The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	0	6785	6179177	transposase	uncultured_Caudovirales_phage(50.0%)	4	NA	NA
AUV96165.1|22_1522_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AUV96166.1|1599_3501_-	NTPase KAP	NA	NA	NA	NA	NA
AUV96167.1|3657_4473_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	42.6	9.7e-52
AUV96168.1|5840_6785_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.5	1.3e-55
>prophage 2
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	19811	27662	6179177		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
AUV96182.1|19811_22499_-	carbonate dehydratase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.8	3.6e-71
AUV96183.1|22549_22981_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	42.8	8.5e-23
AUV96184.1|23514_24600_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUV96185.1|24599_27662_+	AcrB/AcrD/AcrF family protein	NA	S5VL66	Leptospira_phage	22.2	1.2e-25
>prophage 3
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	36792	38061	6179177		Pseudomonas_phage(100.0%)	1	NA	NA
AUV96193.1|36792_38061_+	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	41.1	3.6e-77
>prophage 4
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	49552	49738	6179177		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUV96204.1|49552_49738_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	52.0	4.3e-08
>prophage 5
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	65132	66311	6179177		Caulobacter_phage(100.0%)	1	NA	NA
AUW01636.1|65132_66311_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	40.3	1.5e-53
>prophage 6
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	70276	71445	6179177		Shigella_phage(100.0%)	1	NA	NA
AUV96222.1|70276_71445_-	DDE domain-containing protein	NA	Q716C2	Shigella_phage	89.8	6.9e-168
>prophage 7
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	76178	76982	6179177		Streptococcus_phage(100.0%)	1	NA	NA
AUV96226.1|76178_76982_-	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	37.3	1.8e-34
>prophage 8
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	89753	90668	6179177		Lactobacillus_phage(100.0%)	1	NA	NA
AUV96235.1|89753_90668_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	30.2	1.5e-08
>prophage 9
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	131898	136878	6179177		Stx2-converting_phage(50.0%)	3	NA	NA
AUV96273.1|131898_133071_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	81.2	8.1e-185
AUV96274.1|133245_134670_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AUV96275.1|134775_136878_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	6.3e-63
>prophage 10
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	150269	152327	6179177		uncultured_virus(50.0%)	2	NA	NA
AUV96286.1|150269_151094_+	Fe-S cluster assembly protein NifU	NA	A0A218MKD1	uncultured_virus	45.1	9.5e-23
AUV96287.1|151124_152327_+	cysteine desulfurase NifS	NA	A0A1X7C038	Faustovirus	27.5	2.6e-29
>prophage 11
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	167133	168033	6179177		Cellulophaga_phage(100.0%)	1	NA	NA
AUW01642.1|167133_168033_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	89.5	5.4e-11
>prophage 12
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	173577	192210	6179177		Escherichia_phage(18.18%)	15	NA	NA
AUV96308.1|173577_174177_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A1V0SIZ6	Klosneuvirus	34.2	1.5e-17
AUV96309.1|174260_175580_-	glycosyl transferase	NA	A0A1V0SAH6	Catovirus	36.0	7.4e-09
AUV96310.1|175711_176845_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AUV96311.1|176857_177751_-	glycosyl transferase	NA	NA	NA	NA	NA
AUV96312.1|177747_178902_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	40.9	3.0e-75
AUV96313.1|178920_180813_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
AUV96314.1|180826_181567_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	24.8	1.1e-06
AUV96315.1|181566_182334_-	ABC transporter permease	NA	NA	NA	NA	NA
AUV96316.1|183639_184644_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	30.1	3.6e-32
AUV96317.1|185811_186978_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.0	7.0e-112
AUV96318.1|187151_187706_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.7	7.3e-51
AUV96319.1|187721_188612_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.1	2.4e-27
AUV96320.1|188643_189513_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.7	1.7e-110
AUV96321.1|189526_190591_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.2e-104
AUV96322.1|190803_192210_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.9	4.3e-39
>prophage 13
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	196008	198456	6179177		Catovirus(50.0%)	2	NA	NA
AUV96326.1|196008_196779_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	30.8	2.2e-05
AUV96327.1|196806_198456_-	hypothetical protein	NA	A0A0U3C9T3	Klebsiella_phage	34.5	1.8e-81
>prophage 14
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	208911	215798	6179177		Bacillus_phage(25.0%)	5	NA	NA
AUW01643.1|208911_209802_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.0	5.6e-45
AUV96335.1|210784_212371_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.0	2.9e-36
AUV96336.1|212609_214457_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AUV96337.1|214484_215066_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.6	1.3e-31
AUV96338.1|215156_215798_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.3	1.7e-35
>prophage 15
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	228689	229664	6179177		Planktothrix_phage(100.0%)	1	NA	NA
AUV96347.1|228689_229664_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	1.5e-19
>prophage 16
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	248165	256560	6179177		Bacillus_phage(33.33%)	8	NA	NA
AUV96362.1|248165_249701_+	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	27.6	2.8e-28
AUV96363.1|249697_250420_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	2.4e-30
AUV96364.1|250738_252100_+	U32 family peptidase	NA	Q6DW11	Phage_TP	91.8	6.1e-200
AUV96365.1|252344_253238_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.9	8.8e-14
AUV96366.1|253238_253709_-	hypothetical protein	NA	NA	NA	NA	NA
AUV96367.1|253695_254496_-	CadC family transcriptional regulator	NA	NA	NA	NA	NA
AUV96368.1|254912_255686_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	7.8e-27
AUW01646.1|255696_256560_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	3.9e-11
>prophage 17
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	265194	266562	6179177		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AUV96376.1|265194_266562_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	28.3	1.2e-43
>prophage 18
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	274601	276578	6179177		Tetraselmis_virus(100.0%)	1	NA	NA
AUV96383.1|274601_276578_+	alkyl/aryl-sulfatase	NA	A0A2P0VMX1	Tetraselmis_virus	45.5	3.1e-160
>prophage 19
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	285041	293994	6179177	tRNA	Enterobacteria_phage(60.0%)	9	NA	NA
AUV96392.1|285041_287075_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.5	8.0e-55
AUV96393.1|287275_287743_+	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AUV96394.1|287846_288314_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	79.9	5.1e-66
AUV96395.1|288367_289087_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AUV96396.1|289080_290769_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.5	1.9e-259
AUV96397.1|290979_291738_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	69.8	4.7e-77
AUV96398.1|292237_292351_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96399.1|292325_293063_-	ABC transporter permease	NA	NA	NA	NA	NA
AUV96400.1|293046_293994_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	6.2e-10
>prophage 20
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	300567	301122	6179177		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUV96405.1|300567_301122_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.2	3.9e-20
>prophage 21
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	305317	306052	6179177		Streptococcus_phage(100.0%)	1	NA	NA
AUV96410.1|305317_306052_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	41.6	2.1e-50
>prophage 22
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	321961	323482	6179177		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AUV96426.1|321961_323482_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
>prophage 23
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	327240	331207	6179177		Cellulophaga_phage(50.0%)	3	NA	NA
AUV96430.1|327240_327909_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	6.9e-56
AUV96431.1|328277_329114_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AUV96432.1|329233_331207_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.8	8.1e-12
>prophage 24
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	335324	336182	6179177		Catovirus(100.0%)	1	NA	NA
AUV96437.1|335324_336182_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	30.5	1.5e-23
>prophage 25
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	347408	351716	6179177		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
AUV96447.1|347408_348875_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.1	6.6e-43
AUV96448.1|348993_349971_+	GTP-binding protein	NA	NA	NA	NA	NA
AUV96449.1|350012_350720_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AUV96450.1|351146_351716_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	5.2e-12
>prophage 26
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	357475	440370	6179177	plate,transposase,holin	Vibrio_phage(10.53%)	66	NA	NA
AUV96454.1|357475_359065_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	4.7e-18
AUV96455.1|359068_359413_-	hypothetical protein	NA	NA	NA	NA	NA
AUV96456.1|359743_360940_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	24.8	2.8e-23
AUV96457.1|360936_361656_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
AUV96458.1|361804_363562_+	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	42.4	5.8e-102
AUV96459.1|363699_363984_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
AUV96460.1|364045_364639_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AUV96461.1|364719_365478_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AUV96462.1|365527_366535_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.5	3.1e-84
AUW01650.1|366713_366941_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96463.1|366960_368721_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
AUV96464.1|369168_369621_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AUV96465.1|369613_370156_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AUV96466.1|370130_371234_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AUV96467.1|371188_372952_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AUV96468.1|372975_373710_-	hypothetical protein	NA	NA	NA	NA	NA
AUV96469.1|373774_373969_-	hypothetical protein	NA	NA	NA	NA	NA
AUV96470.1|373958_374321_-	type VI secretion protein	NA	NA	NA	NA	NA
AUV96471.1|374320_377740_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AUV96472.1|377726_378887_-	hypothetical protein	NA	NA	NA	NA	NA
AUV96473.1|378890_379157_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AUV96474.1|379186_379867_-	hypothetical protein	NA	NA	NA	NA	NA
AUV96475.1|379863_381768_-	LysM domain-containing protein	NA	S6BFI4	Thermus_phage	53.5	3.2e-05
AUV96476.1|381776_382316_-	hypothetical protein	NA	NA	NA	NA	NA
AUV96477.1|382308_384924_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AUV96478.1|384991_385219_-	hypothetical protein	NA	NA	NA	NA	NA
AUV96479.1|385215_385857_-	hypothetical protein	NA	NA	NA	NA	NA
AUV96480.1|387466_387958_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUW01651.1|387962_389591_-	cell envelope biogenesis protein OmpA	NA	NA	NA	NA	NA
AUV96481.1|389690_390344_-	type VI secretion system protein ImpK	NA	NA	NA	NA	NA
AUV96482.1|390340_391678_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AUV96483.1|391696_393247_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AUV96484.1|393283_393781_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AUV96485.1|394762_395869_+	AI-2E family transporter	NA	NA	NA	NA	NA
AUV96486.1|396071_396563_+	ecotin	NA	NA	NA	NA	NA
AUV96487.1|396607_398242_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AUV96488.1|398521_399769_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	44.3	9.5e-67
AUV96489.1|399731_401168_-	magnesium transporter	NA	NA	NA	NA	NA
AUV96490.1|401336_402980_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.6	1.2e-08
AUV96491.1|403056_403707_-	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
AUV96492.1|403706_404771_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	L7Y5F8	Megavirus	47.2	1.4e-18
AUV96493.1|404843_405896_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AUV96494.1|405998_407117_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.5	1.9e-119
AUV96495.1|407888_410549_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
AUV96496.1|410565_411216_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
AUV96497.1|411260_414107_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.3	3.4e-43
AUV96498.1|414237_416871_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.8	1.6e-92
AUV96499.1|417056_417785_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
AUV96500.1|418129_420415_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.9	3.5e-285
AUV96501.1|420518_421649_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	7.3e-175
AUV96502.1|421648_421903_+	2Fe-2S ferredoxin	NA	G9IAA2	Pseudomonas_phage	64.0	8.2e-26
AUV96503.1|422095_423640_+|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0SI18	Klosneuvirus	28.3	3.0e-38
AUV96504.1|423684_424641_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUV96505.1|424645_425713_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	42.9	3.9e-08
AUW01652.1|425722_427069_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
AUV96506.1|427340_428963_+	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
AUV96507.1|428952_430212_+	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
AUV96508.1|430208_431387_+	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
AUV96509.1|431409_432213_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
AUV96510.1|432227_433517_-	MFS transporter	NA	NA	NA	NA	NA
AUV96511.1|433569_434775_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.8e-25
AUV96512.1|434788_435571_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUV96513.1|435775_436972_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
AUV96514.1|437068_437611_-	hypothetical protein	NA	NA	NA	NA	NA
AUV96515.1|437880_439329_+	catalase	NA	A0A2K9L0T1	Tupanvirus	46.7	6.9e-101
AUV96516.1|439377_440370_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	56.3	2.7e-72
>prophage 27
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	461938	462490	6179177	integrase	Escherichia_phage(100.0%)	1	452002:452015	463528:463541
452002:452015	attL	CGAGACCAGCCAGC	NA	NA	NA	NA
AUV96538.1|461938_462490_-|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	51.6	2.1e-50
AUV96538.1|461938_462490_-|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	51.6	2.1e-50
463528:463541	attR	CGAGACCAGCCAGC	NA	NA	NA	NA
>prophage 28
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	481479	482079	6179177		Salmonella_phage(100.0%)	1	NA	NA
AUV96555.1|481479_482079_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 29
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	493895	494915	6179177		Enterobacteria_phage(100.0%)	1	NA	NA
AUV96567.1|493895_494915_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.7	3.6e-19
>prophage 30
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	499181	501386	6179177		Salmonella_phage(66.67%)	4	NA	NA
AUV96574.1|499181_499436_+	hypothetical protein	NA	J9Q735	Salmonella_phage	44.7	8.3e-10
AUV96575.1|499439_500006_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	61.3	1.2e-45
AUW01653.1|500073_500571_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUV96576.1|500612_501386_-	histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.7	3.9e-10
>prophage 31
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	505679	507197	6179177		Mollivirus(100.0%)	1	NA	NA
AUV96582.1|505679_507197_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.4e-88
>prophage 32
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	513619	514756	6179177		Brazilian_cedratvirus(100.0%)	1	NA	NA
AUV96590.1|513619_514756_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	1.5e-21
>prophage 33
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	523169	524258	6179177		Pandoravirus(100.0%)	1	NA	NA
AUV96598.1|523169_524258_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
>prophage 34
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	533377	538334	6179177		Enterobacteria_phage(33.33%)	5	NA	NA
AUV96606.1|533377_534274_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	78.2	8.5e-126
AUV96607.1|534501_534837_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AUV96608.1|535507_535762_+	late histone H1	NA	NA	NA	NA	NA
AUV96609.1|536357_537221_+	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	25.2	4.5e-07
AUV96610.1|537401_538334_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	6.1e-10
>prophage 35
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	543495	544239	6179177		Clostridioides_phage(100.0%)	1	NA	NA
AUW01657.1|543495_544239_+	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.6	9.5e-14
>prophage 36
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	562165	572040	6179177		Lactobacillus_phage(25.0%)	9	NA	NA
AUV96628.1|562165_563092_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	26.3	8.8e-09
AUV96629.1|563181_564180_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
AUV96630.1|564176_564395_-	hypothetical protein	NA	NA	NA	NA	NA
AUV96631.1|564387_566412_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.1	6.8e-147
AUW01658.1|566486_567503_-	cell division protein ZipA	NA	NA	NA	NA	NA
AUV96632.1|567736_568498_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
AUV96633.1|568657_569629_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	1.1e-75
AUV96634.1|570010_570268_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AUV96635.1|570312_572040_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	32.0	3.3e-17
>prophage 37
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	576288	584881	6179177		Streptococcus_phage(25.0%)	11	NA	NA
AUW01659.1|576288_577200_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	42.1	1.0e-57
AUV96642.1|577266_578361_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.5	1.4e-29
AUV96643.1|578350_579226_-	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
AUV96644.1|579225_580059_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
AUV96645.1|580058_581075_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV96646.1|581300_582200_-	peroxidase	NA	S4VVJ7	Pandoravirus	32.6	1.9e-24
AUV96647.1|582293_582869_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AUV96648.1|582932_583382_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AUV96649.1|583368_583794_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AUV96650.1|583815_584013_-	hypothetical protein	NA	NA	NA	NA	NA
AUV96651.1|584005_584881_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	32.4	7.5e-18
>prophage 38
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	618370	620070	6179177		Rhodococcus_phage(50.0%)	2	NA	NA
AUV96678.1|618370_619237_-	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	34.5	9.7e-34
AUV96679.1|619356_620070_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	2.4e-38
>prophage 39
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	627336	628626	6179177		Enterobacteria_phage(100.0%)	1	NA	NA
AUV96688.1|627336_628626_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	9.2e-65
>prophage 40
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	632129	633805	6179177		Prochlorococcus_phage(100.0%)	2	NA	NA
AUV96692.1|632129_633167_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	1.4e-71
AUV96693.1|633163_633805_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.2	1.2e-28
>prophage 41
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	646227	646437	6179177		Escherichia_phage(100.0%)	1	NA	NA
AUV96701.1|646227_646437_+	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	73.9	2.5e-20
>prophage 42
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	650417	653419	6179177		Klosneuvirus(50.0%)	2	NA	NA
AUV96705.1|650417_651884_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	9.8e-87
AUV96706.1|652042_653419_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	3.8e-40
>prophage 43
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	666861	667293	6179177		Powai_lake_megavirus(100.0%)	1	NA	NA
AUW01666.1|666861_667293_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 44
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	679464	685822	6179177		Mycoplasma_phage(20.0%)	8	NA	NA
AUV96726.1|679464_680751_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.6	3.4e-35
AUV96727.1|680857_681058_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AUV96728.1|681059_681395_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AUV96729.1|681396_683247_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.8	1.9e-103
AUV96730.1|683262_683778_-	co-chaperone HscB	NA	NA	NA	NA	NA
AUV96731.1|683851_684175_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
AUV96732.1|684194_684581_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
AUV96733.1|684607_685822_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.6e-34
>prophage 45
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	700144	715778	6179177	tRNA	Bacillus_phage(33.33%)	13	NA	NA
AUV96745.1|700144_701398_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	3.3e-99
AUV96746.1|701599_701779_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96747.1|701723_702914_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AUV96748.1|702972_703311_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
AUV96749.1|703376_704714_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	33.1	3.0e-10
AUV96750.1|704700_705405_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AUW01668.1|705418_706855_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.0	1.3e-11
AUW01669.1|707417_711305_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	1.0e-130
AUV96751.1|711479_713096_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
AUV96752.1|713092_713638_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	4.5e-05
AUV96753.1|713657_714293_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
AUV96754.1|714502_715351_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AUV96755.1|715517_715778_+	4Fe-4S dicluster domain-containing protein	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	3.2e-17
>prophage 46
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	718785	722482	6179177		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
AUV96760.1|718785_719466_-	ribonuclease 3	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.5	2.8e-20
AUW01671.1|719409_719640_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96761.1|719692_720667_-	signal peptidase I	NA	NA	NA	NA	NA
AUV96762.1|720682_722482_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.3	6.5e-24
>prophage 47
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	727386	794238	6179177	plate,tRNA,tail,capsid,terminase,integrase,holin,portal,head,transposase	Escherichia_phage(29.17%)	73	753895:753911	789704:789720
AUV96768.1|727386_728127_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
AUV96769.1|728259_729591_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	1.1e-44
AUV96770.1|729636_730020_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	69.9	3.1e-32
AUV96771.1|730331_731021_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	51.2	4.6e-55
AUV96772.1|731104_731539_-|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	6.8e-20
AUV96773.1|731706_732780_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AUV96774.1|732983_733409_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	4.6e-13
AUV96775.1|733478_734177_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AUV96776.1|734212_736891_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AUV96777.1|736984_738340_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AUV96778.1|738379_738706_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96779.1|738708_740007_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.1	3.1e-44
AUW01673.1|740280_740736_-	DUF4385 domain-containing protein	NA	A0A222YVL1	Synechococcus_phage	47.3	4.7e-32
AUV96780.1|746676_749250_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.7	3.1e-128
AUV96781.1|749377_750109_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AUV96782.1|750105_751086_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AUV96783.1|751218_751956_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AUV96784.1|752227_752563_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AUW01674.1|752670_752718_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96785.1|752824_753985_+	prephenate dehydratase	NA	NA	NA	NA	NA
753895:753911	attL	GGCATTAAAAGAGCTGG	NA	NA	NA	NA
AUW01675.1|753981_754854_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AUV96786.1|754922_756044_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AUV96787.1|756053_757124_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	4.8e-91
AUV96788.1|757468_757978_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AUV96789.1|757970_759194_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUV96790.1|759205_759688_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96791.1|759692_761063_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
AUV96792.1|761116_761554_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AUV96793.1|761786_762818_-|integrase	integrase	integrase	A0A0M4S6G4	Salmonella_phage	83.7	1.6e-173
AUV96794.1|762820_763693_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	44.2	3.9e-67
AUV96795.1|763816_764044_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96796.1|764075_764585_+	hypothetical protein	NA	Q6K1F8	Salmonella_virus	93.5	2.7e-84
AUV96797.1|764592_764793_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	71.0	1.2e-16
AUW01676.1|764873_765161_+	hypothetical protein	NA	F1BUS4	Erwinia_phage	57.0	1.8e-24
AUV96798.1|765226_765451_+	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	71.9	4.4e-15
AUV96799.1|765450_765672_+	hypothetical protein	NA	A0A0M4S5Q7	Salmonella_phage	78.1	9.3e-26
AUV96800.1|765672_765951_+	hypothetical protein	NA	A0A0M4R2Q0	Salmonella_phage	75.0	1.2e-33
AUV96801.1|765943_766948_+	hypothetical protein	NA	B7SYG0	Stenotrophomonas_phage	42.6	5.0e-66
AUV96802.1|766944_769164_+	replication protein	NA	A0A218M4H2	Erwinia_phage	90.3	0.0e+00
AUV96803.1|769285_769468_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	78.3	5.3e-19
AUV96804.1|769471_769702_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	69.7	2.8e-25
AUV96805.1|769781_770513_+	hypothetical protein	NA	Q37850	Escherichia_phage	93.8	6.7e-129
AUV96806.1|770635_771253_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96807.1|771344_771596_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96808.1|771568_772612_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.1	4.4e-166
AUV96809.1|772611_774381_-	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	88.3	2.5e-307
AUV96810.1|774546_775401_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.3	1.6e-126
AUV96811.1|775474_776533_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.2	2.3e-162
AUV96812.1|776536_777280_+|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	80.3	1.1e-99
AUV96813.1|777376_777883_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
AUV96814.1|777882_778086_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	80.6	4.2e-25
AUV96815.1|778090_778381_+|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	80.6	2.2e-35
AUV96816.1|778367_778865_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	87.3	7.9e-81
AUV96817.1|778861_779293_+	protein lysB	NA	O80310	Escherichia_phage	64.0	3.4e-40
AUV96818.1|779388_779856_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	73.5	2.6e-62
AUV96819.1|779848_780298_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.0	7.2e-49
AUV96820.1|780366_781008_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.9	5.7e-92
AUV96821.1|781004_781352_+|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	78.3	1.3e-45
AUV96822.1|781356_782265_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	70.9	1.4e-112
AUV96823.1|782257_782854_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	51.4	3.1e-47
AUV96824.1|782861_784775_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0U3DL17	Klebsiella_phage	42.4	8.2e-110
AUV96825.1|784771_785026_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96826.1|785069_786230_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	41.7	7.8e-47
AUV96827.1|786340_787522_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	86.1	8.7e-195
AUV96828.1|787535_788051_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
AUV96829.1|788111_788387_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
AUV96830.1|788401_788539_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	88.9	6.4e-17
AUV96831.1|788531_790973_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	73.0	2.4e-295
789704:789720	attR	GGCATTAAAAGAGCTGG	NA	NA	NA	NA
AUV96832.1|790986_791466_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	77.7	6.9e-66
AUV96833.1|791465_792626_+	hypothetical protein	NA	Q7Y4C6	Escherichia_virus	81.2	1.2e-175
AUV96834.1|792706_792925_+	transcriptional regulator	NA	Q37973	Salmonella_virus	84.7	7.8e-33
AUV96835.1|793083_793431_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AUV96836.1|793470_794238_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 48
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	803796	804279	6179177		Staphylococcus_phage(100.0%)	1	NA	NA
AUV96847.1|803796_804279_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	1.8e-29
>prophage 49
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	814285	817465	6179177		Feldmannia_irregularis_virus(100.0%)	1	NA	NA
AUV96855.1|814285_817465_-	histidine kinase	NA	Q6XM27	Feldmannia_irregularis_virus	21.6	2.9e-19
>prophage 50
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	825697	827218	6179177		Pithovirus(100.0%)	1	NA	NA
AUV96864.1|825697_827218_+	amino acid ABC transporter permease/ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	3.9e-14
>prophage 51
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	834587	835229	6179177		Bacillus_virus(100.0%)	1	NA	NA
AUW01679.1|834587_835229_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	23.9	2.6e-12
>prophage 52
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	838293	841779	6179177		Mollivirus(50.0%)	4	NA	NA
AUV96875.1|838293_839070_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.2	4.2e-12
AUV96876.1|839215_840136_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUV96877.1|840175_840949_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV96878.1|840984_841779_-	antibiotic acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	28.6	3.5e-06
>prophage 53
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	857717	863008	6179177		Gordonia_phage(25.0%)	5	NA	NA
AUV96896.1|857717_857963_+	NrdH-redoxin	NA	A0A0E3T8B5	Gordonia_phage	37.3	6.1e-10
AUV96897.1|857959_858370_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
AUV96898.1|858342_860487_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.0	2.0e-189
AUV96899.1|860497_861460_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	70.8	1.2e-130
AUV96900.1|861805_863008_+	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.2	2.9e-28
>prophage 54
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	877891	886175	6179177	tRNA	Vibrio_phage(20.0%)	9	NA	NA
AUV96915.1|877891_878077_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AUV96916.1|878315_880943_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	39.0	9.9e-82
AUV96917.1|881073_881574_-	recombination regulator RecX	NA	NA	NA	NA	NA
AUV96918.1|881645_882704_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.1	5.2e-114
AUV96919.1|882784_883282_-	hypothetical protein	NA	B5TK85	Pseudomonas_phage	47.8	1.3e-27
AUV96920.1|883486_883714_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96921.1|883750_884629_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV96922.1|884637_885501_-	iron ABC transporter	NA	NA	NA	NA	NA
AUV96923.1|885497_886175_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	3.5e-07
>prophage 55
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	891783	892749	6179177		Tetraselmis_virus(100.0%)	1	NA	NA
AUV96931.1|891783_892749_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	32.9	4.0e-36
>prophage 56
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	934335	935157	6179177		Brazilian_cedratvirus(100.0%)	1	NA	NA
AUV96969.1|934335_935157_+	manganese/iron transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	2.6e-12
>prophage 57
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	943126	946456	6179177		Cedratvirus(33.33%)	3	NA	NA
AUV96978.1|943126_943906_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.8	1.3e-10
AUV96979.1|944097_945351_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	30.9	1.3e-44
AUV96980.1|945688_946456_+	KR domain-containing protein	NA	A0A0N9R355	Chrysochromulina_ericina_virus	27.9	1.4e-20
>prophage 58
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	959286	964498	6179177		Planktothrix_phage(66.67%)	3	NA	NA
AUV96994.1|959286_961230_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.9	1.7e-30
AUV96995.1|961229_962390_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
AUV96996.1|962386_964498_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.2	1.5e-16
>prophage 59
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	981811	989146	6179177	integrase	Cellulophaga_phage(33.33%)	5	982454:982468	989406:989420
AUV97014.1|981811_982321_+	helix-turn-helix domain-containing protein	NA	M1PL54	Cellulophaga_phage	48.8	2.4e-40
982454:982468	attL	CATGCTAACAAAATA	NA	NA	NA	NA
AUV97015.1|983090_983297_-	hypothetical protein	NA	NA	NA	NA	NA
AUV97016.1|984373_984955_-	hypothetical protein	NA	NA	NA	NA	NA
AUV97017.1|984964_986419_-|integrase	integrase	integrase	A0A0R6PHE0	Moraxella_phage	28.7	4.4e-23
AUW01682.1|986578_989146_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.5	3.9e-30
989406:989420	attR	TATTTTGTTAGCATG	NA	NA	NA	NA
>prophage 60
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	995255	999030	6179177		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AUV97026.1|995255_996248_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AUV97027.1|996407_997526_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.6	6.5e-06
AUV97028.1|997648_998275_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	2.4e-34
AUV97029.1|998268_999030_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.6	2.2e-58
>prophage 61
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1002103	1004136	6179177		Tupanvirus(50.0%)	2	NA	NA
AUV97035.1|1002103_1002709_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	36.5	6.1e-27
AUV97036.1|1002708_1004136_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.3	3.9e-32
>prophage 62
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1012317	1013466	6179177		unidentified_phage(100.0%)	1	NA	NA
AUV97043.1|1012317_1013466_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	38.3	2.3e-35
>prophage 63
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1020137	1025462	6179177		Vibrio_phage(33.33%)	4	NA	NA
AUW01684.1|1020137_1020809_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.5e-15
AUV97049.1|1021269_1022379_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
AUV97050.1|1022445_1023744_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.6	2.8e-130
AUV97051.1|1023824_1025462_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.3	1.1e-155
>prophage 64
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1028884	1034293	6179177		Erysipelothrix_phage(33.33%)	3	NA	NA
AUV97054.1|1028884_1030228_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.6	1.4e-34
AUV97055.1|1030350_1033104_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.6	1.2e-48
AUV97056.1|1033153_1034293_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	7.2e-45
>prophage 65
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1041734	1042580	6179177		Vibrio_phage(100.0%)	1	NA	NA
AUV97064.1|1041734_1042580_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 66
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1054978	1055734	6179177		Bacillus_phage(100.0%)	1	NA	NA
AUV97074.1|1054978_1055734_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	31.1	4.2e-09
>prophage 67
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1066453	1069028	6179177	tRNA	environmental_halophage(50.0%)	3	NA	NA
AUV97084.1|1066453_1067659_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.0	4.4e-69
AUV97085.1|1067658_1068096_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AUV97086.1|1068218_1069028_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.3	2.5e-15
>prophage 68
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1074061	1074877	6179177		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AUV97091.1|1074061_1074877_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.8	2.5e-07
>prophage 69
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1108828	1119942	6179177		Deep-sea_thermophilic_phage(25.0%)	5	NA	NA
AUW01686.1|1108828_1110082_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	29.4	5.0e-15
AUV97131.1|1110309_1111641_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
AUV97132.1|1111682_1113518_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	42.5	2.6e-04
AUV97133.1|1113514_1117060_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.9	8.0e-10
AUV97134.1|1117056_1119942_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.7	9.9e-59
>prophage 70
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1125416	1144412	6179177		Geobacillus_virus(16.67%)	19	NA	NA
AUV97141.1|1125416_1126211_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	72.0	2.6e-118
AUV97142.1|1126217_1127093_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AUV97143.1|1127388_1129635_-	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	22.9	1.5e-09
AUV97144.1|1129647_1130178_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AUV97145.1|1130217_1130400_-	hypothetical protein	NA	NA	NA	NA	NA
AUV97146.1|1130619_1130844_+	hypothetical protein	NA	NA	NA	NA	NA
AUV97147.1|1130860_1131556_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
AUV97148.1|1131637_1132351_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	1.0e-44
AUV97149.1|1132475_1132694_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
AUV97150.1|1132931_1133972_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AUV97151.1|1134071_1135265_-	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
AUV97152.1|1135257_1137417_-	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.4	4.9e-18
AUV97153.1|1137440_1137632_-	hypothetical protein	NA	NA	NA	NA	NA
AUV97154.1|1138039_1139056_+	HTH-type transcriptional regulator GalR	NA	NA	NA	NA	NA
AUV97155.1|1139016_1139496_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUV97156.1|1139492_1140266_-	FCD domain-containing protein	NA	NA	NA	NA	NA
AUV97157.1|1140334_1141762_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	27.6	4.5e-36
AUV97158.1|1141769_1143107_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AUV97159.1|1143401_1144412_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	29.8	3.4e-30
>prophage 71
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1155806	1156934	6179177		Bacillus_phage(100.0%)	1	NA	NA
AUV97171.1|1155806_1156934_+	sugar ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.9	3.9e-11
>prophage 72
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1165013	1167505	6179177		Aichi_virus(50.0%)	2	NA	NA
AUV97179.1|1165013_1166432_-	arabinose-proton symporter	NA	O13311	Aichi_virus	28.2	1.6e-25
AUV97180.1|1166743_1167505_-	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	1.4e-20
>prophage 73
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1198549	1202396	6179177		Acinetobacter_phage(50.0%)	3	NA	NA
AUV97212.1|1198549_1200103_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.8	6.6e-158
AUV97213.1|1200600_1201023_-	hypothetical protein	NA	NA	NA	NA	NA
AUV97214.1|1201622_1202396_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	6.8e-23
>prophage 74
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1209694	1211251	6179177		Catovirus(100.0%)	1	NA	NA
AUV97222.1|1209694_1211251_+	AMP-dependent synthetase	NA	A0A1V0SBX8	Catovirus	25.2	8.7e-17
>prophage 75
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1218613	1219789	6179177		Streptococcus_phage(100.0%)	1	NA	NA
AUV97229.1|1218613_1219789_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.8	7.7e-42
>prophage 76
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1224931	1227066	6179177		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
AUV97234.1|1224931_1225357_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	1.2e-50
AUV97235.1|1225370_1226663_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.8	7.4e-171
AUV97236.1|1226715_1227066_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.4	1.3e-24
>prophage 77
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1232356	1233037	6179177		Bacillus_phage(100.0%)	1	NA	NA
AUV97240.1|1232356_1233037_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.4	1.0e-30
>prophage 78
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1239339	1240191	6179177		Staphylococcus_phage(100.0%)	1	NA	NA
AUV97247.1|1239339_1240191_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.9	6.8e-48
>prophage 79
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1243197	1270477	6179177	integrase,transposase,capsid	Escherichia_phage(33.33%)	27	1249362:1249375	1270306:1270319
AUV97251.1|1243197_1243449_+	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	57.7	1.5e-08
AUV97252.1|1244498_1245740_-	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
AUW01688.1|1245847_1246666_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	61.4	9.0e-90
AUV97253.1|1246687_1247807_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AUV97254.1|1248731_1249881_+	DDE domain-containing protein	NA	U5P429	Shigella_phage	41.5	5.4e-48
1249362:1249375	attL	AAAATCTGCTGAAA	NA	NA	NA	NA
AUV97255.1|1249894_1250992_+|integrase	integrase	integrase	H7BVE3	unidentified_phage	33.6	3.4e-07
AUV97256.1|1251004_1252792_-	hypothetical protein	NA	A0A291LB80	Escherichia_phage	34.2	1.9e-39
AUV97257.1|1252796_1252985_-	hypothetical protein	NA	NA	NA	NA	NA
AUV97258.1|1253087_1254128_-|capsid	major capsid protein E	capsid	NA	NA	NA	NA
AUV97259.1|1254146_1254518_-	hypothetical protein	NA	NA	NA	NA	NA
AUV97260.1|1254518_1254761_-	hypothetical protein	NA	NA	NA	NA	NA
AUV97261.1|1255639_1256086_-	hypothetical protein	NA	NA	NA	NA	NA
AUV97262.1|1256364_1256742_-	hypothetical protein	NA	NA	NA	NA	NA
AUV97263.1|1256865_1257501_-	hypothetical protein	NA	I7I023	Enterobacteria_phage	50.3	3.7e-43
AUV97264.1|1257656_1257860_-	hypothetical protein	NA	NA	NA	NA	NA
AUV97265.1|1257860_1258178_-	hypothetical protein	NA	NA	NA	NA	NA
AUV97266.1|1258188_1259454_-	hypothetical protein	NA	NA	NA	NA	NA
AUV97267.1|1259792_1259981_-	hypothetical protein	NA	NA	NA	NA	NA
AUV97268.1|1261483_1262116_+	hypothetical protein	NA	NA	NA	NA	NA
AUV97269.1|1262144_1263548_-|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
AUW01689.1|1264176_1264380_+	hypothetical protein	NA	NA	NA	NA	NA
AUV97270.1|1264455_1264731_+	hypothetical protein	NA	NA	NA	NA	NA
AUV97271.1|1264814_1265018_-	hypothetical protein	NA	NA	NA	NA	NA
AUV97272.1|1265407_1266589_+|integrase	integrase	integrase	NA	NA	NA	NA
AUV97273.1|1266724_1267921_+	enoyl-[acyl-carrier-protein] reductase FabV	NA	NA	NA	NA	NA
AUV97274.1|1267942_1268623_-	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	73.0	1.3e-73
AUV97275.1|1268623_1270477_-	hypothetical protein	NA	A0A291LB80	Escherichia_phage	30.6	6.7e-32
1270306:1270319	attR	TTTCAGCAGATTTT	NA	NA	NA	NA
>prophage 80
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1277083	1280579	6179177	integrase	Bacillus_phage(33.33%)	3	1272925:1272937	1278523:1278535
1272925:1272937	attL	AAGAAGAAAGAAC	NA	NA	NA	NA
AUV97284.1|1277083_1277662_+|integrase	integrase	integrase	A0A0S2GLG4	Bacillus_phage	25.8	1.0e-10
AUV97285.1|1277708_1279091_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	34.4	1.6e-09
1278523:1278535	attR	GTTCTTTCTTCTT	NA	NA	NA	NA
AUV97286.1|1279853_1280579_-	LysM peptidoglycan-binding domain-containing protein	NA	I3PV79	Clostridium_phage	35.0	2.5e-11
>prophage 81
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1285237	1291320	6179177	tRNA	Catovirus(25.0%)	5	NA	NA
AUV97292.1|1285237_1286755_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	7.7e-87
AUV97293.1|1286764_1287863_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
AUV97294.1|1287948_1289682_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.9	1.2e-59
AUV97295.1|1289687_1290401_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AUV97296.1|1290423_1291320_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	3.6e-31
>prophage 82
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1303566	1309468	6179177		Pandoravirus(50.0%)	4	NA	NA
AUV97310.1|1303566_1305000_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	5.1e-32
AUV97311.1|1305190_1305682_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
AUV97312.1|1305790_1306534_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUV97313.1|1306594_1309468_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.5	5.7e-264
>prophage 83
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1317645	1318878	6179177		Catovirus(100.0%)	1	NA	NA
AUV97322.1|1317645_1318878_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.9	1.4e-102
>prophage 84
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1336371	1337028	6179177		Bacillus_virus(100.0%)	1	NA	NA
AUV97340.1|1336371_1337028_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.4	5.3e-08
>prophage 85
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1344304	1345459	6179177		Staphylococcus_phage(100.0%)	1	NA	NA
AUV97346.1|1344304_1345459_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	8.1e-129
>prophage 86
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1363473	1364559	6179177		Geobacillus_virus(100.0%)	1	NA	NA
AUV97368.1|1363473_1364559_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	38.1	3.8e-11
>prophage 87
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1369628	1369835	6179177		Vibrio_phage(100.0%)	1	NA	NA
AUV97372.1|1369628_1369835_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	61.2	8.1e-16
>prophage 88
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1378384	1379755	6179177		Streptococcus_phage(100.0%)	1	NA	NA
AUV97380.1|1378384_1379755_+	cystathionine beta-synthase	NA	A0A1X9I5F1	Streptococcus_phage	35.4	3.3e-44
>prophage 89
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1401677	1404188	6179177		Staphylococcus_phage(33.33%)	3	NA	NA
AUV97400.1|1401677_1402505_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	2.1e-62
AUV97401.1|1402603_1403059_+	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.8	2.9e-21
AUV97402.1|1403153_1404188_-	DUF3362 domain-containing protein	NA	M1QSD9	Pseudomonas_phage	70.4	2.1e-104
>prophage 90
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1407660	1408811	6179177		Shigella_phage(100.0%)	1	NA	NA
AUV97405.1|1407660_1408811_-	DDE domain-containing protein	NA	U5P429	Shigella_phage	41.5	5.4e-48
>prophage 91
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1414146	1415256	6179177		Prochlorococcus_phage(100.0%)	1	NA	NA
AUV97410.1|1414146_1415256_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.7	2.2e-30
>prophage 92
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1418548	1421200	6179177		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AUV97414.1|1418548_1421200_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.1	5.4e-152
>prophage 93
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1431687	1432443	6179177		Enterobacteria_phage(100.0%)	1	NA	NA
AUV97424.1|1431687_1432443_+	hypothetical protein	NA	U5N3V8	Enterobacteria_phage	33.9	2.4e-33
>prophage 94
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1446007	1449743	6179177		Bacillus_virus(50.0%)	3	NA	NA
AUV97435.1|1446007_1448266_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	5.7e-86
AUV97436.1|1448388_1449258_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUV97437.1|1449335_1449743_-	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	52.2	1.5e-21
>prophage 95
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1453034	1454930	6179177		Bacillus_virus(100.0%)	1	NA	NA
AUV97442.1|1453034_1454930_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.9	1.4e-90
>prophage 96
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1459252	1466233	6179177		Erwinia_phage(25.0%)	8	NA	NA
AUV97448.1|1459252_1459921_+	DUF1190 domain-containing protein	NA	A0A173GEW8	Erwinia_phage	48.1	4.7e-36
AUV97449.1|1459926_1461087_+	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	44.2	1.3e-89
AUV97450.1|1461133_1461925_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
AUW01697.1|1462118_1462889_+	zinc transporter ZupT	NA	NA	NA	NA	NA
AUV97451.1|1462950_1463604_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.3	1.2e-44
AUV97452.1|1463981_1464263_+	hypothetical protein	NA	NA	NA	NA	NA
AUV97453.1|1464316_1464526_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
AUV97454.1|1464799_1466233_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	5.1e-40
>prophage 97
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1471343	1472585	6179177		Sinorhizobium_phage(100.0%)	1	NA	NA
AUV97458.1|1471343_1472585_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	51.6	2.7e-90
>prophage 98
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1481970	1487535	6179177	tRNA	Moraxella_phage(33.33%)	5	NA	NA
AUV97469.1|1481970_1482984_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	1.5e-107
AUV97470.1|1482992_1483208_-	hypothetical protein	NA	NA	NA	NA	NA
AUV97471.1|1483221_1483437_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AUW01699.1|1483671_1485417_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	4.1e-76
AUV97472.1|1485690_1487535_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
>prophage 99
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1500708	1507297	6179177	tRNA	Klosneuvirus(50.0%)	4	NA	NA
AUV97485.1|1500708_1502115_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	9.2e-34
AUV97486.1|1502152_1502485_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
AUV97487.1|1502704_1503688_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
AUV97488.1|1504204_1507297_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.6	4.1e-159
>prophage 100
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1518661	1520149	6179177		Bacillus_phage(100.0%)	1	NA	NA
AUW01700.1|1518661_1520149_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	W8CYL7	Bacillus_phage	28.6	1.6e-07
>prophage 101
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1532577	1533546	6179177		Escherichia_phage(100.0%)	1	NA	NA
AUV97509.1|1532577_1533546_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	34.6	2.2e-39
>prophage 102
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1549782	1550928	6179177		Streptococcus_phage(100.0%)	1	NA	NA
AUV97530.1|1549782_1550928_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	38.6	2.2e-46
>prophage 103
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1567154	1577316	6179177		Escherichia_phage(16.67%)	12	NA	NA
AUV97546.1|1567154_1567928_+	transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.8	2.6e-22
AUV97547.1|1568997_1569861_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.2	2.1e-49
AUV97548.1|1569924_1572006_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
AUV97549.1|1571963_1572350_+	YraN family protein	NA	NA	NA	NA	NA
AUV97550.1|1572372_1572963_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
AUV97551.1|1572972_1573548_+	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AUV97552.1|1573655_1574696_-	permease	NA	NA	NA	NA	NA
AUV97553.1|1574765_1575416_-	hypothetical protein	NA	NA	NA	NA	NA
AUV97554.1|1575544_1576063_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	29.0	2.4e-11
AUV97555.1|1576042_1576486_-	hypothetical protein	NA	NA	NA	NA	NA
AUV97556.1|1576541_1576826_+	GIY-YIG nuclease family protein	NA	A0A120L170	Cnaphalocrocis_medinalis_granulovirus	50.6	5.8e-12
AUV97557.1|1576812_1577316_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	32.7	1.7e-14
>prophage 104
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1582509	1584471	6179177		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AUV97563.1|1582509_1584471_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	4.7e-52
>prophage 105
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1589870	1601511	6179177	protease	Cafeteria_roenbergensis_virus(25.0%)	8	NA	NA
AUV97570.1|1589870_1592561_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.6	3.9e-25
AUV97571.1|1592585_1594073_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AUV97572.1|1594100_1594553_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AUV97573.1|1595144_1596488_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	94.4	1.6e-64
AUV97574.1|1596740_1597070_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AUV97575.1|1597299_1598637_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AUV97576.1|1598629_1599478_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	31.0	3.7e-22
AUV97577.1|1599576_1601511_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	9.2e-117
>prophage 106
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1608099	1609541	6179177		Indivirus(50.0%)	2	NA	NA
AUV97587.1|1608099_1609071_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.4	1.3e-07
AUV97588.1|1609268_1609541_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	68.3	1.3e-16
>prophage 107
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1613600	1627583	6179177		Staphylococcus_phage(28.57%)	16	NA	NA
AUV97595.1|1613600_1614413_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.8	4.8e-19
AUV97596.1|1614622_1615600_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
AUW01702.1|1615614_1616601_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	32.2	3.5e-40
AUV97597.1|1616615_1617182_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	82.8	1.3e-58
AUV97598.1|1617178_1617754_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AUV97599.1|1617722_1618268_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AUV97600.1|1618274_1619000_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
AUW01703.1|1619047_1620481_+	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AUV97601.1|1620503_1620791_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
AUV97602.1|1620856_1621345_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AUV97603.1|1621390_1622245_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
AUV97604.1|1622241_1622514_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AUV97605.1|1622566_1623292_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AUV97606.1|1623288_1623942_-	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AUV97607.1|1624176_1626516_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.1	6.0e-38
AUV97608.1|1626647_1627583_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.3	2.9e-15
>prophage 108
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1636291	1640287	6179177	protease	Burkholderia_virus(50.0%)	4	NA	NA
AUV97615.1|1636291_1637779_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.9	1.3e-09
AUV97616.1|1637885_1638779_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
AUV97617.1|1638898_1639705_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
AUW01704.1|1639798_1640287_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.7	4.9e-27
>prophage 109
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1644191	1645559	6179177	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AUV97623.1|1644191_1645559_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	24.2	4.3e-20
>prophage 110
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1652707	1653976	6179177		Oenococcus_phage(100.0%)	1	NA	NA
AUV97630.1|1652707_1653976_-	cation transporter	NA	Q6A201	Oenococcus_phage	33.7	3.0e-60
>prophage 111
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1672869	1673913	6179177		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AUV97647.1|1672869_1673913_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 112
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1702817	1704289	6179177	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
AUV97672.1|1702817_1703327_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
AUV97673.1|1703341_1704289_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.8	1.7e-07
>prophage 113
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1724170	1729742	6179177		Tupanvirus(33.33%)	7	NA	NA
AUV97713.1|1724170_1725355_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	8.9e-14
AUV97714.1|1725425_1727540_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.2	6.2e-58
AUV97715.1|1727636_1728107_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
AUV97716.1|1728202_1728577_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
AUV97717.1|1728701_1728989_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
AUV97718.1|1728996_1729356_-	sulfurtransferase TusC	NA	NA	NA	NA	NA
AUV97719.1|1729355_1729742_-	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	1.2e-20
>prophage 114
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1735377	1748229	6179177		Tupanvirus(14.29%)	12	NA	NA
AUV97728.1|1735377_1737282_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.1	3.8e-75
AUW01708.1|1737343_1738834_-	nicotinate phosphoribosyltransferase	NA	K4F7Y4	Cronobacter_phage	49.9	9.1e-141
AUV97729.1|1738838_1739708_-	ribose-phosphate pyrophosphokinase	NA	A0A2P1CBA5	Salmonella_phage	41.3	2.4e-48
AUV97730.1|1739904_1740624_+	NUDIX domain-containing protein	NA	G3MA14	Bacillus_virus	27.3	7.3e-19
AUV97731.1|1740705_1741728_+	hydrolase	NA	NA	NA	NA	NA
AUV97732.1|1741724_1741943_+	hypothetical protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	38.8	4.0e-05
AUV97733.1|1741978_1742851_+	phosphoribulokinase	NA	NA	NA	NA	NA
AUV97734.1|1742894_1743299_-	OsmC family protein	NA	NA	NA	NA	NA
AUV97735.1|1743603_1744236_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AUV97736.1|1744287_1746366_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	86.2	1.8e-62
AUV97737.1|1746355_1747576_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AUV97738.1|1747665_1748229_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	57.1	4.3e-59
>prophage 115
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1760544	1761372	6179177		Vibrio_phage(100.0%)	1	NA	NA
AUV97751.1|1760544_1761372_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	51.1	1.2e-70
>prophage 116
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1776303	1783110	6179177		Staphylococcus_phage(50.0%)	3	NA	NA
AUV97764.1|1776303_1777926_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.9	4.5e-141
AUV97765.1|1778615_1780709_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
AUV97766.1|1780719_1783110_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	1.2e-14
>prophage 117
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1786600	1787359	6179177		Escherichia_phage(100.0%)	1	NA	NA
AUV97769.1|1786600_1787359_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	3.0e-23
>prophage 118
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1790370	1792818	6179177		Dickeya_phage(100.0%)	1	NA	NA
AUV97773.1|1790370_1792818_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	1.6e-33
>prophage 119
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1810513	1812321	6179177		Enterococcus_phage(50.0%)	2	NA	NA
AUV97788.1|1810513_1811254_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	26.1	3.1e-12
AUV97789.1|1811250_1812321_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
>prophage 120
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1820660	1822159	6179177		Anomala_cuprea_entomopoxvirus(100.0%)	2	NA	NA
AUW01711.1|1820660_1821374_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	7.2e-11
AUV97797.1|1821391_1822159_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.4e-14
>prophage 121
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1830093	1835854	6179177		Klosneuvirus(25.0%)	5	NA	NA
AUV97805.1|1830093_1831359_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	3.7e-26
AUV97806.1|1831476_1832991_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.9	1.5e-13
AUV97807.1|1833023_1833878_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
AUW01712.1|1834134_1835193_-	cell division protein FtsX	NA	NA	NA	NA	NA
AUV97808.1|1835185_1835854_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	9.5e-13
>prophage 122
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1838947	1843013	6179177		Dickeya_phage(50.0%)	4	NA	NA
AUV97812.1|1838947_1839574_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	62.8	5.5e-31
AUV97813.1|1839652_1841857_+	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	37.0	4.2e-118
AUW01714.1|1841935_1842181_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	6.1e-10
AUV97814.1|1842347_1843013_+	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	55.8	6.2e-57
>prophage 123
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1866790	1870897	6179177		Tupanvirus(66.67%)	3	NA	NA
AUV97842.1|1866790_1868776_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	1.6e-20
AUV97843.1|1868772_1869756_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.7	2.8e-37
AUV97844.1|1869757_1870897_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.2	2.3e-27
>prophage 124
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1878635	1879406	6179177		Bacillus_virus(100.0%)	1	NA	NA
AUV97853.1|1878635_1879406_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.9	2.5e-17
>prophage 125
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1882573	1883527	6179177		Cedratvirus(100.0%)	1	NA	NA
AUV97857.1|1882573_1883527_+	hydroxyacid dehydrogenase	NA	A0A285PXZ1	Cedratvirus	33.9	5.6e-35
>prophage 126
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1895711	1897754	6179177		Indivirus(100.0%)	1	NA	NA
AUV97868.1|1895711_1897754_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	1.3e-44
>prophage 127
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1908734	1910812	6179177		Bacillus_phage(100.0%)	2	NA	NA
AUV97878.1|1908734_1909454_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
AUV97879.1|1909450_1910812_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.6	1.3e-11
>prophage 128
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1941619	1942732	6179177	transposase	Phage_Gifsy-1(100.0%)	1	NA	NA
AUV97899.1|1941619_1942732_+|transposase	transposase	transposase	Q9G0F2	Phage_Gifsy-1	88.6	9.4e-191
>prophage 129
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1958832	1965044	6179177		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
AUV97911.1|1958832_1960944_-	cellulose synthase catalytic subunit (UDP-forming)	NA	M1I277	Paramecium_bursaria_Chlorella_virus	33.9	3.3e-35
AUV97912.1|1960964_1961768_-	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
AUV97913.1|1961758_1962337_-	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
AUV97914.1|1963050_1964064_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	2.5e-17
AUV97915.1|1964060_1965044_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	1.1e-14
>prophage 130
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1982998	1983970	6179177		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AUV97930.1|1982998_1983970_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.5	1.4e-17
>prophage 131
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1987328	1989260	6179177		Morganella_phage(50.0%)	2	NA	NA
AUV97934.1|1987328_1987541_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	71.4	6.0e-22
AUV97935.1|1987640_1989260_-	ABC transporter ATP-binding protein	NA	A0A2I4R674	Erysipelothrix_phage	25.4	2.8e-26
>prophage 132
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1993647	1994643	6179177		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AUV97940.1|1993647_1994643_+	O-acetyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.2	6.6e-10
>prophage 133
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1999584	2001126	6179177		Staphylococcus_phage(100.0%)	1	NA	NA
AUV97945.1|1999584_2001126_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	1.3e-17
>prophage 134
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2022722	2024564	6179177	tRNA	Tupanvirus(100.0%)	1	NA	NA
AUV97963.1|2022722_2024564_-|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	25.1	2.0e-12
>prophage 135
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2041997	2051271	6179177		Rhizobium_phage(20.0%)	9	NA	NA
AUV97981.1|2041997_2042249_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	7.6e-16
AUV97982.1|2042360_2042792_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AUV97983.1|2043037_2044582_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AUV97984.1|2044591_2045863_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	33.9	2.1e-08
AUV97985.1|2045914_2046802_+	hypothetical protein	NA	NA	NA	NA	NA
AUV97986.1|2046798_2047596_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AUV97987.1|2047757_2048783_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	1.0e-18
AUV97988.1|2048792_2049986_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.3	1.7e-36
AUV97989.1|2050326_2051271_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.1	8.6e-36
>prophage 136
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2064133	2068872	6179177		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
AUV98001.1|2064133_2064610_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.7	2.4e-26
AUV98002.1|2064733_2065543_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.6	3.8e-24
AUV98003.1|2065742_2065910_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AUV98004.1|2065930_2066167_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AUW01723.1|2066383_2067049_-	JAB domain-containing protein	NA	NA	NA	NA	NA
AUW01724.1|2067224_2068436_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	35.8	5.8e-45
AUW01722.1|2068416_2068872_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	62.6	4.0e-47
>prophage 137
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2074439	2079466	6179177		Pseudomonas_phage(33.33%)	5	NA	NA
AUV98011.1|2074439_2076116_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.0	9.6e-22
AUV98012.1|2076110_2076290_+	hypothetical protein	NA	NA	NA	NA	NA
AUV98013.1|2076373_2076997_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	36.2	2.6e-20
AUV98014.1|2077051_2077327_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AUV98015.1|2077345_2079466_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	2.8e-10
>prophage 138
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2090582	2091434	6179177		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AUV98027.1|2090582_2091434_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	1.3e-14
>prophage 139
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2095039	2096431	6179177		environmental_Halophage(100.0%)	1	NA	NA
AUV98031.1|2095039_2096431_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	95.9	1.6e-67
>prophage 140
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2118730	2123762	6179177		Wolbachia_phage(50.0%)	6	NA	NA
AUV98048.1|2118730_2119714_+	hydroxyacid dehydrogenase	NA	Q9JMN3	Wolbachia_phage	46.9	1.4e-76
AUV98049.1|2119869_2120475_-	shikimate kinase	NA	NA	NA	NA	NA
AUW01725.1|2120662_2121130_+	DUF3237 domain-containing protein	NA	NA	NA	NA	NA
AUV98050.1|2121242_2122250_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AUV98051.1|2122251_2122554_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AUV98052.1|2122712_2123762_+	zinc-binding dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.2	4.5e-70
>prophage 141
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2139352	2140519	6179177		Salmonella_phage(100.0%)	1	NA	NA
AUV98067.1|2139352_2140519_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	25.1	6.5e-25
>prophage 142
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2145006	2145984	6179177	transposase	Sodalis_phage(100.0%)	1	NA	NA
AUV98072.1|2145006_2145984_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.3	1.0e-68
>prophage 143
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2153270	2154383	6179177		Bacillus_virus(100.0%)	1	NA	NA
AUV98080.1|2153270_2154383_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	34.5	8.6e-27
>prophage 144
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2166731	2172073	6179177		Micromonas_sp._RCC1109_virus(50.0%)	6	NA	NA
AUV98093.1|2166731_2168420_-	acetolactate synthase, large subunit, biosynthetic type	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	6.9e-60
AUV98094.1|2168522_2168618_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AUV98095.1|2169199_2169289_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AUV98096.1|2169360_2169807_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUV98097.1|2169877_2170711_+	EamA family transporter	NA	NA	NA	NA	NA
AUV98098.1|2170888_2172073_+	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	23.7	2.9e-12
>prophage 145
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2183469	2184430	6179177		Synechococcus_phage(50.0%)	2	NA	NA
AUV98109.1|2183469_2183898_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	37.3	3.2e-14
AUV98110.1|2184016_2184430_-	heat shock protein IbpA	NA	A0A1D7SU06	Cyanophage	35.4	1.3e-17
>prophage 146
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2187927	2191020	6179177		Oenococcus_phage(50.0%)	3	NA	NA
AUV98113.1|2187927_2189076_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	4.7e-52
AUV98114.1|2189072_2189690_-	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	NA	NA	NA	NA
AUV98115.1|2189851_2191020_-	DDE domain-containing protein	NA	Q716C2	Shigella_phage	89.8	6.9e-168
>prophage 147
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2195760	2203289	6179177		Bacillus_virus(33.33%)	7	NA	NA
AUV98120.1|2195760_2198175_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	33.9	4.8e-115
AUV98121.1|2198203_2199277_-	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
AUV98122.1|2199425_2200526_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.3	6.9e-53
AUV98123.1|2200530_2201931_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AUV98124.1|2202552_2202693_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
AUV98125.1|2202708_2203068_+	ribonuclease P protein component	NA	NA	NA	NA	NA
AUV98126.1|2203031_2203289_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	7.1e-17
>prophage 148
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2210765	2212103	6179177		Moraxella_phage(100.0%)	1	NA	NA
AUV98134.1|2210765_2212103_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.4	5.8e-62
>prophage 149
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2217982	2225585	6179177		Bacillus_phage(25.0%)	7	NA	NA
AUV98140.1|2217982_2218756_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.1	9.9e-14
AUV98141.1|2218803_2219694_-	phosphate ABC transporter, permease protein PstA	NA	NA	NA	NA	NA
AUV98142.1|2219693_2220653_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AUV98143.1|2220663_2220846_-	hypothetical protein	NA	NA	NA	NA	NA
AUV98144.1|2220845_2221886_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.4	4.0e-50
AUV98145.1|2222202_2224032_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	41.7	1.6e-126
AUV98146.1|2224214_2225585_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.4	9.6e-36
>prophage 150
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2240166	2241159	6179177		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AUV98161.1|2240166_2241159_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.0	7.1e-49
>prophage 151
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2244328	2250207	6179177		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
AUV98164.1|2244328_2246197_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.5	1.4e-66
AUV98165.1|2246382_2246802_+	D-ribose pyranase	NA	NA	NA	NA	NA
AUV98166.1|2246812_2248318_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.5	8.9e-19
AUV98167.1|2248323_2249289_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
AUV98168.1|2249316_2250207_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	24.5	7.4e-05
>prophage 152
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2264399	2267189	6179177		uncultured_virus(100.0%)	1	NA	NA
AUV98177.1|2264399_2267189_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	33.6	3.3e-75
>prophage 153
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2271081	2273549	6179177		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
AUV98183.1|2271081_2272491_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
AUV98184.1|2272499_2273549_-	two-component system sensor histidine kinase NtrB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.7	2.2e-08
>prophage 154
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2280373	2281291	6179177		Pandoravirus(100.0%)	1	NA	NA
AUV98191.1|2280373_2281291_-	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	30.0	4.2e-19
>prophage 155
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2342184	2343696	6179177		Bacillus_virus(100.0%)	1	NA	NA
AUV98247.1|2342184_2343696_-	D-xylose ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.5	5.1e-14
>prophage 156
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2352000	2355527	6179177		Bacillus_thuringiensis_phage(33.33%)	4	NA	NA
AUV98255.1|2352000_2352621_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
AUV98256.1|2352692_2353367_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AUV98257.1|2353458_2354832_-	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	23.3	4.5e-09
AUV98258.1|2354828_2355527_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
>prophage 157
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2360145	2361480	6179177		Erwinia_phage(100.0%)	1	NA	NA
AUV98264.1|2360145_2361480_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	30.3	1.1e-44
>prophage 158
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2373851	2376551	6179177		Escherichia_phage(50.0%)	3	NA	NA
AUV98276.1|2373851_2374601_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	34.1	1.0e-23
AUV98277.1|2374729_2375833_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
AUV98278.1|2375888_2376551_-	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	3.5e-28
>prophage 159
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2391278	2393147	6179177		Acinetobacter_phage(100.0%)	1	NA	NA
AUW01736.1|2391278_2393147_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	27.7	2.8e-06
>prophage 160
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2403341	2404988	6179177		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AUV98297.1|2403341_2404988_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	33.0	1.6e-66
>prophage 161
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2414678	2425513	6179177		Vibrio_phage(20.0%)	9	NA	NA
AUV98306.1|2414678_2415407_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.0	1.2e-21
AUV98307.1|2415509_2417528_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	1.9e-112
AUV98308.1|2417531_2418494_-	ribokinase	NA	NA	NA	NA	NA
AUV98309.1|2418477_2419893_-	allantoin permease	NA	NA	NA	NA	NA
AUV98310.1|2419911_2420928_-	ADP-ribosylglycohydrolase family protein	NA	A0A172WZB4	Catopsilia_pomona_nucleopolyhedrovirus	25.3	2.2e-08
AUV98311.1|2421149_2421890_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUV98312.1|2421954_2423442_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
AUV98313.1|2423576_2424842_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.8	8.3e-42
AUV98314.1|2425183_2425513_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	2.5e-14
>prophage 162
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2429563	2433841	6179177		Catovirus(33.33%)	4	NA	NA
AUV98318.1|2429563_2430694_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.3	1.9e-26
AUV98319.1|2430690_2431953_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.6	2.8e-26
AUV98320.1|2432031_2432706_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AUW01739.1|2432710_2433841_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	42.5	5.1e-19
>prophage 163
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2457203	2461062	6179177		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
AUV98339.1|2457203_2458106_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	28.9	2.3e-17
AUV98340.1|2458105_2458822_+	flavin mononucleotide phosphatase	NA	NA	NA	NA	NA
AUV98341.1|2458899_2461062_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	1.3e-116
>prophage 164
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2464911	2466738	6179177		Catovirus(100.0%)	1	NA	NA
AUV98346.1|2464911_2466738_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.6	2.8e-83
>prophage 165
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2477542	2483721	6179177		Alteromonas_phage(33.33%)	7	NA	NA
AUV98357.1|2477542_2478991_+	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	56.4	6.8e-08
AUV98358.1|2479061_2479817_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
AUV98359.1|2479830_2480436_+	SCP2 domain-containing protein	NA	NA	NA	NA	NA
AUV98360.1|2480432_2482073_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.9	1.5e-40
AUV98361.1|2482150_2482402_+	Sec-independent protein translocase protein TatA	NA	NA	NA	NA	NA
AUV98362.1|2482405_2482945_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AUV98363.1|2482947_2483721_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.0	1.5e-25
>prophage 166
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2492926	2493541	6179177		Streptococcus_phage(100.0%)	1	NA	NA
AUV98373.1|2492926_2493541_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.1	1.4e-18
>prophage 167
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2503422	2523140	6179177		uncultured_Mediterranean_phage(16.67%)	16	NA	NA
AUV98377.1|2503422_2504373_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.6	3.0e-28
AUV98378.1|2504592_2504775_-	hypothetical protein	NA	NA	NA	NA	NA
AUV98379.1|2505374_2506559_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	8.9e-14
AUV98380.1|2506572_2506770_+	hypothetical protein	NA	NA	NA	NA	NA
AUV98381.1|2506791_2507175_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
AUV98382.1|2507176_2507722_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	29.1	3.1e-14
AUV98383.1|2507875_2508304_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
AUV98384.1|2508307_2509012_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
AUV98385.1|2509431_2509929_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
AUV98386.1|2509995_2510361_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
AUV98387.1|2510686_2514715_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	30.2	1.1e-23
AUV98388.1|2514791_2519015_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.3	1.3e-67
AUV98389.1|2519424_2520765_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
AUV98390.1|2520808_2521126_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AUV98391.1|2521129_2521435_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AUV98392.1|2521607_2523140_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.7	3.8e-09
>prophage 168
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2531685	2540458	6179177		Klosneuvirus(25.0%)	9	NA	NA
AUV98402.1|2531685_2532357_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	31.2	9.5e-21
AUV98403.1|2532399_2532990_+	DUF416 domain-containing protein	NA	NA	NA	NA	NA
AUV98404.1|2533176_2533449_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	1.2e-19
AUW01742.1|2533461_2534154_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
AUV98405.1|2534157_2534592_-	zinc resistance-associated protein ZraP	NA	NA	NA	NA	NA
AUV98406.1|2534844_2536233_+	two-component system sensor histidine kinase ZraS	NA	NA	NA	NA	NA
AUV98407.1|2536229_2537564_+	sigma-54-dependent Fis family transcriptional regulator	NA	Q6XM27	Feldmannia_irregularis_virus	29.9	2.4e-07
AUV98408.1|2537560_2538853_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AUV98409.1|2538868_2540458_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.1e-67
>prophage 169
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2554259	2557943	6179177		Dickeya_phage(100.0%)	1	NA	NA
AUV98416.1|2554259_2557943_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 170
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2587964	2589074	6179177		Mycoplasma_phage(100.0%)	1	NA	NA
AUV98449.1|2587964_2589074_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 171
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2596274	2596883	6179177		Lactococcus_phage(100.0%)	1	NA	NA
AUV98456.1|2596274_2596883_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	7.8e-14
>prophage 172
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2602723	2605364	6179177		Escherichia_phage(50.0%)	2	NA	NA
AUV98463.1|2602723_2604139_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.3	2.8e-200
AUV98464.1|2604284_2605364_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.1	2.6e-28
>prophage 173
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2609466	2614766	6179177		uncultured_Mediterranean_phage(33.33%)	3	NA	NA
AUV98471.1|2609466_2612292_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
AUV98472.1|2612538_2613066_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	96.4	3.5e-55
AUV98473.1|2613152_2614766_-	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	2.5e-06
>prophage 174
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2626578	2627928	6179177		Moraxella_phage(100.0%)	1	NA	NA
AUV98483.1|2626578_2627928_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.8	6.7e-159
>prophage 175
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2640199	2651306	6179177		Staphylococcus_phage(33.33%)	9	NA	NA
AUV98494.1|2640199_2642158_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.5	3.5e-92
AUV98495.1|2642250_2642502_-	hypothetical protein	NA	NA	NA	NA	NA
AUV98496.1|2642569_2643883_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
AUV98497.1|2643919_2644603_-	sel1 repeat family protein	NA	NA	NA	NA	NA
AUV98498.1|2644809_2646957_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.3	4.1e-33
AUV98499.1|2647213_2648125_-	allose kinase	NA	NA	NA	NA	NA
AUV98500.1|2648108_2648804_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AUV98501.1|2648814_2649795_-	allose ABC transporter	NA	NA	NA	NA	NA
AUV98502.1|2649773_2651306_-	allose ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.5	1.4e-11
>prophage 176
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2656973	2658616	6179177		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
AUV98510.1|2656973_2657660_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.9	1.1e-08
AUV98511.1|2657857_2658616_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	25.8	2.2e-13
>prophage 177
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2663941	2670876	6179177		Burkholderia_virus(25.0%)	8	NA	NA
AUV98518.1|2663941_2665444_+	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.0	7.0e-56
AUW01750.1|2665590_2665896_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
AUV98519.1|2665895_2666816_-	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	43.8	9.7e-08
AUV98520.1|2666966_2667647_-	hypothetical protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.7	9.3e-32
AUV98521.1|2667870_2668653_+	disulfide bond formation protein DsbA	NA	NA	NA	NA	NA
AUV98522.1|2668686_2669283_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUV98523.1|2669398_2669986_+	flavodoxin family protein	NA	NA	NA	NA	NA
AUW01751.1|2670441_2670876_+	hypothetical protein	NA	E5AGC9	Erwinia_phage	38.3	5.7e-19
>prophage 178
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2675462	2676830	6179177		Escherichia_phage(100.0%)	1	NA	NA
AUV98527.1|2675462_2676830_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	54.2	2.3e-122
>prophage 179
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2680205	2692484	6179177	transposase	Klebsiella_phage(20.0%)	14	NA	NA
AUV98532.1|2680205_2680436_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	46.6	2.0e-07
AUV98533.1|2680514_2681747_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUV98534.1|2682640_2683396_-	hypothetical protein	NA	U5N3V8	Enterobacteria_phage	33.9	2.4e-33
AUV98535.1|2683392_2684892_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AUV98536.1|2684964_2685228_+	hypothetical protein	NA	NA	NA	NA	NA
AUV98537.1|2685241_2687251_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	27.6	5.5e-40
AUW01753.1|2687879_2688371_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
AUV98538.1|2688443_2688647_+	hypothetical protein	NA	NA	NA	NA	NA
AUV98539.1|2688664_2689213_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	61.4	1.4e-51
AUV98540.1|2689291_2689534_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
AUV98541.1|2689517_2689766_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
AUV98542.1|2690074_2690953_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV98543.1|2690955_2691828_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AUV98544.1|2691824_2692484_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.6	5.8e-15
>prophage 180
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2705771	2706893	6179177	integrase	Pseudomonas_phage(100.0%)	1	2699337:2699349	2707790:2707802
2699337:2699349	attL	GCCCGCCGCGCCG	NA	NA	NA	NA
AUV98555.1|2705771_2706893_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	45.3	2.9e-46
AUV98555.1|2705771_2706893_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	45.3	2.9e-46
2707790:2707802	attR	CGGCGCGGCGGGC	NA	NA	NA	NA
>prophage 181
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2727468	2730156	6179177		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AUV98580.1|2727468_2730156_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	19.2	3.1e-06
>prophage 182
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2737439	2739967	6179177	integrase	Macacine_betaherpesvirus(33.33%)	3	2729267:2729281	2738695:2738709
2729267:2729281	attL	AGCTGAGAAATTACG	NA	NA	NA	NA
AUV98585.1|2737439_2738231_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	81.7	5.7e-49
AUV98586.1|2738258_2739533_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.5	3.1e-153
2738695:2738709	attR	CGTAATTTCTCAGCT	NA	NA	NA	NA
AUV98587.1|2739532_2739967_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	51.2	4.7e-29
>prophage 183
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2747623	2752035	6179177	transposase	Enterobacteria_phage(50.0%)	4	NA	NA
AUV98596.1|2747623_2748379_-	hypothetical protein	NA	U5N3V8	Enterobacteria_phage	33.9	2.4e-33
AUV98597.1|2748375_2749875_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AUV98598.1|2750043_2750562_+	hypothetical protein	NA	NA	NA	NA	NA
AUV98599.1|2750601_2752035_+	chromate transporter	NA	A0A219VHC2	Ochrobactrum_phage	75.3	1.1e-37
>prophage 184
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2759304	2762156	6179177	integrase	Caulobacter_phage(50.0%)	3	2757453:2757466	2766924:2766937
2757453:2757466	attL	GTTCACAGTTTTCA	NA	NA	NA	NA
AUV98610.1|2759304_2760297_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.6	5.3e-52
AUV98611.1|2760388_2761342_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AUV98612.1|2761472_2762156_+|integrase	integrase	integrase	A0A2K9V411	Faecalibacterium_phage	37.6	9.6e-29
2766924:2766937	attR	TGAAAACTGTGAAC	NA	NA	NA	NA
>prophage 185
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2780171	2785701	6179177		Cronobacter_phage(33.33%)	5	NA	NA
AUV98626.1|2780171_2780465_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	2.1e-12
AUV98627.1|2780508_2782155_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	1.0e-188
AUV98628.1|2782288_2782642_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
AUV98629.1|2782688_2783555_-	hypothetical protein	NA	NA	NA	NA	NA
AUV98630.1|2783577_2785701_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.0	1.2e-29
>prophage 186
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2796597	2801815	6179177		Morganella_phage(33.33%)	6	NA	NA
AUV98643.1|2796597_2797128_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-45
AUV98644.1|2797268_2797628_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
AUV98645.1|2797638_2798034_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
AUV98646.1|2798044_2798779_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AUW01762.1|2798771_2800562_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	26.8	2.2e-16
AUV98647.1|2800837_2801815_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	1.2e-27
>prophage 187
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2809066	2809612	6179177		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AUV98653.1|2809066_2809612_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	7.7e-29
>prophage 188
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2814350	2817582	6179177		Vibrio_phage(50.0%)	2	NA	NA
AUV98658.1|2814350_2815682_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.6	4.3e-17
AUV98659.1|2815692_2817582_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	2.2e-59
>prophage 189
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2823108	2827470	6179177		Pithovirus(50.0%)	3	NA	NA
AUV98666.1|2823108_2824407_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
AUV98667.1|2824556_2824982_+	HTH-type transcriptional repressor NsrR	NA	NA	NA	NA	NA
AUV98668.1|2825019_2827470_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	31.9	3.2e-66
>prophage 190
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2867536	2874088	6179177		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
AUV98710.1|2867536_2868064_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	7.1e-56
AUV98711.1|2868467_2869424_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV98712.1|2869533_2871036_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	2.2e-09
AUV98713.1|2871046_2872072_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUV98714.1|2872058_2873045_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
AUV98715.1|2873089_2874088_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 191
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2893084	2896010	6179177		Cronobacter_phage(50.0%)	2	NA	NA
AUV98734.1|2893084_2893549_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	8.5e-53
AUV98735.1|2893871_2896010_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.4	3.4e-266
>prophage 192
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2903838	2911621	6179177		Enterobacteria_phage(25.0%)	6	NA	NA
AUV98741.1|2903838_2904786_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.0	1.3e-12
AUV98742.1|2905164_2907873_+	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.1	1.7e-47
AUV98743.1|2907940_2908327_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
AUV98744.1|2908481_2909951_-	N-acetylglucosamine-binding protein GbpA	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.5	1.4e-21
AUV98745.1|2910211_2910673_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AUV98746.1|2910685_2911621_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	1.0e-52
>prophage 193
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2916765	2925815	6179177	tRNA	Klosneuvirus(33.33%)	8	NA	NA
AUV98753.1|2916765_2919621_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	6.0e-141
AUV98754.1|2919620_2920064_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AUV98755.1|2920186_2921698_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	9.2e-48
AUV98756.1|2921735_2921861_-	hypothetical protein	NA	NA	NA	NA	NA
AUV98757.1|2921982_2922102_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AUV98758.1|2922091_2923189_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AUV98759.1|2923188_2924271_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AUW01766.1|2924312_2925815_-	ATP-binding protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	8.8e-83
>prophage 194
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2941738	2946609	6179177		Planktothrix_phage(50.0%)	5	NA	NA
AUV98771.1|2941738_2942809_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.6e-22
AUV98772.1|2942814_2943639_-	phosphodiesterase	NA	NA	NA	NA	NA
AUV98773.1|2943649_2944537_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AUV98774.1|2944526_2945399_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUV98775.1|2945589_2946609_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	32.3	2.6e-46
>prophage 195
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2951459	2952299	6179177		uncultured_marine_virus(100.0%)	1	NA	NA
AUV98778.1|2951459_2952299_+	hypothetical protein	NA	A0A0F7L647	uncultured_marine_virus	33.2	1.5e-20
>prophage 196
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2968178	2969543	6179177		Burkholderia_virus(100.0%)	1	NA	NA
AUV98791.1|2968178_2969543_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.3e-45
>prophage 197
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2982236	2987951	6179177		Staphylococcus_phage(50.0%)	3	NA	NA
AUV98798.1|2982236_2984966_-	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	1.7e-20
AUW01767.1|2984962_2986030_-	hypothetical protein	NA	NA	NA	NA	NA
AUV98799.1|2986553_2987951_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.9	3.4e-20
>prophage 198
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2996372	2999759	6179177	holin	Serratia_phage(100.0%)	1	NA	NA
AUV98810.1|2996372_2999759_-|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	7.4e-05
>prophage 199
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3005636	3006221	6179177		Moraxella_phage(100.0%)	1	NA	NA
AUV98819.1|3005636_3006221_-	TetR/AcrR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.3	5.0e-10
>prophage 200
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3014417	3018391	6179177		Acinetobacter_phage(50.0%)	2	NA	NA
AUV98829.1|3014417_3015887_-	restriction endonuclease subunit M	NA	J7I0U9	Acinetobacter_phage	27.6	1.1e-34
AUV98830.1|3015961_3018391_-	DEAD/DEAH box helicase	NA	A0A0K1LLU7	Rhodobacter_phage	23.9	6.7e-08
>prophage 201
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3030832	3032670	6179177		Streptococcus_phage(50.0%)	2	NA	NA
AUV98845.1|3030832_3032044_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	7.9e-58
AUV98846.1|3032043_3032670_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	52.3	3.2e-55
>prophage 202
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3069058	3070081	6179177		Tupanvirus(100.0%)	1	NA	NA
AUV98881.1|3069058_3070081_+	galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	28.4	3.6e-11
>prophage 203
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3077294	3080462	6179177	transposase	Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
AUV98886.1|3077294_3078356_+	glucosamine--fructose-6-phosphate aminotransferase	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	23.3	2.1e-06
AUV98887.1|3078352_3079384_+	SIS domain-containing protein	NA	NA	NA	NA	NA
AUV98888.1|3079523_3080462_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	52.9	8.5e-68
>prophage 204
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3083624	3084904	6179177		Shigella_phage(50.0%)	2	NA	NA
AUW01772.1|3083624_3084362_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	1.3e-63
AUV98891.1|3084364_3084904_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	60.6	7.1e-27
>prophage 205
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3098212	3100917	6179177		Streptococcus_phage(50.0%)	3	NA	NA
AUV98907.1|3098212_3099802_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.3	2.4e-30
AUV98908.1|3100019_3100631_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
AUV98909.1|3100755_3100917_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	69.8	3.0e-13
>prophage 206
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3105585	3106908	6179177		Geobacillus_virus(100.0%)	1	NA	NA
AUV98914.1|3105585_3106908_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.4	2.6e-78
>prophage 207
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3113207	3118427	6179177		Enterococcus_phage(33.33%)	3	NA	NA
AUV98920.1|3113207_3114440_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.0	4.1e-86
AUW01774.1|3114548_3116216_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	1.4e-41
AUV98921.1|3116489_3118427_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	3.6e-12
>prophage 208
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3122391	3123816	6179177		Bacillus_phage(100.0%)	1	NA	NA
AUV98928.1|3122391_3123816_+	two-component system sensor histidine kinase CreC	NA	W8CYF6	Bacillus_phage	27.7	2.1e-17
>prophage 209
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3134899	3135853	6179177		Cyanophage(100.0%)	1	NA	NA
AUV98938.1|3134899_3135853_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	2.8e-10
>prophage 210
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3140240	3148524	6179177		Chrysochromulina_ericina_virus(25.0%)	7	NA	NA
AUV98944.1|3140240_3142157_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
AUV98945.1|3142244_3143381_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	3.6e-28
AUV98946.1|3143548_3144496_+	hypothetical protein	NA	NA	NA	NA	NA
AUV98947.1|3144620_3144968_+	hypothetical protein	NA	NA	NA	NA	NA
AUV98948.1|3145045_3145579_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	55.5	2.6e-53
AUV98949.1|3145595_3146039_-	transcriptional regulator	NA	NA	NA	NA	NA
AUV98950.1|3146424_3148524_+	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.5	4.0e-33
>prophage 211
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3153161	3159849	6179177	tRNA	uncultured_Caudovirales_phage(50.0%)	5	NA	NA
AUV98953.1|3153161_3154337_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	49.1	8.4e-89
AUV98954.1|3154389_3155289_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
AUV98955.1|3155455_3155719_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUV98956.1|3156049_3156988_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
AUW01776.1|3157032_3159849_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	25.4	6.7e-76
>prophage 212
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3186145	3187294	6179177		Halovirus(100.0%)	1	NA	NA
AUV98979.1|3186145_3187294_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	31.9	3.1e-48
>prophage 213
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3194037	3195406	6179177		Bacillus_phage(50.0%)	2	NA	NA
AUV98984.1|3194037_3194517_+	type 3 dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	40.9	6.7e-29
AUV98985.1|3194557_3195406_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	30.7	9.9e-07
>prophage 214
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3207947	3213399	6179177		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AUV98997.1|3207947_3210854_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.6	2.9e-21
AUV98998.1|3211041_3213399_-	DNA polymerase II	NA	D0FZR7	Heterocapsa_circularisquama_DNA_virus	37.1	8.0e-06
>prophage 215
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3219612	3220314	6179177		Bacillus_virus(100.0%)	1	NA	NA
AUV99004.1|3219612_3220314_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.7	1.3e-20
>prophage 216
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3241082	3242807	6179177		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AUV99022.1|3241082_3242807_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.3	1.0e-34
>prophage 217
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3268924	3269968	6179177		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AUV99048.1|3268924_3269968_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.6	2.2e-101
>prophage 218
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3274297	3274849	6179177		Thiobacimonas_phage(100.0%)	1	NA	NA
AUV99053.1|3274297_3274849_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0T6G1	Thiobacimonas_phage	32.8	1.9e-14
>prophage 219
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3286097	3287522	6179177		Erysipelothrix_phage(100.0%)	1	NA	NA
AUV99061.1|3286097_3287522_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	4.6e-41
>prophage 220
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3297303	3298074	6179177		Escherichia_phage(100.0%)	1	NA	NA
AUV99070.1|3297303_3298074_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	37.0	1.3e-29
>prophage 221
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3302952	3309533	6179177		Mamastrovirus(33.33%)	5	NA	NA
AUV99076.1|3302952_3304554_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	47.5	3.3e-19
AUV99077.1|3304654_3307045_-	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
AUV99078.1|3307248_3307785_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.8	2.7e-18
AUV99079.1|3307836_3308499_-	carbonate dehydratase	NA	NA	NA	NA	NA
AUV99080.1|3308606_3309533_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.8e-22
>prophage 222
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3322136	3328902	6179177	tRNA	unidentified_phage(50.0%)	6	NA	NA
AUV99094.1|3322136_3323534_-	polynucleotide adenylyltransferase	NA	H7BUW3	unidentified_phage	37.8	4.9e-27
AUV99095.1|3323585_3324467_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AUV99096.1|3324527_3324983_-	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AUV99097.1|3325147_3325864_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AUV99098.1|3325863_3326400_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AUV99099.1|3326472_3328902_+	ATP-dependent helicase HrpB	NA	A0A0U2UIE6	Niemeyer_virus	31.6	9.6e-39
>prophage 223
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3350936	3355592	6179177	transposase	Planktothrix_phage(50.0%)	4	NA	NA
AUV99118.1|3350936_3351734_+	iron-hydroxamate transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	27.4	1.2e-14
AUV99119.1|3351733_3352624_+	iron-hydroxamate transporter substrate-binding subunit	NA	NA	NA	NA	NA
AUV99120.1|3352620_3354603_+	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
AUV99121.1|3354662_3355592_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	40.7	2.4e-59
>prophage 224
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3358758	3359103	6179177		Lake_Baikal_phage(100.0%)	1	NA	NA
AUV99123.1|3358758_3359103_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.6e-27
>prophage 225
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3363234	3369038	6179177	protease	uncultured_Mediterranean_phage(50.0%)	3	NA	NA
AUV99128.1|3363234_3364674_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.5	1.8e-24
AUV99129.1|3364865_3366023_+	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
AUV99130.1|3366059_3369038_-	viral enhancin protein	NA	A9YMZ4	Helicoverpa_armigera_granulovirus	23.7	5.7e-41
>prophage 226
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3379562	3380321	6179177		Flavobacterium_phage(100.0%)	1	NA	NA
AUV99141.1|3379562_3380321_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	2.1e-24
>prophage 227
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3389155	3393273	6179177		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
AUV99150.1|3389155_3389752_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	38.9	4.6e-27
AUV99151.1|3389790_3393273_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.3	2.7e-204
>prophage 228
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3408044	3409076	6179177		Planktothrix_phage(100.0%)	1	NA	NA
AUV99167.1|3408044_3409076_-	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	1.9e-36
>prophage 229
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3415760	3416564	6179177		Staphylococcus_phage(100.0%)	1	NA	NA
AUV99169.1|3415760_3416564_+	2,5-didehydrogluconate reductase DkgB	NA	A0A2H4PQR8	Staphylococcus_phage	36.0	2.1e-38
>prophage 230
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3420608	3424819	6179177		Lactobacillus_phage(33.33%)	5	NA	NA
AUV99173.1|3420608_3421976_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	30.6	4.3e-12
AUV99174.1|3422047_3422803_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AUV99175.1|3422835_3423558_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUV99176.1|3423554_3424022_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	59.7	3.8e-53
AUW01784.1|3424087_3424819_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.0	4.6e-37
>prophage 231
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3428920	3429502	6179177		Caulobacter_phage(100.0%)	1	NA	NA
AUV99180.1|3428920_3429502_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.6	1.1e-12
>prophage 232
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3464516	3465992	6179177		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AUV99213.1|3464516_3465992_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.8	1.7e-46
>prophage 233
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3471263	3471737	6179177		Burkholderia_phage(100.0%)	1	NA	NA
AUV99218.1|3471263_3471737_-	hypothetical protein	NA	K4NX96	Burkholderia_phage	34.4	2.8e-19
>prophage 234
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3488409	3493280	6179177		Catovirus(50.0%)	5	NA	NA
AUW01789.1|3488409_3489942_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	35.0	1.8e-67
AUV99229.1|3489952_3490828_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV99230.1|3490858_3491539_-	ABC transporter permease	NA	NA	NA	NA	NA
AUV99231.1|3491541_3492186_-	ABC transporter permease	NA	NA	NA	NA	NA
AUV99232.1|3492182_3493280_-	glycine/betaine ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.2	1.0e-08
>prophage 235
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3508896	3512607	6179177		Streptococcus_phage(66.67%)	3	NA	NA
AUV99245.1|3508896_3510150_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	2.2e-95
AUV99246.1|3510160_3511264_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.2	2.4e-61
AUV99247.1|3511554_3512607_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.2	1.3e-112
>prophage 236
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3517358	3518102	6179177		Bacillus_virus(100.0%)	1	NA	NA
AUV99251.1|3517358_3518102_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	3.5e-32
>prophage 237
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3525286	3526129	6179177		Brazilian_cedratvirus(100.0%)	1	NA	NA
AUV99259.1|3525286_3526129_-	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.6	1.6e-12
>prophage 238
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3535374	3539499	6179177		Brazilian_cedratvirus(66.67%)	6	NA	NA
AUW01792.1|3535374_3536193_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	2.3e-16
AUV99267.1|3536206_3537016_-	cysteine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV99268.1|3537008_3537203_+	hypothetical protein	NA	NA	NA	NA	NA
AUV99269.1|3537738_3537921_+	hypothetical protein	NA	NA	NA	NA	NA
AUV99270.1|3538028_3538724_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	8.1e-07
AUV99271.1|3538716_3539499_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	A0A2R8FG22	Brazilian_cedratvirus	23.7	5.1e-10
>prophage 239
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3550981	3552028	6179177		Bacillus_virus(100.0%)	1	NA	NA
AUV99282.1|3550981_3552028_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	8.9e-34
>prophage 240
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3560084	3560852	6179177		Planktothrix_phage(100.0%)	1	NA	NA
AUV99289.1|3560084_3560852_+	taurine transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	1.5e-25
>prophage 241
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3585300	3594520	6179177		Bacillus_phage(60.0%)	7	NA	NA
AUV99316.1|3585300_3586212_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.9	4.2e-104
AUV99317.1|3586302_3587208_+	fructokinase	NA	NA	NA	NA	NA
AUV99318.1|3587256_3587619_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AUV99319.1|3587907_3591042_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	4.9e-11
AUV99320.1|3591038_3592241_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	34.7	6.3e-07
AUV99321.1|3592519_3593209_+	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	38.0	3.3e-37
AUV99322.1|3593230_3594520_+	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	27.9	1.0e-26
>prophage 242
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3611351	3615691	6179177	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
AUV99335.1|3611351_3612479_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.6	1.5e-90
AUV99336.1|3612501_3612834_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
AUV99337.1|3612861_3614709_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
AUV99338.1|3614719_3615691_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.8	7.2e-46
>prophage 243
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3620701	3622369	6179177		Indivirus(50.0%)	2	NA	NA
AUV99345.1|3620701_3621805_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.3	4.2e-50
AUV99346.1|3621898_3622369_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.7	1.7e-29
>prophage 244
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3639366	3641070	6179177		Lactobacillus_phage(100.0%)	1	NA	NA
AUV99364.1|3639366_3641070_-	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	27.1	3.7e-21
>prophage 245
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3656227	3661277	6179177	protease	Agrobacterium_phage(25.0%)	4	NA	NA
AUV99379.1|3656227_3656851_+	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
AUV99380.1|3656983_3658258_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.1	2.8e-130
AUV99381.1|3658441_3660796_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.1	1.0e-223
AUV99382.1|3661004_3661277_+	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
>prophage 246
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3664654	3665350	6179177		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUV99387.1|3664654_3665350_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.4e-88
>prophage 247
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3669777	3673321	6179177		Bacillus_phage(100.0%)	2	NA	NA
AUV99392.1|3669777_3671550_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.0	5.7e-49
AUV99393.1|3671542_3673321_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	6.4e-40
>prophage 248
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3684727	3685837	6179177		Planktothrix_phage(100.0%)	1	NA	NA
AUV99409.1|3684727_3685837_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	1.0e-24
>prophage 249
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3694989	3704377	6179177		Enterobacteria_phage(33.33%)	10	NA	NA
AUV99417.1|3694989_3696063_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	40.8	4.5e-65
AUW01794.1|3696175_3696439_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
AUV99418.1|3696438_3696579_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
AUV99419.1|3696575_3697274_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUV99420.1|3697375_3698830_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.5	2.4e-16
AUV99421.1|3698804_3699275_-	hypothetical protein	NA	NA	NA	NA	NA
AUV99422.1|3699401_3699968_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
AUV99423.1|3700130_3700349_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AUV99424.1|3700375_3700750_-	Hha toxicity attenuator	NA	NA	NA	NA	NA
AUV99425.1|3701230_3704377_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.8	3.5e-49
>prophage 250
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3709893	3717740	6179177	transposase	Sodalis_phage(25.0%)	9	NA	NA
AUV99429.1|3709893_3710829_-|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	51.6	4.3e-64
AUV99430.1|3710895_3711069_-	DUF2496 domain-containing protein	NA	NA	NA	NA	NA
AUV99431.1|3711083_3711611_-	primosomal replication protein N''	NA	NA	NA	NA	NA
AUV99432.1|3711680_3712058_+	DUF454 domain-containing protein	NA	NA	NA	NA	NA
AUV99433.1|3712208_3712760_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	2.3e-28
AUV99434.1|3712851_3714759_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	1.3e-43
AUV99435.1|3714816_3715149_+	nucleoid-associated protein, YbaB/EbfC family	NA	NA	NA	NA	NA
AUV99436.1|3715148_3715754_+	recombination protein RecR	NA	NA	NA	NA	NA
AUV99437.1|3715865_3717740_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.3	5.6e-111
>prophage 251
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3732158	3735985	6179177		Pteropox_virus(50.0%)	2	NA	NA
AUV99450.1|3732158_3733409_+	phospholipase	NA	A0A1B1MR92	Pteropox_virus	22.4	9.1e-25
AUV99451.1|3733483_3735985_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	5.0e-115
>prophage 252
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3740880	3741561	6179177		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AUV99457.1|3740880_3741561_+	iron ABC transporter ATP-binding protein FetA	NA	F2Y165	Organic_Lake_phycodnavirus	31.3	2.7e-15
>prophage 253
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3744747	3745434	6179177		Planktothrix_phage(100.0%)	1	NA	NA
AUW01795.1|3744747_3745434_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.5	7.6e-34
>prophage 254
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3754277	3757038	6179177	tRNA	Moumouvirus(50.0%)	3	NA	NA
AUV99470.1|3754277_3755663_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.1	1.0e-45
AUV99471.1|3755957_3756170_-	ribosome-associated protein	NA	NA	NA	NA	NA
AUV99472.1|3756171_3757038_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	6.5e-30
>prophage 255
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3760220	3760469	6179177		Salmonella_phage(100.0%)	1	NA	NA
AUV99476.1|3760220_3760469_-	AlpA family phage regulatory protein	NA	T1SA17	Salmonella_phage	71.8	4.7e-26
>prophage 256
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3766435	3767437	6179177		Bacillus_virus(100.0%)	1	NA	NA
AUV99482.1|3766435_3767437_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.4	3.1e-28
>prophage 257
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3778987	3779863	6179177		Burkholderia_virus(100.0%)	1	NA	NA
AUV99492.1|3778987_3779863_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.5	3.0e-19
>prophage 258
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3786641	3791716	6179177	tRNA	Acinetobacter_phage(33.33%)	4	NA	NA
AUV99497.1|3786641_3788117_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.5	2.9e-46
AUV99498.1|3788489_3790007_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.1	2.5e-85
AUV99499.1|3790159_3790573_+	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
AUV99500.1|3790840_3791716_-	class A extended-spectrum beta-lactamase OXY-1-1	NA	A0A1B0VBP7	Salmonella_phage	74.6	3.1e-112
>prophage 259
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3796482	3797967	6179177		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AUV99505.1|3796482_3797967_+	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	21.2	5.7e-10
>prophage 260
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3806286	3807687	6179177		Bacillus_phage(100.0%)	1	NA	NA
AUV99512.1|3806286_3807687_-	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	25.1	1.7e-16
>prophage 261
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3812081	3812873	6179177		Bacillus_virus(100.0%)	1	NA	NA
AUV99516.1|3812081_3812873_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.7	2.7e-14
>prophage 262
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3828424	3829174	6179177		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AUV99531.1|3828424_3829174_-	oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.2	1.3e-18
>prophage 263
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3864241	3866953	6179177		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AUW01800.1|3864241_3866953_+	carbonate dehydratase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	27.2	9.3e-67
>prophage 264
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3877599	3879643	6179177		Bacillus_virus(50.0%)	2	NA	NA
AUV99568.1|3877599_3878643_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	6.0e-14
AUV99569.1|3878632_3879643_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	1.3e-16
>prophage 265
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3884974	3894116	6179177		Planktothrix_phage(50.0%)	10	NA	NA
AUV99573.1|3884974_3886441_-	GntR family transcriptional regulator	NA	A0A1X9I5H2	Streptococcus_phage	22.0	1.8e-16
AUV99574.1|3886675_3887527_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV99575.1|3887575_3888217_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUV99576.1|3888231_3888897_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUV99577.1|3888889_3889651_+	glutamate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.6e-19
AUV99578.1|3889571_3889778_+	hypothetical protein	NA	NA	NA	NA	NA
AUV99579.1|3890195_3890960_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUV99580.1|3891142_3892480_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AUV99581.1|3892588_3893293_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.4	4.0e-22
AUV99582.1|3893279_3894116_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.1e-13
>prophage 266
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3898680	3904598	6179177	holin	Catovirus(50.0%)	5	NA	NA
AUV99586.1|3898680_3900345_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.3e-60
AUV99587.1|3900359_3901832_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUV99588.1|3901842_3902436_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
AUW01802.1|3902352_3902568_+	hypothetical protein	NA	NA	NA	NA	NA
AUV99589.1|3902564_3904598_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	28.1	5.8e-21
>prophage 267
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3908063	3909608	6179177		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AUV99593.1|3908063_3909608_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	3.1e-14
>prophage 268
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3921156	3925931	6179177		Tupanvirus(50.0%)	2	NA	NA
AUV99604.1|3921156_3925038_+	enterobactin synthase subunit F	NA	A0A2K9KZV5	Tupanvirus	26.9	3.1e-55
AUV99605.1|3925136_3925931_-	iron-enterobactin transporter ATP-binding protein	NA	M1HRF1	Paramecium_bursaria_Chlorella_virus	25.6	9.9e-09
>prophage 269
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3930001	3932119	6179177		Plodia_interpunctella_granulovirus(100.0%)	1	NA	NA
AUV99609.1|3930001_3932119_-	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.5	2.4e-33
>prophage 270
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3940977	3944594	6179177		Burkholderia_phage(50.0%)	4	NA	NA
AUV99618.1|3940977_3941382_-	transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	33.3	6.1e-07
AUV99619.1|3941362_3941656_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUV99620.1|3941842_3942931_-	oxidoreductase	NA	NA	NA	NA	NA
AUV99621.1|3943091_3944594_+	ABC transporter	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	1.3e-14
>prophage 271
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3962161	3982048	6179177	tRNA,transposase	Cedratvirus(12.5%)	17	NA	NA
AUV99637.1|3962161_3963190_+	dihydrofolate reductase	NA	A0A2R8FCS0	Cedratvirus	34.1	1.7e-29
AUV99638.1|3963228_3964173_-	sugar kinase	NA	NA	NA	NA	NA
AUV99639.1|3964184_3965186_-	ABC transporter permease	NA	NA	NA	NA	NA
AUV99640.1|3965185_3966172_-	ABC transporter permease	NA	NA	NA	NA	NA
AUW01805.1|3966168_3967674_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	6.6e-14
AUV99641.1|3967718_3968699_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV99642.1|3969237_3971547_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit C	tRNA	A0A077SK27	Escherichia_phage	33.1	3.9e-82
AUV99643.1|3971543_3971783_-	hypothetical protein	NA	NA	NA	NA	NA
AUV99644.1|3971730_3972273_-	acireductone dioxygenase	NA	NA	NA	NA	NA
AUV99645.1|3972269_3972959_-	acireductone synthase	NA	NA	NA	NA	NA
AUV99646.1|3973138_3974299_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AUV99647.1|3974299_3974929_-	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	50.3	2.0e-52
AUW01806.1|3974913_3976137_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.1	2.6e-61
AUV99648.1|3976886_3978006_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AUV99649.1|3979244_3979808_+	peroxiredoxin	NA	NA	NA	NA	NA
AUV99650.1|3979977_3981543_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	6.4e-44
AUV99651.1|3981619_3982048_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.7	2.5e-19
>prophage 272
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3986135	3987673	6179177		Morganella_phage(33.33%)	3	NA	NA
AUV99656.1|3986135_3986345_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	80.6	4.5e-22
AUW01807.1|3986409_3986793_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	50.0	5.2e-24
AUV99657.1|3986884_3987673_+	hydrolase	NA	M1HKP1	Paramecium_bursaria_Chlorella_virus	24.2	2.8e-08
>prophage 273
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3991590	3994034	6179177		Stx2-converting_phage(50.0%)	2	NA	NA
AUV99663.1|3991590_3992790_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.7	1.4e-104
AUV99664.1|3992933_3994034_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.0e-08
>prophage 274
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4001050	4009149	6179177	tRNA	Staphylococcus_phage(33.33%)	5	NA	NA
AUV99672.1|4001050_4003633_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.1	1.2e-188
AUV99673.1|4003859_4004342_+	hypothetical protein	NA	NA	NA	NA	NA
AUV99674.1|4004541_4006329_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	34.2	6.2e-27
AUV99675.1|4006384_4008052_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
AUV99676.1|4008423_4009149_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.7e-28
>prophage 275
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4014997	4016062	6179177		Pseudomonas_phage(100.0%)	1	NA	NA
AUV99683.1|4014997_4016062_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.5e-48
>prophage 276
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4020717	4022379	6179177		Ostreococcus_mediterraneus_virus(100.0%)	1	NA	NA
AUV99687.1|4020717_4022379_-	asparagine synthase B	NA	A0A0P0C0R1	Ostreococcus_mediterraneus_virus	39.7	7.9e-85
>prophage 277
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4027006	4036958	6179177	tRNA	Vibrio_phage(25.0%)	7	NA	NA
AUV99692.1|4027006_4028959_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	3.2e-08
AUV99693.1|4029137_4030805_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	92.4	1.3e-310
AUV99694.1|4031243_4032647_+	chitoporin	NA	NA	NA	NA	NA
AUV99695.1|4032693_4033026_+	hypothetical protein	NA	NA	NA	NA	NA
AUV99696.1|4033078_4034374_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.5	1.4e-60
AUV99697.1|4034428_4035568_-	tricarballylate utilization protein TcuB	NA	NA	NA	NA	NA
AUV99698.1|4035554_4036958_-	tricarballylate dehydrogenase	NA	A0A2P0ZL82	Lactobacillus_phage	26.4	3.0e-08
>prophage 278
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4039962	4040736	6179177		Mycobacterium_phage(100.0%)	1	NA	NA
AUV99703.1|4039962_4040736_-	alpha/beta hydrolase	NA	W0LK50	Mycobacterium_phage	37.0	2.6e-06
>prophage 279
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4047180	4048665	6179177		Staphylococcus_phage(100.0%)	1	NA	NA
AUW01809.1|4047180_4048665_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	2.5e-21
>prophage 280
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4056932	4064424	6179177		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
AUV99717.1|4056932_4058981_-	K(+)-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.9	5.5e-27
AUV99718.1|4059002_4060682_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AUV99719.1|4060681_4060771_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUV99720.1|4061080_4061287_+	DUF2517 domain-containing protein	NA	NA	NA	NA	NA
AUV99721.1|4061531_4062980_+	deoxyribodipyrimidine photo-lyase	NA	F2Y1V1	Organic_Lake_phycodnavirus	32.8	4.0e-56
AUV99722.1|4062942_4064424_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	2.9e-46
>prophage 281
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4070221	4071013	6179177		Kaumoebavirus(100.0%)	1	NA	NA
AUV99730.1|4070221_4071013_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.1	7.5e-09
>prophage 282
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4110150	4113667	6179177		Vibriophage(33.33%)	4	NA	NA
AUV99769.1|4110150_4110870_+	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	33.0	2.9e-23
AUV99770.1|4110866_4111811_-	cation transporter	NA	A0A1V0SED0	Indivirus	27.8	5.2e-25
AUV99771.1|4111928_4112300_-	hypothetical protein	NA	NA	NA	NA	NA
AUV99772.1|4112614_4113667_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.6	1.8e-82
>prophage 283
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4117987	4124513	6179177		Tupanvirus(33.33%)	7	NA	NA
AUV99777.1|4117987_4119004_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.7	4.4e-78
AUV99778.1|4119215_4120685_-	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	29.6	4.3e-10
AUV99779.1|4120752_4121541_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AUV99780.1|4121694_4121844_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
AUV99781.1|4121989_4122763_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV99782.1|4122762_4123452_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AUV99783.1|4123454_4124513_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.8	3.1e-18
>prophage 284
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4131686	4132418	6179177		Enterobacteria_phage(100.0%)	1	NA	NA
AUV99792.1|4131686_4132418_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	51.8	1.7e-52
>prophage 285
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4139183	4144137	6179177		Catovirus(50.0%)	4	NA	NA
AUV99799.1|4139183_4140707_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.8	2.4e-80
AUV99800.1|4140819_4142202_+	amino acid permease	NA	NA	NA	NA	NA
AUV99801.1|4142301_4142778_-	kinase inhibitor	NA	NA	NA	NA	NA
AUW01811.1|4142847_4144137_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	5.0e-18
>prophage 286
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4147812	4148535	6179177		Staphylococcus_phage(100.0%)	1	NA	NA
AUV99806.1|4147812_4148535_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	8.1e-10
>prophage 287
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4155100	4156006	6179177		Streptococcus_phage(100.0%)	1	NA	NA
AUV99813.1|4155100_4156006_-	hypothetical protein	NA	A1IMD5	Streptococcus_phage	27.7	3.1e-27
>prophage 288
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4165789	4167529	6179177		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AUV99827.1|4165789_4167529_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.0	1.5e-17
>prophage 289
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4172670	4181207	6179177		Micromonas_pusilla_virus(20.0%)	8	NA	NA
AUV99833.1|4172670_4173516_+	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	31.6	6.4e-06
AUV99834.1|4173515_4174508_+	transketolase	NA	NA	NA	NA	NA
AUV99835.1|4174808_4176158_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.5	1.0e-45
AUV99836.1|4176358_4178503_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	2.0e-43
AUV99837.1|4178545_4179514_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AUV99838.1|4179649_4179910_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AUV99839.1|4180194_4180461_-	DksA/TraR family C4-type zinc finger protein	NA	A0A0A0PZH0	Pectobacterium_bacteriophage	57.3	9.5e-17
AUV99840.1|4180529_4181207_-	Fe2+-dependent dioxygenase	NA	Q5GQB0	Synechococcus_phage	31.0	3.4e-18
>prophage 290
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4187778	4192882	6179177		Planktothrix_phage(33.33%)	6	NA	NA
AUV99845.1|4187778_4188501_-	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.8	1.5e-35
AUV99846.1|4188497_4189157_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AUV99847.1|4189290_4190037_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
AUV99848.1|4190408_4190912_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	24.6	1.9e-05
AUV99849.1|4191130_4192018_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AUV99850.1|4192369_4192882_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	31.3	2.3e-14
>prophage 291
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4196791	4203847	6179177		Klosneuvirus(33.33%)	6	NA	NA
AUV99855.1|4196791_4197832_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	35.0	1.0e-05
AUV99856.1|4197983_4199360_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	24.0	5.0e-24
AUV99857.1|4199430_4200147_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUV99858.1|4200189_4201104_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AUV99859.1|4201294_4202077_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AUV99860.1|4202254_4203847_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	8.5e-60
>prophage 292
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4213293	4215726	6179177		Citrobacter_phage(100.0%)	1	NA	NA
AUV99867.1|4213293_4215726_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	42.0	1.0e-08
>prophage 293
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4219904	4221758	6179177		Planktothrix_phage(100.0%)	1	NA	NA
AUV99872.1|4219904_4221758_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.2	4.1e-13
>prophage 294
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4231433	4254718	6179177	transposase,holin	Klebsiella_phage(26.09%)	35	NA	NA
AUV99880.1|4231433_4232720_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	54.5	1.3e-122
AUV99881.1|4232719_4232935_-	hypothetical protein	NA	NA	NA	NA	NA
AUV99882.1|4233022_4233367_-	hypothetical protein	NA	NA	NA	NA	NA
AUV99883.1|4233363_4233588_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	58.1	4.0e-16
AUV99884.1|4233929_4234223_-	hypothetical protein	NA	NA	NA	NA	NA
AUV99885.1|4234844_4235261_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	50.4	2.0e-29
AUV99886.1|4235343_4235571_+	transcriptional regulator	NA	H9C161	Pectobacterium_phage	35.1	7.1e-05
AUV99887.1|4235554_4235980_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUV99888.1|4235993_4236248_+	hypothetical protein	NA	NA	NA	NA	NA
AUV99889.1|4236244_4237321_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	41.6	5.2e-29
AUV99890.1|4237333_4237627_+	hypothetical protein	NA	NA	NA	NA	NA
AUV99891.1|4237623_4237836_+	hypothetical protein	NA	NA	NA	NA	NA
AUV99892.1|4237828_4238617_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	51.3	4.0e-63
AUV99893.1|4238613_4239690_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	72.9	1.2e-147
AUW01815.1|4239829_4240024_+	hypothetical protein	NA	Q6UAU1	Klebsiella_phage	74.2	9.7e-19
AUV99894.1|4240024_4240357_+	hypothetical protein	NA	NA	NA	NA	NA
AUV99895.1|4240353_4240854_+	hypothetical protein	NA	C6ZR26	Salmonella_phage	74.4	5.1e-11
AUV99896.1|4241291_4241585_+	hypothetical protein	NA	NA	NA	NA	NA
AUV99897.1|4242005_4242239_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	68.8	3.7e-25
AUV99898.1|4242367_4242550_+	hypothetical protein	NA	NA	NA	NA	NA
AUV99899.1|4242716_4243310_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	64.8	1.3e-42
AUV99900.1|4243306_4243951_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	80.0	4.3e-103
AUV99901.1|4244084_4244684_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	62.4	7.1e-68
AUV99902.1|4245387_4245699_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.5e-48
AUV99903.1|4245695_4246238_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	75.8	1.3e-76
AUV99904.1|4246234_4246579_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	82.5	4.5e-43
AUV99905.1|4246575_4246851_+	hypothetical protein	NA	NA	NA	NA	NA
AUV99906.1|4246801_4246993_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	85.5	1.3e-20
AUV99907.1|4247254_4248375_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AUV99908.1|4248443_4249385_-	hypothetical protein	NA	NA	NA	NA	NA
AUV99909.1|4249523_4250834_+	hypothetical protein	NA	A0A0K2FI18	Enterobacter_phage	31.8	7.3e-33
AUV99910.1|4250941_4251181_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	58.2	9.1e-19
AUV99911.1|4251834_4252269_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	46.1	5.4e-25
AUV99912.1|4252728_4253931_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	46.7	4.7e-95
AUV99913.1|4253959_4254718_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.2	2.0e-11
>prophage 295
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4262282	4273808	6179177		Bacillus_phage(33.33%)	13	NA	NA
AUV99920.1|4262282_4262546_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	71.8	1.6e-27
AUV99921.1|4262750_4263041_+	DUF1418 domain-containing protein	NA	NA	NA	NA	NA
AUV99922.1|4263024_4263747_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AUV99923.1|4263850_4264753_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.5	2.0e-34
AUV99924.1|4264842_4265322_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
AUV99925.1|4265670_4266783_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AUW01817.1|4266885_4268019_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	7.7e-31
AUV99926.1|4268029_4268983_+	putrescine ABC transporter permease	NA	NA	NA	NA	NA
AUV99927.1|4268979_4269825_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AUV99928.1|4269882_4270371_+	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AUV99929.1|4270413_4271544_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	25.2	1.7e-25
AUW01818.1|4271622_4272339_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.9	1.1e-35
AUV99930.1|4272335_4273808_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	32.4	4.3e-26
>prophage 296
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4277437	4280177	6179177		Planktothrix_phage(50.0%)	4	NA	NA
AUW01819.1|4277437_4278166_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	2.7e-29
AUV99936.1|4278393_4278909_-	lipoprotein	NA	NA	NA	NA	NA
AUV99937.1|4279026_4279350_+	hypothetical protein	NA	NA	NA	NA	NA
AUV99938.1|4279346_4280177_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	28.9	8.2e-06
>prophage 297
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4294053	4317219	6179177	protease,tRNA	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
AUV99949.1|4294053_4296000_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.2	9.4e-37
AUV99950.1|4296067_4296298_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.4e-16
AUV99951.1|4296622_4296940_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.4e-13
AUV99952.1|4296970_4299253_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	3.7e-165
AUV99953.1|4299390_4299609_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AUV99954.1|4299888_4300593_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUV99955.1|4300631_4302353_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	3.6e-16
AUV99956.1|4302353_4304120_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.3	9.2e-23
AUV99957.1|4304234_4305203_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.6e-61
AUV99958.1|4305734_4306229_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AUV99959.1|4306364_4310483_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	5.0e-88
AUV99960.1|4310604_4311216_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUV99961.1|4311224_4312568_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.7	7.8e-83
AUV99962.1|4312659_4313952_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	3.6e-93
AUV99963.1|4314152_4316591_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.6	1.5e-217
AUV99964.1|4316601_4317219_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	57.1	2.2e-72
>prophage 298
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4324350	4327577	6179177		Tetraselmis_virus(100.0%)	2	NA	NA
AUV99973.1|4324350_4325091_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.8e-20
AUV99974.1|4325294_4327577_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.9	1.9e-161
>prophage 299
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4331625	4332714	6179177		Streptococcus_phage(100.0%)	1	NA	NA
AUV99978.1|4331625_4332714_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.3e-80
>prophage 300
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4337007	4341560	6179177		Bacillus_phage(100.0%)	3	NA	NA
AUV99982.1|4337007_4337295_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	5.5e-10
AUV99983.1|4337510_4339766_+	ComEC family protein	NA	NA	NA	NA	NA
AUV99984.1|4339811_4341560_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	5.1e-58
>prophage 301
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4357594	4367864	6179177	tRNA,transposase	Clostridium_botulinum_C_phage(16.67%)	7	NA	NA
AUV99997.1|4357594_4358029_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	6.8e-20
AUV99998.1|4358120_4359311_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AUV99999.1|4359498_4360584_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	53.0	1.5e-100
AUW00001.1|4361175_4362576_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.0	5.0e-80
AUW01822.1|4362879_4364082_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.1	6.4e-44
AUW00002.1|4364409_4367025_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
AUW00003.1|4367090_4367864_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.0	8.1e-32
>prophage 302
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4374576	4376484	6179177		Tupanvirus(100.0%)	1	NA	NA
AUW00010.1|4374576_4376484_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	5.6e-50
>prophage 303
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4389259	4391314	6179177		Bacillus_phage(100.0%)	1	NA	NA
AUW00023.1|4389259_4391314_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.2	2.7e-18
>prophage 304
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4397179	4398347	6179177		Shigella_phage(100.0%)	1	NA	NA
AUW00025.1|4397179_4398347_+	DDE domain-containing protein	NA	Q716C2	Shigella_phage	89.8	6.9e-168
>prophage 305
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4405470	4407618	6179177		Bacillus_phage(100.0%)	1	NA	NA
AUW00027.1|4405470_4407618_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	25.1	1.6e-24
>prophage 306
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4418192	4418852	6179177		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUW00037.1|4418192_4418852_-	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	3.8e-46
>prophage 307
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4437291	4438032	6179177		Planktothrix_phage(100.0%)	1	NA	NA
AUW00055.1|4437291_4438032_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	1.4e-28
>prophage 308
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4462098	4462878	6179177		Brazilian_cedratvirus(100.0%)	1	NA	NA
AUW01828.1|4462098_4462878_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.2	3.3e-17
>prophage 309
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4467145	4473766	6179177		Morganella_phage(50.0%)	6	NA	NA
AUW00080.1|4467145_4467358_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	77.1	8.4e-24
AUW00081.1|4468019_4468241_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	56.5	6.7e-16
AUW00082.1|4468527_4468719_+	hypothetical protein	NA	NA	NA	NA	NA
AUW00083.1|4468878_4471998_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	20.6	1.0e-45
AUW01829.1|4472316_4472703_-	transporter	NA	NA	NA	NA	NA
AUW00084.1|4473061_4473766_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.4	5.3e-30
>prophage 310
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4487785	4488814	6179177		Bacillus_phage(100.0%)	1	NA	NA
AUW00098.1|4487785_4488814_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	36.4	5.2e-18
>prophage 311
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4494344	4495727	6179177		Enterobacteria_phage(100.0%)	1	NA	NA
AUW00103.1|4494344_4495727_+	xanthine permease XanP	NA	Q9KX94	Enterobacteria_phage	27.0	5.7e-20
>prophage 312
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4509217	4509958	6179177		Planktothrix_phage(100.0%)	1	NA	NA
AUW00118.1|4509217_4509958_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	6.7e-36
>prophage 313
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4517406	4518309	6179177		Bacillus_phage(100.0%)	1	NA	NA
AUW00125.1|4517406_4518309_+	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	32.1	4.7e-15
>prophage 314
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4522070	4528648	6179177		Serratia_phage(50.0%)	4	NA	NA
AUW00130.1|4522070_4524368_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A1S6UAD4	Serratia_phage	44.2	5.0e-05
AUW00131.1|4524419_4524740_-	PTS system fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
AUW00132.1|4524760_4525837_-	PTS fructose-like transporter subunit EIIC	NA	NA	NA	NA	NA
AUW00133.1|4526146_4528648_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.9	6.1e-12
>prophage 315
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4542630	4544878	6179177		Enterobacteria_phage(100.0%)	4	NA	NA
AUW00149.1|4542630_4542804_+	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	88.9	3.2e-05
AUW00150.1|4542800_4543043_-	hypothetical protein	NA	NA	NA	NA	NA
AUW00151.1|4543039_4544362_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.1	2.9e-199
AUW00152.1|4544383_4544878_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	78.1	3.3e-39
>prophage 316
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4561502	4564633	6179177		Cronobacter_phage(50.0%)	4	NA	NA
AUW00166.1|4561502_4562567_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.1	7.3e-92
AUW00167.1|4562617_4562911_-	hypothetical protein	NA	NA	NA	NA	NA
AUW00168.1|4563026_4563815_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
AUW00169.1|4563937_4564633_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	32.8	1.2e-26
>prophage 317
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4573982	4578156	6179177		Acanthocystis_turfacea_Chlorella_virus(50.0%)	6	NA	NA
AUW00176.1|4573982_4574921_+	glyoxylate/hydroxypyruvate reductase GhrA	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	28.4	4.6e-05
AUW00177.1|4575006_4575744_+	phosphatase	NA	NA	NA	NA	NA
AUW00178.1|4575766_4576321_+	molecular chaperone	NA	NA	NA	NA	NA
AUW01835.1|4576424_4576916_+	hypothetical protein	NA	NA	NA	NA	NA
AUW00179.1|4577206_4577512_+	hypothetical protein	NA	NA	NA	NA	NA
AUW00180.1|4577601_4578156_+	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.6	5.1e-28
>prophage 318
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4586525	4587446	6179177		Morganella_phage(100.0%)	1	NA	NA
AUW00188.1|4586525_4587446_-	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	42.4	1.3e-57
>prophage 319
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4590676	4590922	6179177		Salmonella_phage(100.0%)	1	NA	NA
AUW00192.1|4590676_4590922_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	47.4	7.7e-13
>prophage 320
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4612170	4617924	6179177	transposase	Trichoplusia_ni_ascovirus(25.0%)	7	NA	NA
AUW00213.1|4612170_4612905_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	2.9e-15
AUW00214.1|4613115_4613352_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
AUW00215.1|4613441_4614683_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AUW00216.1|4614877_4615312_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	6.8e-20
AUW00217.1|4615458_4616268_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
AUW00218.1|4616270_4617293_+	cell division protein YceG	NA	NA	NA	NA	NA
AUW00219.1|4617282_4617924_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	38.2	5.9e-28
>prophage 321
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4633695	4633953	6179177		Erwinia_phage(100.0%)	1	NA	NA
AUW00234.1|4633695_4633953_+	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	38.6	3.6e-05
>prophage 322
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4640245	4643996	6179177		Planktothrix_phage(50.0%)	4	NA	NA
AUW00238.1|4640245_4640947_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	41.3	5.4e-35
AUW00239.1|4640946_4642191_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AUW00240.1|4642239_4643151_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AUW00241.1|4643165_4643996_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	2.8e-22
>prophage 323
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4651100	4652051	6179177		Cyanophage(100.0%)	1	NA	NA
AUW00249.1|4651100_4652051_+	transaldolase	NA	A0A127KMN5	Cyanophage	35.1	1.6e-13
>prophage 324
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4657331	4658468	6179177		Bacillus_virus(100.0%)	1	NA	NA
AUW00255.1|4657331_4658468_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.6	1.3e-30
>prophage 325
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4665251	4756272	6179177	tRNA,tail,capsid,terminase,integrase,protease,holin,portal,head,transposase	Salmonella_phage(15.87%)	105	4664388:4664405	4749452:4749469
4664388:4664405	attL	CCAGCGCCGCCGCGCCCC	NA	NA	NA	NA
AUW00262.1|4665251_4666622_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.6e-107
AUW00263.1|4666625_4667267_-	lysogenization regulator HflD	NA	NA	NA	NA	NA
AUW00264.1|4667326_4668478_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUW00265.1|4668471_4668948_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AUW00266.1|4668957_4669620_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AUW00267.1|4669856_4671107_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	4.4e-19
AUW00268.1|4671220_4672363_-|integrase	integrase	integrase	O21929	Phage_21	80.2	1.1e-170
AUW00269.1|4672352_4672589_-	excisionase	NA	NA	NA	NA	NA
AUW00270.1|4672617_4672899_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	52.8	2.8e-19
AUW00271.1|4672901_4673135_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	56.8	1.1e-13
AUW00272.1|4673834_4674167_-	hypothetical protein	NA	NA	NA	NA	NA
AUW00273.1|4674854_4675262_-	hypothetical protein	NA	NA	NA	NA	NA
AUW00274.1|4675258_4676044_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	1.7e-61
AUW00275.1|4676036_4676237_-	hypothetical protein	NA	NA	NA	NA	NA
AUW00276.1|4676236_4676764_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	69.7	5.4e-64
AUW00277.1|4676896_4677724_-	DUF2303 domain-containing protein	NA	Q8HAA2	Salmonella_phage	84.4	6.2e-131
AUW00278.1|4677780_4678152_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	93.5	2.8e-59
AUW01838.1|4679009_4679456_+	hypothetical protein	NA	NA	NA	NA	NA
AUW00279.1|4679689_4679923_-	hypothetical protein	NA	Q56BD7	Escherichia_virus	37.0	6.6e-06
AUW00280.1|4680169_4680802_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.0	1.0e-32
AUW00281.1|4680899_4681130_+	XRE family transcriptional regulator	NA	Q716D6	Shigella_phage	51.6	3.6e-12
AUW00282.1|4681158_4681710_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	69.3	3.2e-67
AUW00283.1|4681882_4682062_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	65.5	5.6e-13
AUW00284.1|4682051_4682963_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	78.0	2.4e-51
AUW00285.1|4682959_4683418_+	hypothetical protein	NA	NA	NA	NA	NA
AUW00286.1|4683596_4684550_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	75.0	2.2e-127
AUW00287.1|4684542_4686513_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.9	1.4e-197
AUW00288.1|4686509_4686986_+|protease	SOS-response repressor and protease LexA	protease	U5P451	Shigella_phage	66.2	4.5e-17
AUW00289.1|4686982_4687381_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	70.5	6.0e-47
AUW00290.1|4687469_4688192_+	DNA-binding protein	NA	A0A0P0ZCS0	Stx2-converting_phage	67.9	1.4e-73
AUW00291.1|4688249_4689749_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AUW00292.1|4689745_4690501_+	hypothetical protein	NA	U5N3V8	Enterobacteria_phage	33.9	2.4e-33
AUW00293.1|4690725_4691250_+	hypothetical protein	NA	NA	NA	NA	NA
AUW00294.1|4691258_4692314_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	53.7	4.2e-108
AUW00295.1|4692332_4693163_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	48.1	1.3e-56
AUW00296.1|4693373_4693565_+	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	84.1	8.3e-23
AUW00297.1|4693714_4694794_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	79.3	1.8e-170
AUW00298.1|4695070_4695571_+	HNH endonuclease	NA	Q2NPG0	Xanthomonas_virus	41.6	1.1e-21
AUW00299.1|4695702_4696128_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	84.4	1.1e-59
AUW00300.1|4696803_4697115_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.5e-48
AUW00301.1|4697111_4697651_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	99.4	5.1e-102
AUW00302.1|4697647_4697995_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.0	5.2e-39
AUW00303.1|4697991_4698267_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	55.1	5.2e-18
AUW00304.1|4698607_4699156_+	hypothetical protein	NA	NA	NA	NA	NA
AUW00305.1|4699742_4700033_+	hypothetical protein	NA	NA	NA	NA	NA
AUW00306.1|4700150_4700396_+	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	60.5	1.2e-18
AUW00307.1|4700450_4700792_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	75.7	2.7e-48
AUW00308.1|4700909_4701374_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	6.3e-48
AUW00309.1|4701327_4703064_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.9	1.1e-137
AUW00310.1|4703070_4704390_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	58.9	2.2e-138
AUW00311.1|4704365_4705073_+|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.0	6.4e-68
AUW00312.1|4705082_4706303_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.5	3.4e-141
AUW00313.1|4706348_4706603_+	hypothetical protein	NA	NA	NA	NA	NA
AUW01839.1|4706608_4706941_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	31.6	8.8e-12
AUW00314.1|4706953_4707292_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	67.0	1.2e-37
AUW00315.1|4707288_4707738_+	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	81.9	5.1e-63
AUW00316.1|4707734_4708082_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	59.3	1.8e-31
AUW00317.1|4708138_4708849_+|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	69.1	1.3e-84
AUW00318.1|4708879_4709284_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	56.5	3.2e-32
AUW00319.1|4709286_4709592_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.0	2.8e-28
AUW00320.1|4709784_4710300_+	hypothetical protein	NA	A0A1V0E5P7	Salmonella_phage	69.5	1.9e-61
AUW00321.1|4710495_4710870_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	51.6	7.6e-28
AUW00322.1|4710923_4714331_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	42.9	8.7e-187
AUW00323.1|4714354_4714819_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	63.3	1.7e-53
AUW00324.1|4714815_4715292_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	67.1	2.3e-53
AUW00325.1|4715307_4715688_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	3.2e-58
AUW00326.1|4715684_4718762_+	kinase	NA	A0A286S259	Klebsiella_phage	61.0	0.0e+00
AUW00327.1|4722965_4723469_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	71.9	1.6e-52
AUW00328.1|4723598_4723841_-	hypothetical protein	NA	NA	NA	NA	NA
AUW00329.1|4723840_4724083_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	75.9	1.2e-29
AUW00330.1|4724161_4724581_+	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	56.7	2.1e-34
AUW00331.1|4724582_4725848_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
AUW00332.1|4725890_4726532_+	hypothetical protein	NA	NA	NA	NA	NA
AUW01840.1|4726845_4727028_+	hypothetical protein	NA	NA	NA	NA	NA
AUW00333.1|4727470_4727908_-	hypothetical protein	NA	NA	NA	NA	NA
AUW00334.1|4728985_4729138_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.0	1.9e-17
AUW00335.1|4729282_4731067_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.7	5.6e-20
AUW00336.1|4731144_4732335_-	HD domain-containing protein	NA	NA	NA	NA	NA
AUW00337.1|4733693_4734461_-	ferric citrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	26.2	2.6e-14
AUW00338.1|4734461_4735415_-	iron-dicitrate transporter subunit FecD	NA	NA	NA	NA	NA
AUW00339.1|4735411_4736410_-	iron-dicitrate transporter permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.1	5.4e-12
AUW00340.1|4736406_4737309_-	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AUW00341.1|4737367_4739704_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUW00342.1|4739802_4740750_-	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUW00343.1|4740746_4741268_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUW00344.1|4741527_4742316_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUW00345.1|4742859_4743774_+	lipid A biosynthesis palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	51.2	4.5e-74
AUW00346.1|4743864_4744503_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
AUW00347.1|4744632_4744896_+	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AUW00348.1|4744944_4745070_-	hypothetical protein	NA	NA	NA	NA	NA
AUW01841.1|4745210_4745285_-	hypothetical protein	NA	NA	NA	NA	NA
AUW00349.1|4745284_4745386_-	hypothetical protein	NA	NA	NA	NA	NA
AUW00350.1|4745443_4746457_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
AUW00351.1|4746753_4746993_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AUW00352.1|4746987_4747332_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AUW00353.1|4747318_4747828_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AUW00354.1|4747990_4748683_+	hypothetical protein	NA	NA	NA	NA	NA
AUW00355.1|4748720_4749905_-	cyanate MFS transporter	NA	NA	NA	NA	NA
4749452:4749469	attR	CCAGCGCCGCCGCGCCCC	NA	NA	NA	NA
AUW00356.1|4750005_4750797_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUW01842.1|4750780_4751227_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AUW00357.1|4751390_4751891_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AUW00358.1|4751924_4753421_-	diguanylate cylase	NA	A0A127AWB9	Bacillus_phage	30.6	4.1e-08
AUW00359.1|4753419_4753695_+	hypothetical protein	NA	NA	NA	NA	NA
AUW00360.1|4753782_4754940_+	glycosyl transferase	NA	NA	NA	NA	NA
AUW00361.1|4754988_4756272_-	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	28.6	2.2e-10
>prophage 326
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4759604	4760459	6179177		Indivirus(100.0%)	1	NA	NA
AUW00364.1|4759604_4760459_+	hypothetical protein	NA	A0A1V0SDE7	Indivirus	25.3	3.2e-13
>prophage 327
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4764087	4766349	6179177		Tupanvirus(100.0%)	2	NA	NA
AUW00370.1|4764087_4765341_-	chitinase	NA	A0A2K9L3D4	Tupanvirus	28.3	9.1e-25
AUW00371.1|4765707_4766349_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	39.1	2.6e-20
>prophage 328
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4772284	4774240	6179177		Streptococcus_phage(100.0%)	1	NA	NA
AUW00378.1|4772284_4774240_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.9	4.4e-42
>prophage 329
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4778470	4779103	6179177		Bacillus_phage(100.0%)	1	NA	NA
AUW00383.1|4778470_4779103_-	sulfate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	3.4e-12
>prophage 330
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4785113	4786334	6179177		Klosneuvirus(100.0%)	1	NA	NA
AUW00390.1|4785113_4786334_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.2e-26
>prophage 331
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4795751	4796579	6179177		Bacillus_virus(100.0%)	1	NA	NA
AUW00399.1|4795751_4796579_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.1	1.2e-70
>prophage 332
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4802794	4808534	6179177		Tupanvirus(50.0%)	5	NA	NA
AUW00407.1|4802794_4805053_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	49.9	2.1e-144
AUW01844.1|4805141_4805489_+	cell division activator CedA	NA	NA	NA	NA	NA
AUW00408.1|4805564_4806956_-	L-cystine transporter	NA	NA	NA	NA	NA
AUW00409.1|4807090_4807681_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AUW00410.1|4807772_4808534_-	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.0	1.8e-15
>prophage 333
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4812909	4814226	6179177		Streptococcus_phage(100.0%)	1	NA	NA
AUW00415.1|4812909_4814226_-	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	32.6	1.6e-40
>prophage 334
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4822739	4825697	6179177		Acinetobacter_phage(100.0%)	2	NA	NA
AUW00426.1|4822739_4824098_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	4.7e-35
AUW00427.1|4824101_4825697_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.7	1.1e-46
>prophage 335
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4838650	4841248	6179177		Tupanvirus(100.0%)	1	NA	NA
AUW00439.1|4838650_4841248_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.0	2.2e-89
>prophage 336
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4846092	4846683	6179177		Staphylococcus_phage(100.0%)	1	NA	NA
AUW00443.1|4846092_4846683_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	3.5e-43
>prophage 337
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4852261	4858447	6179177		Bodo_saltans_virus(33.33%)	5	NA	NA
AUW00450.1|4852261_4854196_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	25.1	1.4e-08
AUW00451.1|4854277_4855435_-	hypothetical protein	NA	NA	NA	NA	NA
AUW00452.1|4855617_4856406_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
AUW00453.1|4856643_4857453_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	1.6e-14
AUW00454.1|4857454_4858447_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	26.7	2.1e-08
>prophage 338
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4881566	4882586	6179177		Bacillus_phage(100.0%)	1	NA	NA
AUW00474.1|4881566_4882586_+	methionine ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.6	6.9e-15
>prophage 339
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4891452	4892247	6179177		Bacillus_virus(100.0%)	1	NA	NA
AUW00480.1|4891452_4892247_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.4	1.4e-31
>prophage 340
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4906998	4974125	6179177	plate,protease,tRNA	Enterobacteria_phage(23.08%)	62	NA	NA
AUW00494.1|4906998_4907733_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.1	5.3e-33
AUW00495.1|4908102_4908645_-	chorismate mutase	NA	NA	NA	NA	NA
AUW00496.1|4908883_4909447_-|protease	protease	protease	NA	NA	NA	NA
AUW00497.1|4909513_4909669_+	NmrA family transcriptional regulator	NA	NA	NA	NA	NA
AUW00498.1|4910280_4910772_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AUW01854.1|4910812_4912348_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AUW00499.1|4912361_4913705_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AUW00500.1|4913701_4914367_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AUW00501.1|4914363_4916052_+	OmpA family protein	NA	NA	NA	NA	NA
AUW00502.1|4916195_4916687_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUW00503.1|4916934_4919577_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.4	6.5e-97
AUW00504.1|4919573_4922069_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.5	1.0e-19
AUW00505.1|4922321_4924289_+	hypothetical protein	NA	A0A077K801	Ralstonia_phage	32.4	6.6e-62
AUW00506.1|4924290_4924551_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
AUW00507.1|4924550_4925984_+	hypothetical protein	NA	NA	NA	NA	NA
AUW01855.1|4926125_4929359_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
AUW00508.1|4929454_4929733_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
AUW00509.1|4929745_4931503_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AUW00510.1|4931466_4932552_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AUW00511.1|4932529_4933069_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AUW00512.1|4933070_4933526_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AUW00513.1|4933549_4934884_+	hypothetical protein	NA	NA	NA	NA	NA
AUW00514.1|4935045_4936725_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
AUW00515.1|4936779_4938234_-	MFS transporter	NA	NA	NA	NA	NA
AUW00516.1|4939115_4940498_+	carbohydrate porin	NA	NA	NA	NA	NA
AUW00517.1|4940561_4941521_-	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AUW00518.1|4941535_4942069_-	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
AUW00519.1|4942065_4943289_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUW00520.1|4943285_4944008_-	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
AUW00521.1|4944009_4945269_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUW00522.1|4945265_4945985_-	KR domain-containing protein	NA	NA	NA	NA	NA
AUW00523.1|4945981_4946416_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AUW00524.1|4946658_4947384_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.4	3.5e-45
AUW01856.1|4947485_4947830_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
AUW00525.1|4947927_4949049_-	MFS transporter	NA	NA	NA	NA	NA
AUW00526.1|4949257_4950394_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUW00527.1|4950565_4951450_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUW00528.1|4951563_4952448_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUW00529.1|4952606_4953578_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUW00530.1|4953622_4954453_-	oxidoreductase	NA	NA	NA	NA	NA
AUW01857.1|4954647_4955673_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUW00531.1|4956511_4956700_+	cold-shock protein	NA	NA	NA	NA	NA
AUW00532.1|4956688_4956907_-	hypothetical protein	NA	NA	NA	NA	NA
AUW00533.1|4957069_4957699_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AUW00534.1|4957824_4958406_+	hypothetical protein	NA	NA	NA	NA	NA
AUW00535.1|4958602_4959166_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
AUW00536.1|4959220_4959535_-	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
AUW00537.1|4959712_4959904_-	hypothetical protein	NA	NA	NA	NA	NA
AUW00538.1|4960060_4960255_-	hypothetical protein	NA	NA	NA	NA	NA
AUW00539.1|4960541_4960964_+	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	51.2	2.6e-32
AUW00540.1|4960963_4962229_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	66.4	1.0e-156
AUW01858.1|4962301_4963369_-	oxidoreductase	NA	NA	NA	NA	NA
AUW00541.1|4963385_4964129_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.6	8.6e-15
AUW01859.1|4964745_4965366_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUW00542.1|4965708_4966692_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AUW00543.1|4967175_4968549_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	6.8e-50
AUW00544.1|4968593_4969529_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.4	7.0e-139
AUW01860.1|4970339_4971278_+|protease	outer membrane protease PgtE	protease	NA	NA	NA	NA
AUW00545.1|4971656_4971947_-	lipoprotein bor	NA	C6ZCX3	Enterobacteria_phage	66.0	9.7e-31
AUW00546.1|4972135_4972570_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.2e-30
AUW00547.1|4972652_4972865_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
AUW00548.1|4973018_4974125_-	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	57.4	4.9e-107
>prophage 341
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4978644	4984029	6179177	holin	Enterobacterial_phage(33.33%)	9	NA	NA
AUW01861.1|4978644_4979181_+	phage repressor protein	NA	K7PKK1	Enterobacteria_phage	49.7	5.2e-30
AUW00551.1|4979641_4980004_+	antitermination protein	NA	C6ZR44	Salmonella_phage	58.3	5.4e-31
AUW00552.1|4980080_4980473_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	66.2	1.3e-38
AUW00553.1|4980462_4980735_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	55.4	2.2e-16
AUW00554.1|4980742_4981285_+	hypothetical protein	NA	A0A0U2I1S0	Escherichia_phage	66.3	8.9e-70
AUW00555.1|4981511_4981877_+	hypothetical protein	NA	NA	NA	NA	NA
AUW00556.1|4982204_4982477_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AUW00557.1|4982473_4982914_-	META domain-containing protein	NA	NA	NA	NA	NA
AUW00558.1|4983039_4984029_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.7	1.9e-70
>prophage 342
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4993317	4994838	6179177		Indivirus(100.0%)	1	NA	NA
AUW00568.1|4993317_4994838_-	amino acid ABC transporter permease/ATP-binding protein	NA	A0A1V0SE00	Indivirus	26.3	1.2e-10
>prophage 343
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5017433	5018940	6179177		Streptococcus_phage(50.0%)	2	NA	NA
AUW00590.1|5017433_5018123_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.1	9.8e-13
AUW00591.1|5018193_5018940_+	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	29.9	6.2e-05
>prophage 344
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5040527	5041598	6179177		Synechococcus_phage(100.0%)	1	NA	NA
AUW00609.1|5040527_5041598_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	V5UTY8	Synechococcus_phage	39.3	2.4e-10
>prophage 345
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5051373	5055984	6179177		Klosneuvirus(50.0%)	2	NA	NA
AUW00619.1|5051373_5055276_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	7.6e-54
AUW00620.1|5055324_5055984_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	50.4	1.4e-29
>prophage 346
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5067994	5072613	6179177		Bacillus_phage(20.0%)	7	NA	NA
AUW00631.1|5067994_5068966_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.7	2.1e-13
AUW00632.1|5069031_5069235_-	selenoprotein YdfZ	NA	J9Q802	Salmonella_phage	53.7	6.0e-11
AUW00633.1|5069527_5069725_+	hypothetical protein	NA	NA	NA	NA	NA
AUW00634.1|5070031_5070274_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	82.3	1.6e-31
AUW00635.1|5070499_5071027_+	cytochrome B	NA	A0A0U2QLA7	Escherichia_phage	46.7	2.4e-19
AUW00636.1|5071196_5071472_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
AUW00637.1|5071494_5072613_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.5	4.7e-33
>prophage 347
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5079849	5081358	6179177		Mollivirus(100.0%)	1	NA	NA
AUW00644.1|5079849_5081358_+	carboxylesterase/lipase family protein	NA	A0A0M4JT58	Mollivirus	29.5	1.7e-30
>prophage 348
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5094703	5096668	6179177		Phage_TP(100.0%)	1	NA	NA
AUW00656.1|5094703_5096668_+	U32 family peptidase	NA	Q6DW11	Phage_TP	28.0	3.0e-22
>prophage 349
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5103417	5104428	6179177		Mycoplasma_phage(100.0%)	1	NA	NA
AUW00664.1|5103417_5104428_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	35.8	4.7e-24
>prophage 350
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5118483	5119272	6179177		Phage_21(100.0%)	1	NA	NA
AUW00680.1|5118483_5119272_+	hypothetical protein	NA	Q77Z02	Phage_21	46.6	2.7e-59
>prophage 351
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5125593	5127690	6179177		Salmonella_phage(100.0%)	1	NA	NA
AUW01866.1|5125593_5127690_-	TonB-dependent siderophore receptor	NA	A0A1B0VCF0	Salmonella_phage	68.2	4.1e-139
>prophage 352
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5138223	5139003	6179177		Bacillus_virus(100.0%)	1	NA	NA
AUW00700.1|5138223_5139003_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	1.4e-20
>prophage 353
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5152723	5153425	6179177		Bacillus_virus(100.0%)	1	NA	NA
AUW00713.1|5152723_5153425_+	ABC transporter substrate-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	1.1e-30
>prophage 354
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5159016	5160561	6179177		Escherichia_phage(100.0%)	1	NA	NA
AUW00719.1|5159016_5160561_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	44.6	1.9e-19
>prophage 355
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5166663	5168154	6179177		Mycobacterium_phage(100.0%)	1	NA	NA
AUW00723.1|5166663_5168154_+	methyl viologen resistance protein SmvA	NA	A0A0M3UL24	Mycobacterium_phage	29.3	1.1e-32
>prophage 356
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5178134	5179739	6179177		Planktothrix_phage(100.0%)	1	NA	NA
AUW00734.1|5178134_5179739_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	1.1e-19
>prophage 357
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5183980	5188926	6179177		Tupanvirus(33.33%)	5	NA	NA
AUW00739.1|5183980_5184991_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.6	2.5e-25
AUW00740.1|5185247_5185847_+	pyrophosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	40.6	5.3e-23
AUW00741.1|5186339_5186528_+	hypothetical protein	NA	NA	NA	NA	NA
AUW00742.1|5186648_5187176_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUW00743.1|5187213_5188926_-	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	25.4	1.2e-32
>prophage 358
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5207496	5211080	6179177		Bacillus_virus(50.0%)	2	NA	NA
AUW00761.1|5207496_5208192_+	magnesium transport protein MgtC	NA	G3MA03	Bacillus_virus	43.1	6.2e-15
AUW00762.1|5208347_5211080_+	magnesium-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	25.6	1.9e-35
>prophage 359
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5219352	5220941	6179177		Bacillus_virus(50.0%)	2	NA	NA
AUW00772.1|5219352_5220168_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	21.3	4.3e-07
AUW00773.1|5220164_5220941_+	ABC transporter ATP-binding protein	NA	A0A140XAK6	Dickeya_phage	48.4	1.5e-17
>prophage 360
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5234129	5238248	6179177		Klosneuvirus(50.0%)	4	NA	NA
AUW00782.1|5234129_5235515_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.5	9.7e-28
AUW00783.1|5235822_5236758_-	thiamine biosynthesis protein	NA	NA	NA	NA	NA
AUW00784.1|5236782_5237523_-	ABC transporter permease	NA	NA	NA	NA	NA
AUW00785.1|5237519_5238248_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	2.8e-18
>prophage 361
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5255337	5256222	6179177		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AUW00802.1|5255337_5256222_-	KR domain-containing protein	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	56.7	3.7e-81
>prophage 362
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5263457	5264855	6179177		Erysipelothrix_phage(100.0%)	1	NA	NA
AUW00807.1|5263457_5264855_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.7	5.3e-42
>prophage 363
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5296184	5316747	6179177		Bacillus_phage(50.0%)	5	NA	NA
AUW00832.1|5296184_5297987_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.5	5.7e-20
AUW00833.1|5297973_5299776_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	27.4	3.2e-31
AUW00834.1|5299942_5300902_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUW00835.1|5301085_5307184_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	26.9	1.5e-32
AUW00836.1|5307270_5316747_+	KR domain-containing protein	NA	D0R7J2	Paenibacillus_phage	36.8	8.1e-49
>prophage 364
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5332302	5333085	6179177		Staphylococcus_phage(100.0%)	1	NA	NA
AUW00850.1|5332302_5333085_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	4.8e-16
>prophage 365
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5337692	5339690	6179177		Acinetobacter_phage(100.0%)	1	NA	NA
AUW00856.1|5337692_5339690_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.3	4.2e-08
>prophage 366
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5343440	5344169	6179177		Escherichia_phage(100.0%)	1	NA	NA
AUW00860.1|5343440_5344169_+	tetrathionate reductase subunit TtrB	NA	A0A077SL61	Escherichia_phage	38.4	8.4e-23
>prophage 367
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5362363	5363200	6179177		Mycobacterium_phage(100.0%)	1	NA	NA
AUW00882.1|5362363_5363200_-	alpha/beta hydrolase	NA	A0A1I9SAY0	Mycobacterium_phage	38.5	1.1e-13
>prophage 368
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5372463	5373996	6179177		Staphylococcus_phage(100.0%)	1	NA	NA
AUW00894.1|5372463_5373996_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	5.0e-17
>prophage 369
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5381768	5385332	6179177		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
AUW00902.1|5381768_5382764_+	oxidoreductase	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	30.5	4.4e-22
AUW00903.1|5382853_5384116_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
AUW00904.1|5384246_5385332_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	67.1	7.9e-142
>prophage 370
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5389760	5390570	6179177		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
AUW00909.1|5389760_5390570_-	ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	29.4	2.8e-11
>prophage 371
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5394557	5396015	6179177		Mycoplasma_phage(100.0%)	1	NA	NA
AUW00914.1|5394557_5396015_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.3	1.7e-38
>prophage 372
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5403323	5404064	6179177		Indivirus(100.0%)	1	NA	NA
AUW00924.1|5403323_5404064_-	amino acid ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.1	7.3e-14
>prophage 373
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5407565	5408357	6179177		Bacillus_virus(100.0%)	1	NA	NA
AUW01873.1|5407565_5408357_+	ABC transporter	NA	G3M9Y6	Bacillus_virus	29.5	1.6e-19
>prophage 374
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5428284	5429646	6179177		Bacillus_phage(100.0%)	1	NA	NA
AUW00951.1|5428284_5429646_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.4	3.4e-17
>prophage 375
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5439778	5440159	6179177		Streptococcus_phage(100.0%)	1	NA	NA
AUW01876.1|5439778_5440159_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	1.4e-08
>prophage 376
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5444302	5445808	6179177		Staphylococcus_phage(50.0%)	2	NA	NA
AUW00967.1|5444302_5445001_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.3	6.2e-15
AUW00968.1|5445010_5445808_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A1M7XV31	Cedratvirus	26.9	1.2e-11
>prophage 377
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5449988	5451092	6179177		uncultured_virus(100.0%)	1	NA	NA
AUW00972.1|5449988_5451092_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	48.9	1.1e-101
>prophage 378
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5458977	5466197	6179177		Escherichia_phage(50.0%)	5	NA	NA
AUW00982.1|5458977_5460048_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	44.6	1.3e-64
AUW00983.1|5460255_5463363_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	60.0	0.0e+00
AUW00984.1|5463418_5464669_+	MFS transporter	NA	NA	NA	NA	NA
AUW00985.1|5464742_5465831_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	82.5	3.7e-176
AUW00986.1|5465933_5466197_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	82.4	3.8e-34
>prophage 379
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5472420	5482812	6179177		Klosneuvirus(20.0%)	9	NA	NA
AUW00995.1|5472420_5474463_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	22.2	1.4e-14
AUW00996.1|5474634_5475384_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
AUW00997.1|5475474_5476161_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUW00998.1|5476204_5476636_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.3	1.5e-19
AUW01879.1|5476913_5478377_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	31.4	1.4e-45
AUW00999.1|5478611_5479988_-	MFS transporter	NA	NA	NA	NA	NA
AUW01000.1|5480031_5481051_-	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
AUW01001.1|5481065_5482280_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.5	9.7e-48
AUW01002.1|5482485_5482812_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	53.9	7.6e-24
>prophage 380
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5487565	5489691	6179177		Escherichia_phage(100.0%)	3	NA	NA
AUW01007.1|5487565_5488183_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	57.6	2.6e-73
AUW01008.1|5488184_5489042_+	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AUW01009.1|5489082_5489691_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.6	2.2e-24
>prophage 381
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5500065	5502222	6179177		Bacillus_virus(100.0%)	1	NA	NA
AUW01019.1|5500065_5502222_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	34.0	7.8e-16
>prophage 382
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5509572	5510532	6179177		Salmonella_phage(100.0%)	1	NA	NA
AUW01029.1|5509572_5510532_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	1.3e-52
>prophage 383
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5521457	5524235	6179177		Lactobacillus_phage(100.0%)	1	NA	NA
AUW01039.1|5521457_5524235_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	30.8	4.7e-66
>prophage 384
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5540029	5543164	6179177	integrase	Morganella_phage(25.0%)	4	5539700:5539715	5544346:5544361
5539700:5539715	attL	TCTTTTTCTTCTTCGT	NA	NA	NA	NA
AUW01054.1|5540029_5541130_+|integrase	integrase	integrase	A0A1W6JP34	Morganella_phage	57.1	2.9e-115
AUW01055.1|5541184_5541505_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	45.1	2.5e-19
AUW01056.1|5541504_5541744_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	58.2	1.6e-18
AUW01057.1|5541853_5543164_-	hypothetical protein	NA	A0A0K2FI18	Enterobacter_phage	31.8	7.3e-33
5544346:5544361	attR	TCTTTTTCTTCTTCGT	NA	NA	NA	NA
>prophage 385
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5547449	5565971	6179177	head,tail	Salmonella_phage(56.52%)	26	NA	NA
AUW01060.1|5547449_5547635_-	hypothetical protein	NA	Q9B026	Phage_GMSE-1	42.2	4.0e-06
AUW01061.1|5547634_5548540_-	hypothetical protein	NA	A0A1I9SEW2	Klebsiella_phage	57.5	4.7e-47
AUW01062.1|5548539_5549316_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	57.3	1.8e-79
AUW01063.1|5549312_5550512_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	71.4	6.2e-156
AUW01064.1|5550511_5550865_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	6.7e-50
AUW01065.1|5550864_5551620_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	76.8	3.3e-107
AUW01066.1|5551688_5551898_-	hypothetical protein	NA	NA	NA	NA	NA
AUW01067.1|5552123_5552474_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	80.8	7.9e-27
AUW01068.1|5552476_5553541_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	73.2	5.2e-146
AUW01069.1|5553543_5553846_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	68.0	8.8e-35
AUW01070.1|5553845_5554433_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	77.2	1.9e-73
AUW01071.1|5554432_5556349_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	64.5	2.8e-227
AUW01072.1|5556338_5556491_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	80.0	4.1e-17
AUW01073.1|5556526_5557006_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	64.7	2.2e-51
AUW01074.1|5557009_5557450_-	DUF3277 domain-containing protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	80.1	1.0e-63
AUW01075.1|5557459_5558611_-	hypothetical protein	NA	A0A0M4RD26	Salmonella_phage	82.0	4.0e-176
AUW01076.1|5558613_5559165_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	47.2	5.0e-44
AUW01077.1|5559157_5559562_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	73.8	1.9e-45
AUW01078.1|5559561_5560068_-	hypothetical protein	NA	NA	NA	NA	NA
AUW01079.1|5560064_5560484_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	63.7	1.2e-42
AUW01080.1|5560452_5560734_-	hypothetical protein	NA	NA	NA	NA	NA
AUW01081.1|5560779_5561721_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	3.2e-139
AUW01082.1|5561732_5562227_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	63.8	6.1e-49
AUW01083.1|5562238_5563438_-	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	55.1	1.9e-104
AUW01084.1|5563915_5564464_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	55.7	1.1e-48
AUW01085.1|5564519_5565971_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	67.6	1.9e-191
>prophage 386
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5570514	5588657	6179177	holin	Klebsiella_phage(73.91%)	27	NA	NA
AUW01089.1|5570514_5571270_+	hypothetical protein	NA	U5N3V8	Enterobacteria_phage	33.9	2.4e-33
AUW01090.1|5572254_5573019_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	46.2	2.3e-10
AUW01091.1|5573410_5573704_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	73.2	2.6e-31
AUW01092.1|5573700_5573856_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	76.5	2.1e-16
AUW01093.1|5573845_5574121_-	hypothetical protein	NA	NA	NA	NA	NA
AUW01094.1|5574117_5574462_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	86.0	7.0e-44
AUW01095.1|5574458_5575001_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	77.5	2.6e-77
AUW01096.1|5574997_5575309_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.5e-48
AUW01097.1|5575991_5577077_+	hypothetical protein	NA	NA	NA	NA	NA
AUW01098.1|5577076_5578069_+	hypothetical protein	NA	NA	NA	NA	NA
AUW01099.1|5578108_5578456_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	86.7	1.8e-55
AUW01100.1|5578537_5579500_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	97.8	7.6e-181
AUW01101.1|5579501_5581148_-	ATP-dependent helicase	NA	A0A286N2P9	Klebsiella_phage	81.0	1.7e-273
AUW01102.1|5581457_5581751_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
AUW01103.1|5581725_5581947_-	XRE family transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
AUW01104.1|5582044_5582713_+	LexA family transcriptional repressor	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
AUW01105.1|5582883_5583198_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
AUW01106.1|5583190_5583379_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
AUW01107.1|5583548_5583914_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
AUW01108.1|5583906_5584161_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	88.1	1.5e-35
AUW01109.1|5584347_5584788_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	78.3	1.2e-56
AUW01882.1|5584831_5585350_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	78.5	1.8e-75
AUW01110.1|5585354_5586062_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	86.2	4.5e-106
AUW01111.1|5586054_5586489_+	hypothetical protein	NA	NA	NA	NA	NA
AUW01112.1|5586472_5586697_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	55.4	2.8e-17
AUW01113.1|5586847_5587111_+	pyocin activator protein PrtN	NA	A0A1L5C290	Pseudoalteromonas_phage	45.1	7.0e-12
AUW01114.1|5588141_5588657_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.8	4.1e-24
>prophage 387
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5602830	5605799	6179177		Molluscum_contagiosum_virus(50.0%)	3	NA	NA
AUW01127.1|5602830_5603313_+	glutathione peroxidase	NA	A0A1S7DMQ0	Molluscum_contagiosum_virus	40.2	3.0e-16
AUW01128.1|5603489_5604179_-	VIT family protein	NA	NA	NA	NA	NA
AUW01129.1|5604497_5605799_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.5e-17
>prophage 388
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5617246	5617450	6179177		Salmonella_phage(100.0%)	1	NA	NA
AUW01137.1|5617246_5617450_+	selenoprotein YdfZ	NA	J9Q802	Salmonella_phage	67.2	3.5e-19
>prophage 389
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5622808	5624179	6179177		Pandoravirus(100.0%)	1	NA	NA
AUW01143.1|5622808_5624179_+	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	33.7	8.0e-67
>prophage 390
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5635359	5636634	6179177	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AUW01155.1|5635359_5636634_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.9	7.2e-86
>prophage 391
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5645274	5646752	6179177		Salmonella_phage(50.0%)	2	NA	NA
AUW01163.1|5645274_5645796_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	2.1e-47
AUW01164.1|5645855_5646752_-	oxidoreductase	NA	A0A1V0SDE7	Indivirus	29.7	2.7e-07
>prophage 392
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5650909	5659608	6179177		Bacillus_phage(20.0%)	9	NA	NA
AUW01170.1|5650909_5651764_+	peptidoglycan endopeptidase	NA	A0A217EQL1	Bacillus_phage	38.7	4.7e-17
AUW01171.1|5651888_5652470_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	45.3	2.6e-43
AUW01172.1|5652526_5653693_-	MFS transporter	NA	NA	NA	NA	NA
AUW01173.1|5653857_5653947_-	YnhF family membrane protein	NA	NA	NA	NA	NA
AUW01174.1|5654243_5655269_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	1.8e-31
AUW01175.1|5655287_5656199_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUW01176.1|5656311_5657496_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AUW01177.1|5657794_5658943_+	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	6.5e-86
AUW01178.1|5658972_5659608_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	2.1e-22
>prophage 393
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5674113	5678206	6179177		Trichoplusia_ni_ascovirus(50.0%)	5	NA	NA
AUW01194.1|5674113_5674998_+	KR domain-containing protein	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	55.8	2.8e-81
AUW01195.1|5675019_5675826_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AUW01196.1|5675932_5676568_-	carbonic anhydrase	NA	NA	NA	NA	NA
AUW01197.1|5676792_5677422_+	threonine transporter	NA	NA	NA	NA	NA
AUW01198.1|5677435_5678206_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.3	6.2e-16
>prophage 394
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5683271	5688668	6179177		Planktothrix_phage(33.33%)	4	NA	NA
AUW01203.1|5683271_5684252_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	1.2e-11
AUW01204.1|5684248_5685214_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	26.9	1.8e-09
AUW01205.1|5685288_5687694_-	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
AUW01206.1|5688119_5688668_+	DNA recombinase	NA	A0A2L1IV36	Escherichia_phage	51.9	7.2e-51
>prophage 395
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5694687	5695239	6179177	integrase	Escherichia_phage(100.0%)	1	5691930:5691944	5702163:5702177
5691930:5691944	attL	GATATGCAGGACGTT	NA	NA	NA	NA
AUW01212.1|5694687_5695239_-|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	55.1	2.6e-53
AUW01212.1|5694687_5695239_-|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	55.1	2.6e-53
5702163:5702177	attR	AACGTCCTGCATATC	NA	NA	NA	NA
>prophage 396
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5698998	5699871	6179177		Lactobacillus_phage(100.0%)	1	NA	NA
AUW01217.1|5698998_5699871_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.3e-05
>prophage 397
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5703297	5704368	6179177		Bacillus_virus(100.0%)	1	NA	NA
AUW01221.1|5703297_5704368_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	9.8e-28
>prophage 398
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5732312	5734655	6179177		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUW01240.1|5732312_5734655_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.1	3.9e-05
>prophage 399
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5755534	5759862	6179177		Planktothrix_phage(50.0%)	3	NA	NA
AUW01257.1|5755534_5756356_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	5.6e-15
AUW01894.1|5756862_5758935_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUW01258.1|5759073_5759862_-	ABC transporter	NA	G3M9Y6	Bacillus_virus	33.8	8.5e-29
>prophage 400
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5772925	5774889	6179177		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
AUW01270.1|5772925_5773942_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	6.0e-43
AUW01271.1|5773938_5774889_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.9	4.8e-34
>prophage 401
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5793049	5794270	6179177		environmental_halophage(100.0%)	1	NA	NA
AUW01290.1|5793049_5794270_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.6	2.6e-93
>prophage 402
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5811975	5829962	6179177	tRNA	Tupanvirus(25.0%)	17	NA	NA
AUW01306.1|5811975_5814354_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.0	2.9e-173
AUW01307.1|5814696_5815530_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
AUW01308.1|5815683_5816730_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	47.4	2.3e-82
AUW01309.1|5816847_5817075_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
AUW01310.1|5817109_5818552_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	34.4	7.4e-55
AUW01311.1|5818713_5819178_-	endopeptidase	NA	NA	NA	NA	NA
AUW01312.1|5819259_5820009_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	4.2e-09
AUW01313.1|5820008_5820560_-	glutathione peroxidase	NA	NA	NA	NA	NA
AUW01314.1|5820784_5821585_+	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
AUW01896.1|5821611_5822598_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AUW01315.1|5822698_5822998_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	9.4e-13
AUW01316.1|5823002_5825390_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUW01317.1|5825405_5826389_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	2.9e-34
AUW01318.1|5826786_5827143_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AUW01319.1|5827193_5827391_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AUW01320.1|5827487_5828030_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.3	5.3e-14
AUW01321.1|5828033_5829962_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	6.7e-128
>prophage 403
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5839325	5842222	6179177		Lactobacillus_phage(33.33%)	3	NA	NA
AUW01335.1|5839325_5840162_-	transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	41.2	3.9e-08
AUW01336.1|5840207_5841212_-	oligopeptide ABC transporter ATP-binding protein OppF	NA	G3M9Y6	Bacillus_virus	28.6	6.8e-15
AUW01337.1|5841208_5842222_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	30.7	1.7e-13
>prophage 404
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5850524	5860947	6179177		Erwinia_phage(20.0%)	10	NA	NA
AUW01343.1|5850524_5851142_-	thymidine kinase	NA	A0A191ZC13	Erwinia_phage	52.6	3.3e-52
AUW01344.1|5851697_5852105_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
AUW01345.1|5852239_5853142_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	47.6	1.5e-58
AUW01346.1|5853339_5854353_-	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	27.7	3.4e-06
AUW01347.1|5854433_5855342_-	patatin family protein	NA	NA	NA	NA	NA
AUW01348.1|5855454_5855913_+	hypothetical protein	NA	NA	NA	NA	NA
AUW01349.1|5855955_5856798_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	46.3	1.6e-12
AUW01350.1|5858027_5858705_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
AUW01351.1|5858704_5859415_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
AUW01352.1|5859411_5860947_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	3.7e-20
>prophage 405
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5877381	5878170	6179177		Bacillus_virus(100.0%)	1	NA	NA
AUW01359.1|5877381_5878170_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	1.0e-29
>prophage 406
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5883528	5889234	6179177		Mythimna_unipuncta_granulovirus(33.33%)	7	NA	NA
AUW01366.1|5883528_5883759_-	cation transport regulator	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	46.7	9.1e-08
AUW01367.1|5884024_5885125_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AUW01368.1|5885213_5886068_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.8	8.9e-48
AUW01369.1|5886107_5886920_-	hypothetical protein	NA	NA	NA	NA	NA
AUW01370.1|5886923_5887316_-	siroheme synthase	NA	NA	NA	NA	NA
AUW01371.1|5887312_5888152_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUW01372.1|5888151_5889234_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	40.0	1.1e-07
>prophage 407
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5892448	5895325	6179177		Tupanvirus(50.0%)	2	NA	NA
AUW01897.1|5892448_5893396_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	3.0e-44
AUW01376.1|5893645_5895325_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	1.1e-22
>prophage 408
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5899001	5900009	6179177	integrase	uncultured_Caudovirales_phage(100.0%)	1	5898981:5898995	5901253:5901267
5898981:5898995	attL	CCACAAAATCCACGC	NA	NA	NA	NA
AUW01381.1|5899001_5900009_+|integrase	integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	33.4	2.1e-48
AUW01381.1|5899001_5900009_+|integrase	integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	33.4	2.1e-48
5901253:5901267	attR	CCACAAAATCCACGC	NA	NA	NA	NA
>prophage 409
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5918592	5920065	6179177		Enterobacteria_phage(100.0%)	1	NA	NA
AUW01395.1|5918592_5920065_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.7	2.8e-25
>prophage 410
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5923086	5923545	6179177		Acinetobacter_phage(100.0%)	1	NA	NA
AUW01398.1|5923086_5923545_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	35.9	2.1e-19
>prophage 411
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5930361	5936558	6179177		Morganella_phage(25.0%)	6	NA	NA
AUW01402.1|5930361_5930889_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	57.5	2.5e-48
AUW01403.1|5930967_5931462_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
AUW01404.1|5931695_5933336_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	2.0e-133
AUW01405.1|5933651_5934545_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUW01406.1|5934604_5935291_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.1	3.0e-06
AUW01899.1|5935469_5936558_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	6.7e-24
>prophage 412
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5957941	5958553	6179177		Geobacillus_virus(100.0%)	1	NA	NA
AUW01424.1|5957941_5958553_-	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
>prophage 413
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5974043	5982128	6179177	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
AUW01440.1|5974043_5975729_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	4.2e-33
AUW01441.1|5975937_5976522_-	hypothetical protein	NA	NA	NA	NA	NA
AUW01442.1|5976565_5977261_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AUW01443.1|5977328_5979239_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.9	4.2e-90
AUW01444.1|5979371_5979716_+	RidA family protein	NA	NA	NA	NA	NA
AUW01902.1|5979886_5981026_-	alginate lyase	NA	NA	NA	NA	NA
AUW01445.1|5981033_5982128_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.8e-21
>prophage 414
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5989290	5990646	6179177		Pandoravirus(100.0%)	1	NA	NA
AUW01451.1|5989290_5990646_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	41.3	2.7e-43
>prophage 415
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5994490	5996050	6179177		Moraxella_phage(100.0%)	1	NA	NA
AUW01455.1|5994490_5996050_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.0	6.6e-41
>prophage 416
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6003486	6003696	6179177		Morganella_phage(100.0%)	1	NA	NA
AUW01463.1|6003486_6003696_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 417
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6007929	6011627	6179177	protease,transposase	Clostridium_botulinum_C_phage(50.0%)	3	NA	NA
AUW01471.1|6007929_6008364_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	6.8e-20
AUW01472.1|6008460_6009342_-|protease	protease HtpX	protease	NA	NA	NA	NA
AUW01473.1|6009578_6011627_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.4	2.6e-85
>prophage 418
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6019095	6019749	6179177		Escherichia_phage(100.0%)	1	NA	NA
AUW01479.1|6019095_6019749_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	52.1	1.7e-59
>prophage 419
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6028998	6029967	6179177		Pectobacterium_phage(50.0%)	2	NA	NA
AUW01488.1|6028998_6029229_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	1.3e-14
AUW01489.1|6029307_6029967_+	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	32.8	2.6e-15
>prophage 420
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6037408	6043082	6179177		Cyanophage(50.0%)	4	NA	NA
AUW01496.1|6037408_6038884_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.7e-78
AUW01497.1|6039245_6040115_+	transcriptional regulator HexR	NA	NA	NA	NA	NA
AUW01498.1|6040240_6041683_+	pyruvate kinase	NA	NA	NA	NA	NA
AUW01499.1|6041747_6043082_-	malate permease	NA	A0A140XAH4	Dickeya_phage	62.9	1.2e-22
>prophage 421
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6048104	6054445	6179177		Listeria_phage(25.0%)	7	NA	NA
AUW01504.1|6048104_6049427_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.2e-14
AUW01505.1|6049442_6050387_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUW01506.1|6050465_6051218_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.0	3.0e-15
AUW01507.1|6051217_6052003_+	zinc ABC transporter permease	NA	NA	NA	NA	NA
AUW01508.1|6052211_6053222_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.6	8.1e-08
AUW01509.1|6053230_6053842_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AUW01510.1|6053923_6054445_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
>prophage 422
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6058317	6065038	6179177	tRNA	Escherichia_coli_phage(33.33%)	8	NA	NA
AUW01515.1|6058317_6059136_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.1	2.6e-57
AUW01516.1|6059189_6059585_+	hypothetical protein	NA	NA	NA	NA	NA
AUW01517.1|6059624_6060368_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	29.1	1.5e-22
AUW01518.1|6060364_6061387_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AUW01519.1|6061420_6061630_+	hypothetical protein	NA	NA	NA	NA	NA
AUW01520.1|6061685_6062429_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AUW01521.1|6062505_6063075_-	VOC family protein	NA	NA	NA	NA	NA
AUW01522.1|6063304_6065038_+|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	34.2	4.1e-84
>prophage 423
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6072061	6073576	6179177		Brazilian_cedratvirus(100.0%)	1	NA	NA
AUW01530.1|6072061_6073576_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	27.6	1.5e-10
>prophage 424
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6090853	6091606	6179177		Bacillus_virus(100.0%)	1	NA	NA
AUW01548.1|6090853_6091606_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.4e-27
>prophage 425
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6098312	6113501	6179177		Burkholderia_phage(25.0%)	14	NA	NA
AUW01558.1|6098312_6099980_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	36.7	9.3e-17
AUW01559.1|6100087_6100267_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AUW01560.1|6100342_6101254_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AUW01561.1|6101437_6102349_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AUW01562.1|6102323_6102818_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.0	1.4e-32
AUW01563.1|6102798_6104232_-	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	53.5	4.6e-97
AUW01564.1|6104288_6104984_-	phosphohydrolase	NA	S4W232	Pandoravirus	26.5	2.3e-06
AUW01565.1|6105026_6105308_-	hypothetical protein	NA	NA	NA	NA	NA
AUW01566.1|6105935_6107006_+	porin	NA	Q1MVN1	Enterobacteria_phage	51.1	5.3e-90
AUW01567.1|6107658_6108048_+	GtrA family protein	NA	NA	NA	NA	NA
AUW01568.1|6108044_6109037_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	39.5	1.3e-50
AUW01569.1|6109033_6110491_+	glucosyl transferase GtrII family protein	NA	E5AGC8	Erwinia_phage	41.1	1.2e-100
AUW01570.1|6111115_6111913_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
AUW01571.1|6112250_6113501_+	DUF4102 domain-containing protein	NA	Q8W6M6	Sinorhizobium_phage	30.0	3.8e-47
>prophage 426
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6117774	6119283	6179177		Pithovirus(100.0%)	1	NA	NA
AUW01575.1|6117774_6119283_+	sugar ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	22.7	1.4e-08
>prophage 427
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6132362	6135542	6179177		Enterobacteria_phage(50.0%)	4	NA	NA
AUW01587.1|6132362_6133118_+	hypothetical protein	NA	U5N3V8	Enterobacteria_phage	33.9	2.4e-33
AUW01588.1|6133191_6133686_+	hypothetical protein	NA	NA	NA	NA	NA
AUW01910.1|6133930_6134683_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUW01589.1|6134768_6135542_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A0M4JSW6	Mollivirus	25.9	1.9e-09
>prophage 428
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6145355	6145931	6179177		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
AUW01601.1|6145355_6145931_+	peptidase C56	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	33.1	7.8e-24
>prophage 429
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6148958	6149876	6179177		Burkholderia_virus(100.0%)	1	NA	NA
AUW01605.1|6148958_6149876_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	30.9	3.9e-09
>prophage 430
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6153205	6153400	6179177		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUW01609.1|6153205_6153400_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	50.0	5.9e-08
>prophage 431
CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6173312	6174599	6179177		Enterobacteria_phage(100.0%)	1	NA	NA
AUW01628.1|6173312_6174599_-	hypothetical protein	NA	Q858S9	Enterobacteria_phage	27.2	6.4e-42
>prophage 1
CP026277	Klebsiella oxytoca strain KONIH5 plasmid pKPC-8bc0, complete sequence	56561	3895	54227	56561	transposase,integrase	Burkholderia_phage(20.0%)	50	851:889	51228:51266
851:889	attL	GCTTAGCGTGCTTTATTTTCCGTTTTCTGAGACGACCCC	NA	NA	NA	NA
AUW02208.1|3895_5329_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AUW02209.1|5362_6571_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AUW02210.1|6583_6796_-	resolvase	NA	NA	NA	NA	NA
AUW02211.1|6837_7602_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AUW02212.1|7744_8011_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AUW02213.1|8231_8714_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	6.6e-16
AUW02214.1|8860_9874_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUW02215.1|9812_10127_+|transposase	transposase	transposase	NA	NA	NA	NA
AUW02216.1|10266_10836_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
AUW02217.1|11187_11850_-	hypothetical protein	NA	NA	NA	NA	NA
AUW02218.1|12792_13512_-	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
AUW02219.1|14071_14413_+	ArdK family transcriptional regulator	NA	NA	NA	NA	NA
AUW02261.1|14427_15219_-	sprT domain-containing protein	NA	NA	NA	NA	NA
AUW02220.1|15369_16635_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	53.8	2.2e-119
AUW02221.1|16622_17063_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
AUW02222.1|17477_17903_+	hypothetical protein	NA	NA	NA	NA	NA
AUW02223.1|17960_18365_+	antirestriction protein ArdR	NA	NA	NA	NA	NA
AUW02224.1|18374_18614_+	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
AUW02225.1|19499_19796_+	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
AUW02226.1|19792_20152_+	hypothetical protein	NA	NA	NA	NA	NA
AUW02227.1|20220_20505_+	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
AUW02228.1|20713_21046_+	hypothetical protein	NA	NA	NA	NA	NA
AUW02229.1|22398_22908_+	antirestriction protein	NA	NA	NA	NA	NA
AUW02230.1|23634_23814_+	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
AUW02231.1|23868_24189_+	CcgAII protein	NA	NA	NA	NA	NA
AUW02262.1|24299_24533_-	hypothetical protein	NA	NA	NA	NA	NA
AUW02232.1|24825_25194_-	StbC	NA	NA	NA	NA	NA
AUW02233.1|25195_25912_-	StdB protein	NA	NA	NA	NA	NA
AUW02263.1|25920_26058_-	StbA	NA	NA	NA	NA	NA
AUW02234.1|26830_27247_+	traK protein	NA	NA	NA	NA	NA
AUW02235.1|27248_28778_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
AUW02236.1|28777_32014_+	conjugative relaxase	NA	U5J9B0	Bacillus_phage	27.3	2.4e-05
AUW02237.1|32013_32379_+	FipA	NA	NA	NA	NA	NA
AUW02238.1|32951_33656_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUW02239.1|34180_35062_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AUW02240.1|35311_36631_-|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AUW02241.1|40648_41182_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
AUW02242.1|41181_42177_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AUW02243.1|42218_43379_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
AUW02244.1|43378_44200_-	conjugal transfer protein TraO	NA	NA	NA	NA	NA
AUW02245.1|44273_44972_-	type IV secretion system protein VirB8	NA	NA	NA	NA	NA
AUW02246.1|44961_45108_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
AUW02247.1|45190_46231_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
AUW02248.1|46246_46474_-	entry exclusion protein	NA	NA	NA	NA	NA
AUW02249.1|46481_47195_-	type IV secretion system protein	NA	NA	NA	NA	NA
AUW02250.1|47212_49813_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
AUW02251.1|49812_50130_-	type IV secretion system protein VirB3	NA	NA	NA	NA	NA
AUW02252.1|50179_50473_-	conjugal transfer protein TraM	NA	NA	NA	NA	NA
AUW02264.1|50482_50764_-	transcriptional regulator	NA	NA	NA	NA	NA
AUW02253.1|51260_54227_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
51228:51266	attR	GGGGTCGTCTCAGAAAACGGAAAATAAAGCACGCTAAGC	NA	NA	NA	NA
