The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	607	44419	6190364	head,holin,capsid,terminase,portal,protease,transposase,tail	Escherichia_phage(23.91%)	53	NA	NA
AUW08834.1|607_1789_+	DUF4102 domain-containing protein	NA	A0A2R2Z2Y0	Escherichia_phage	84.5	4.5e-199
AUW08835.1|1877_2693_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08836.1|2746_2932_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	59.6	5.2e-14
AUW08837.1|4555_5635_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	73.0	9.5e-148
AUW08838.1|5631_6420_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	8.4e-61
AUW08839.1|6419_6719_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	45.7	5.5e-13
AUW08840.1|7141_8299_-	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	28.6	2.4e-35
AUW08841.1|8470_8953_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	41.5	1.7e-11
AUW08842.1|9055_9325_+	Cro/Cl family transcriptional regulator	NA	D0UIL8	Aggregatibacter_phage	49.3	2.9e-13
AUW08843.1|9353_9584_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08844.1|9584_10040_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.8	2.3e-66
AUW08845.1|10277_10490_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	1.7e-16
AUW08846.1|10446_11361_+	transcriptional regulator	NA	H2DE83	Erwinia_phage	59.6	3.1e-30
AUW08847.1|11357_12167_+	DNA methylase	NA	A0A1C9II58	Salmonella_phage	71.5	3.6e-115
AUW08848.1|12176_12566_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	73.6	3.6e-49
AUW08849.1|12580_13276_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	65.2	1.6e-76
AUW08850.1|13272_14253_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	68.4	2.2e-135
AUW08851.1|14266_14845_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	57.8	5.8e-51
AUW08852.1|14995_15235_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08853.1|15400_15796_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	93.9	3.2e-61
AUW08854.1|15782_16064_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.3e-37
AUW08855.1|16063_16693_+	endolysin	NA	G8C7W0	Escherichia_phage	89.5	3.4e-105
AUW08856.1|16700_16976_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	51.7	1.9e-15
AUW08857.1|16926_17124_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	85.2	1.5e-22
AUW08858.1|17194_17683_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08859.1|17769_18153_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	94.5	5.2e-64
AUW08860.1|18219_18465_+	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	61.7	4.2e-19
AUW08861.1|18563_18998_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08862.1|19120_19471_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.7	2.7e-51
AUW08863.1|19627_20125_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.7	2.2e-62
AUW08864.1|20124_21882_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	90.4	0.0e+00
AUW08865.1|21892_22078_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	61.7	6.2e-15
AUW08866.1|22248_23395_+	DDE domain-containing protein	NA	U5P429	Shigella_phage	93.3	3.5e-148
AUW08867.1|23358_24540_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	82.9	2.3e-187
AUW08868.1|24526_25180_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	86.9	7.9e-105
AUW08869.1|25194_26403_+|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	82.0	1.1e-187
AUW08870.1|26441_26645_+	hypothetical protein	NA	S5FNU1	Shigella_phage	47.0	1.4e-07
AUW08871.1|26641_26962_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	39.8	1.7e-15
AUW08872.1|26970_27309_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	6.4e-42
AUW08873.1|27305_27755_+	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	81.9	8.7e-63
AUW08874.1|27751_28099_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	60.2	2.3e-31
AUW08875.1|28155_28860_+|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	67.4	3.6e-79
AUW08876.1|28890_29295_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	55.7	7.2e-32
AUW08877.1|29297_29603_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	66.0	9.5e-29
AUW08878.1|29596_29794_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08879.1|29850_30831_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
AUW08880.1|33398_33674_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08881.1|33786_34767_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
AUW08882.1|36271_36745_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.5	2.7e-54
AUW08883.1|36731_37217_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	66.9	1.8e-53
AUW08884.1|37226_37607_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.6e-57
AUW08885.1|37603_40681_+	kinase	NA	A0A286S259	Klebsiella_phage	67.8	0.0e+00
AUW08886.1|40756_44419_+	hypothetical protein	NA	A0A286S1R8	Klebsiella_phage	90.4	0.0e+00
>prophage 2
CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	138769	218073	6190364	head,holin,capsid,terminase,portal,protease,transposase,tail	Enterobacteria_phage(13.95%)	69	NA	NA
AUW08976.1|138769_139750_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	56.7	1.8e-73
AUW08977.1|139798_141247_-	catalase	NA	A0A2K9L0T1	Tupanvirus	46.7	6.9e-101
AUW08978.1|141516_142059_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08979.1|142155_143352_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
AUW08980.1|143556_144339_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUW08981.1|144352_145558_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.8e-25
AUW08982.1|145610_146900_+	MFS transporter	NA	NA	NA	NA	NA
AUW08983.1|146914_147718_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
AUW08984.1|147740_148919_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
AUW08985.1|148915_150175_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
AUW08986.1|150164_151787_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
AUW08987.1|153414_154485_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	42.9	3.9e-08
AUW08988.1|154556_154811_-	2Fe-2S ferredoxin	NA	G9IAA2	Pseudomonas_phage	64.0	8.2e-26
AUW08989.1|154810_155941_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	7.3e-175
AUW08990.1|156044_158330_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.8	1.3e-284
AUW08991.1|158674_159403_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
AUW08992.1|159588_162222_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.7	6.2e-92
AUW08993.1|162352_165199_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.3	3.4e-43
AUW08994.1|165243_165894_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
AUW08995.1|165910_168571_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
AUW08996.1|169342_170461_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.0e-116
AUW08997.1|170563_171616_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AUW08998.1|171688_172753_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	L7Y5F8	Megavirus	47.2	1.4e-18
AUW08999.1|172752_173403_+	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
AUW09000.1|173479_175123_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.3	2.4e-09
AUW09001.1|175291_176728_+	magnesium transporter	NA	NA	NA	NA	NA
AUW09002.1|176690_177938_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	44.3	1.2e-66
AUW09003.1|178217_179852_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AUW09004.1|179896_180388_-	ecotin	NA	NA	NA	NA	NA
AUW09005.1|180659_181766_-	AI-2E family transporter	NA	NA	NA	NA	NA
AUW09006.1|182353_183454_+	hsdR	NA	NA	NA	NA	NA
AUW09007.1|183569_184748_-	recombinase	NA	A0A2H4J1K3	uncultured_Caudovirales_phage	30.8	3.6e-31
AUW09008.1|184750_184960_-	hypothetical protein	NA	NA	NA	NA	NA
AUW09009.1|185172_186319_+	DDE domain-containing protein	NA	U5P429	Shigella_phage	93.3	3.5e-148
AUW09010.1|186558_186750_+	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	85.7	1.7e-23
AUW09011.1|186899_187949_+	DNA adenine methylase	NA	A5LH81	Enterobacteria_phage	79.0	1.5e-169
AUW09012.1|188768_190058_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09013.1|190172_190364_-	hypothetical protein	NA	NA	NA	NA	NA
AUW09014.1|190281_190707_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	84.4	1.1e-59
AUW09015.1|191337_191748_-	hypothetical protein	NA	NA	NA	NA	NA
AUW09016.1|191990_192380_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	80.3	2.4e-48
AUW09017.1|192369_192648_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	76.1	4.0e-34
AUW09018.1|192647_193277_+	endolysin	NA	F1C591	Cronobacter_phage	75.8	3.8e-88
AUW09019.1|193279_193555_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	65.9	6.6e-21
AUW09020.1|193794_194103_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09021.1|194235_194472_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09022.1|194481_194823_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	76.6	9.3e-49
AUW09023.1|195004_195469_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	2.8e-48
AUW09024.1|195422_197159_+|terminase	phage terminase small subunit P27 family	terminase	M4QNU0	Tetraselmis_viridis_virus	44.6	2.9e-138
AUW09025.1|197165_198485_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	59.1	4.4e-139
AUW09026.1|198460_199168_+|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.0	6.4e-68
AUW09027.1|199177_200398_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.5	7.5e-141
AUW09028.1|200443_200698_+	hypothetical protein	NA	NA	NA	NA	NA
AUW14303.1|200703_201036_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	31.6	8.8e-12
AUW09029.1|201048_201387_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	66.1	2.8e-37
AUW09030.1|201383_201833_+	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	81.2	9.7e-62
AUW09031.1|201829_202177_+	hypothetical protein	NA	K7PKL6	Enterobacterial_phage	61.1	1.8e-31
AUW09032.1|202233_202944_+|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	68.6	3.7e-84
AUW09033.1|202974_203379_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	56.5	2.5e-32
AUW09034.1|203381_203687_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.0	6.2e-28
AUW09035.1|203878_204394_+	hypothetical protein	NA	A0A1V0E5P7	Salmonella_phage	70.1	1.4e-61
AUW09036.1|204586_205141_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09037.1|205198_206392_-|transposase	IS4/IS5 family transposase	transposase	S5FM71	Shigella_phage	63.7	1.5e-141
AUW09038.1|206515_209908_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	55.0	3.8e-283
AUW09039.1|209929_210403_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	61.4	1.2e-54
AUW09040.1|210389_210866_+	ArsR family transcriptional regulator	NA	A0A286S2B1	Klebsiella_phage	67.1	6.7e-53
AUW09041.1|210878_211259_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	82.5	2.0e-60
AUW09042.1|211255_214333_+	kinase	NA	A0A286S259	Klebsiella_phage	61.2	0.0e+00
AUW09043.1|214410_218073_+	hypothetical protein	NA	A0A286S1R8	Klebsiella_phage	90.0	0.0e+00
>prophage 3
CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	224220	233198	6190364		Pseudomonas_phage(66.67%)	7	NA	NA
AUW09049.1|224220_225705_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AUW09050.1|226129_227614_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AUW09051.1|227787_228039_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09052.1|228038_229523_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AUW09053.1|229947_231432_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
AUW14304.1|231511_231931_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	55.9	4.7e-34
AUW09054.1|231932_233198_+	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.9	1.6e-207
>prophage 4
CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	378640	387034	6190364		Planktothrix_phage(33.33%)	8	NA	NA
AUW14315.1|378640_379504_+	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.0	3.0e-11
AUW09179.1|379514_380288_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	7.8e-27
AUW09180.1|380704_381505_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
AUW09181.1|381491_381962_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09182.1|381962_382856_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.4	2.0e-13
AUW09183.1|383100_384462_-	U32 family peptidase	NA	Q6DW11	Phage_TP	92.0	1.6e-200
AUW09184.1|384779_385502_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	2.4e-30
AUW09185.1|385498_387034_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	27.6	2.8e-28
>prophage 5
CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	447887	457524	6190364	transposase	Enterobacteria_phage(25.0%)	8	NA	NA
AUW09228.1|447887_449294_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.9	4.3e-39
AUW09229.1|449506_450571_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.2e-104
AUW09230.1|450584_451454_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.7	8.3e-110
AUW09231.1|451485_452376_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.1	2.4e-27
AUW09232.1|452391_452946_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.7	7.3e-51
AUW09233.1|453119_454286_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.0	7.0e-112
AUW09234.1|455187_456156_+|transposase	IS5-like element IS903 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.5	2.6e-181
AUW09235.1|456519_457524_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	30.1	3.6e-32
>prophage 6
CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	598922	634476	6190364	holin,tail,integrase	uncultured_Caudovirales_phage(32.35%)	46	590263:590276	600391:600404
590263:590276	attL	TGCTTAATCAGGTT	NA	NA	NA	NA
AUW09363.1|598922_599939_-|integrase	integrase	integrase	H9C152	Pectobacterium_phage	64.8	2.5e-126
AUW09364.1|599922_600168_-	hypothetical protein	NA	H9C153	Pectobacterium_phage	35.2	1.2e-05
AUW09365.1|600124_600328_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	61.1	3.9e-10
AUW09366.1|600377_600563_-	hypothetical protein	NA	NA	NA	NA	NA
600391:600404	attR	TGCTTAATCAGGTT	NA	NA	NA	NA
AUW09367.1|600564_601125_-	hypothetical protein	NA	H9C156	Pectobacterium_phage	58.4	2.6e-48
AUW09368.1|601124_603335_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.1	4.1e-97
AUW09369.1|603367_603652_-	hypothetical protein	NA	NA	NA	NA	NA
AUW09370.1|603680_603926_-	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	55.0	2.8e-15
AUW09371.1|603933_604257_-	hypothetical protein	NA	NA	NA	NA	NA
AUW09372.1|604890_605346_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	54.3	1.2e-35
AUW09373.1|605454_605688_+	XRE family transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	44.4	2.9e-09
AUW09374.1|605750_606197_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.4	1.0e-26
AUW09375.1|606280_606439_+	adenylate cyclase	NA	NA	NA	NA	NA
AUW14327.1|606456_607425_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.3	1.6e-37
AUW14328.1|607433_608828_+	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	46.9	1.4e-103
AUW09376.1|608866_609535_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09377.1|609538_609772_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09378.1|609935_610526_+	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	84.7	5.7e-94
AUW09379.1|610528_610759_+	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	38.7	2.9e-06
AUW09380.1|610755_611373_+	hypothetical protein	NA	A0A2H4JEM6	uncultured_Caudovirales_phage	24.9	2.3e-05
AUW09381.1|611385_611724_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	82.0	1.7e-47
AUW09382.1|611906_612098_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09383.1|612166_612763_+	DUF1367 domain-containing protein	NA	H9C173	Pectobacterium_phage	70.7	1.4e-79
AUW09384.1|612774_613077_+	hypothetical protein	NA	A0A2H4FS95	Methylophilaceae_phage	51.7	1.2e-23
AUW09385.1|613232_613529_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09386.1|613556_613997_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09387.1|614007_614229_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09388.1|614232_615858_+|tail	phage tail protein	tail	A0A2H4J3N6	uncultured_Caudovirales_phage	59.3	3.4e-173
AUW09389.1|615854_616088_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09390.1|616074_616923_+	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	42.5	1.2e-44
AUW09391.1|616956_617421_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	70.0	2.5e-60
AUW09392.1|617456_617864_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	68.3	5.5e-40
AUW09393.1|618081_618987_+	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	39.6	1.3e-44
AUW09394.1|619046_619610_+	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	49.7	3.4e-48
AUW09395.1|619609_621601_+	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	48.3	9.5e-186
AUW09396.1|621600_622053_+	N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	44.3	1.2e-22
AUW09397.1|622055_622544_+	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	49.0	3.5e-09
AUW09398.1|622549_625264_+	lytic transglycosylase	NA	G9L6D3	Escherichia_phage	58.6	2.0e-287
AUW09399.1|625263_628143_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	68.0	0.0e+00
AUW09400.1|628185_628512_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09401.1|628584_628926_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	48.2	1.5e-19
AUW09402.1|628922_630533_+	transcriptional regulator	NA	A0A2H4JCA3	uncultured_Caudovirales_phage	71.0	4.0e-227
AUW09403.1|630549_633030_+	hypothetical protein	NA	A0A0A8JA02	Klebsiella_phage	35.3	4.6e-97
AUW09404.1|633375_633600_+|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	70.1	2.0e-20
AUW09405.1|633583_634120_+	lysozyme	NA	K7PM52	Enterobacteria_phage	68.8	6.1e-71
AUW09406.1|634116_634476_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	43.1	1.3e-16
>prophage 7
CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	955887	1018764	6190364	plate,transposase,protease	Thermus_phage(20.0%)	47	NA	NA
AUW09685.1|955887_956868_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.9	2.1e-24
AUW09686.1|957265_958846_-	sulfurtransferase	NA	NA	NA	NA	NA
AUW09687.1|958847_959444_-	cysteine dioxygenase	NA	NA	NA	NA	NA
AUW09688.1|959548_959674_-	DNA metabolism protein	NA	NA	NA	NA	NA
AUW09689.1|959757_960651_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUW09690.1|960796_961882_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AUW14341.1|961935_963024_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUW09691.1|963035_964010_+	aliphatic sulfonates ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUW09692.1|964006_965035_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUW09693.1|965015_966011_+	sulfonate ABC transporter permease	NA	NA	NA	NA	NA
AUW09694.1|966004_966793_+	ABC transporter	NA	G3M9Y6	Bacillus_virus	33.8	1.1e-28
AUW14342.1|966938_969011_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUW09695.1|969517_970339_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	3.3e-15
AUW09696.1|970335_971361_+	heme ABC transporter	NA	NA	NA	NA	NA
AUW09697.1|971357_972410_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AUW09698.1|972426_973374_+	preprotein translocase YidC	NA	NA	NA	NA	NA
AUW09699.1|973370_974270_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AUW09700.1|974365_975133_+	basic amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUW09701.1|975198_975966_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUW14343.1|975949_976672_+	polar amino acid ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUW09702.1|976772_977978_-	MFS transporter	NA	NA	NA	NA	NA
AUW09703.1|978260_979412_+	amidohydrolase	NA	NA	NA	NA	NA
AUW09704.1|979702_981853_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
AUW09705.1|982088_983171_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
AUW09706.1|984031_984523_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AUW14344.1|984563_986096_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AUW09707.1|986116_987457_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AUW09708.1|987453_988143_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AUW09709.1|988139_989852_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09710.1|989856_990348_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUW09711.1|990636_991002_+|protease	Clp protease	protease	NA	NA	NA	NA
AUW09712.1|990998_993524_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.2	6.1e-20
AUW09713.1|993510_994743_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09714.1|994749_995112_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09715.1|995559_995790_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09716.1|998221_1000510_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09717.1|1000513_1001206_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09718.1|1001940_1002138_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09719.1|1002379_1003126_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09720.1|1003157_1004366_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09721.1|1004362_1007830_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
AUW09722.1|1009668_1010649_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
AUW14345.1|1010686_1010890_-	hypothetical protein	NA	NA	NA	NA	NA
AUW09723.1|1011064_1011499_+	hypothetical protein	NA	NA	NA	NA	NA
AUW09724.1|1014175_1014598_+	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
AUW09725.1|1015960_1017715_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AUW09726.1|1017678_1018764_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 8
CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	1740729	1749153	6190364	holin,tail	Cronobacter_phage(28.57%)	14	NA	NA
AUW10370.1|1740729_1741344_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	69.6	1.2e-67
AUW10371.1|1741511_1742246_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	83.2	1.6e-125
AUW10372.1|1742247_1743000_-|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	76.3	5.7e-115
AUW10373.1|1742996_1743344_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	60.0	2.4e-36
AUW10374.1|1743366_1744476_-|tail	phage tail tape measure protein	tail	I6PCW3	Cronobacter_phage	48.5	5.9e-52
AUW10375.1|1744560_1744806_-	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	40.0	2.3e-09
AUW10376.1|1744868_1745180_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	62.1	1.5e-32
AUW10377.1|1745252_1745915_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	65.0	7.0e-77
AUW10378.1|1746034_1746454_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	51.5	9.4e-35
AUW10379.1|1746509_1747052_-	hypothetical protein	NA	A0A0U2I1S0	Escherichia_phage	66.7	5.2e-70
AUW10380.1|1747059_1747332_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	55.4	2.2e-16
AUW10381.1|1747321_1747714_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	66.2	1.3e-38
AUW10382.1|1747790_1748153_-	antitermination protein	NA	C6ZR44	Salmonella_phage	57.5	7.1e-31
AUW14376.1|1748616_1749153_-	phage repressor protein	NA	K7PKK1	Enterobacteria_phage	49.7	5.2e-30
>prophage 9
CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	1753802	1798153	6190364	plate,tRNA,transposase,protease	Escherichia_phage(27.27%)	45	NA	NA
AUW10384.1|1753802_1754783_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
AUW10385.1|1754882_1755989_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	57.4	4.9e-107
AUW10386.1|1756142_1756355_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
AUW10387.1|1756437_1756872_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.2e-30
AUW10388.1|1757060_1757351_+	lipoprotein bor	NA	C6ZCX3	Enterobacteria_phage	66.0	9.7e-31
AUW14379.1|1757749_1758688_-|protease	outer membrane protease PgtE	protease	NA	NA	NA	NA
AUW10389.1|1759025_1759298_-	hypothetical protein	NA	NA	NA	NA	NA
AUW10390.1|1759501_1760437_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.4	5.4e-139
AUW10391.1|1760481_1761855_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	6.8e-50
AUW10392.1|1762338_1763322_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AUW10393.1|1763664_1764285_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AUW10394.1|1764901_1765645_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.2	8.6e-15
AUW14380.1|1765661_1766729_+	oxidoreductase	NA	NA	NA	NA	NA
AUW10395.1|1766801_1768067_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	66.4	3.5e-157
AUW10396.1|1768066_1768489_-	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	51.2	2.6e-32
AUW10397.1|1768776_1768971_+	hypothetical protein	NA	NA	NA	NA	NA
AUW10398.1|1769127_1769319_+	hypothetical protein	NA	NA	NA	NA	NA
AUW10399.1|1769643_1770612_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
AUW10400.1|1770655_1770877_+	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
AUW10401.1|1770931_1771495_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
AUW10402.1|1771691_1772273_-	hypothetical protein	NA	NA	NA	NA	NA
AUW10403.1|1772398_1773028_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AUW10404.1|1773389_1773578_-	cold-shock protein	NA	NA	NA	NA	NA
AUW10405.1|1774293_1775274_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUW10406.1|1775432_1776317_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUW10407.1|1776430_1777315_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUW10408.1|1777486_1778623_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUW10409.1|1778832_1779954_+	MFS transporter	NA	NA	NA	NA	NA
AUW14381.1|1780051_1780396_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
AUW10410.1|1780497_1781226_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.4	2.1e-45
AUW10411.1|1781468_1781903_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AUW10412.1|1781899_1782619_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUW10413.1|1782615_1783875_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUW10414.1|1783876_1784599_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
AUW10415.1|1784595_1785819_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUW10416.1|1785815_1786349_+	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
AUW10417.1|1786363_1787323_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AUW10418.1|1787386_1788769_-	carbohydrate porin	NA	NA	NA	NA	NA
AUW10419.1|1789660_1791115_+	MFS transporter	NA	NA	NA	NA	NA
AUW10420.1|1791169_1792849_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
AUW10421.1|1793011_1794346_-	hypothetical protein	NA	NA	NA	NA	NA
AUW10422.1|1794369_1794825_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AUW10423.1|1794826_1795366_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AUW10424.1|1795343_1796429_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AUW10425.1|1796392_1798153_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 10
CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	1981079	2039272	6190364	integrase,capsid,plate,terminase,portal,tRNA,tail	Enterobacteria_phage(51.43%)	62	1980967:1980984	2018021:2018038
1980967:1980984	attL	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AUW10585.1|1981079_1981331_-	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
AUW10586.1|1981374_1982514_-	hypothetical protein	NA	B9A7A9	Serratia_phage	70.7	3.0e-144
AUW10587.1|1982669_1983842_+|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	70.2	3.2e-157
AUW10588.1|1983841_1984357_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.8	5.7e-58
AUW10589.1|1984402_1984720_+|tail	phage tail protein	tail	B9A7B2	Serratia_phage	54.8	1.0e-17
AUW14392.1|1984719_1984878_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
AUW10590.1|1984864_1987840_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.6	2.3e-220
AUW10591.1|1987855_1988347_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	3.3e-55
AUW10592.1|1988560_1990402_-	ribonuclease H	NA	NA	NA	NA	NA
AUW10593.1|1991113_1992211_-|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	45.6	4.8e-06
AUW10594.1|1992195_1992411_-	hypothetical protein	NA	NA	NA	NA	NA
AUW10595.1|1992407_1995437_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	3.7e-24
AUW10596.1|1995426_1996350_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.9	3.4e-53
AUW10597.1|1996351_1996702_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	55.7	6.0e-27
AUW10598.1|1996698_1997286_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.0	1.4e-60
AUW10599.1|1997282_1997918_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.0	1.1e-55
AUW10600.1|1997914_1998382_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	3.1e-47
AUW14393.1|1998563_1998893_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AUW10601.1|1998904_1999450_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	42.5	8.2e-31
AUW10602.1|1999446_1999731_-|tail	phage tail protein	tail	NA	NA	NA	NA
AUW10603.1|1999721_1999922_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
AUW10604.1|1999921_2000437_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	50.0	2.2e-41
AUW10605.1|2000541_2001408_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.1	7.6e-71
AUW10606.1|2001456_2002491_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	49.7	1.1e-95
AUW10607.1|2002500_2003340_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	67.4	3.0e-96
AUW10608.1|2003496_2005224_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	68.3	3.1e-233
AUW10609.1|2005217_2006279_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.7	1.3e-141
AUW10610.1|2006623_2008495_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AUW10611.1|2008491_2009925_+	hypothetical protein	NA	NA	NA	NA	NA
AUW10612.1|2012616_2013633_-	hypothetical protein	NA	B7SYG0	Stenotrophomonas_phage	43.7	1.5e-65
AUW14394.1|2013670_2013898_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	39.7	1.9e-05
AUW10613.1|2013906_2014473_-	ribonuclease	NA	D4HTX2	Vibrio_phage	31.0	2.3e-12
AUW10614.1|2014469_2014694_-	hypothetical protein	NA	NA	NA	NA	NA
AUW10615.1|2014761_2015034_-	hypothetical protein	NA	NA	NA	NA	NA
AUW10616.1|2015049_2015427_-	hypothetical protein	NA	NA	NA	NA	NA
AUW10617.1|2015442_2015661_-	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	47.3	1.6e-06
AUW10618.1|2015791_2016118_-	hypothetical protein	NA	NA	NA	NA	NA
AUW10619.1|2016114_2016384_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	88.8	3.9e-42
AUW10620.1|2016506_2016806_+	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	71.7	3.5e-36
AUW10621.1|2016921_2017935_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	79.5	7.6e-155
AUW10622.1|2018167_2019181_+	diguanylate cyclase	NA	NA	NA	NA	NA
2018021:2018038	attR	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AUW10623.1|2019238_2019340_+	hypothetical protein	NA	NA	NA	NA	NA
AUW14395.1|2019339_2019414_+	hypothetical protein	NA	NA	NA	NA	NA
AUW10624.1|2019554_2019680_+	hypothetical protein	NA	NA	NA	NA	NA
AUW10625.1|2019728_2019992_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AUW10626.1|2020121_2020760_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
AUW10627.1|2020850_2021765_-	lipid A biosynthesis palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	51.2	4.5e-74
AUW10628.1|2022308_2023097_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUW10629.1|2023356_2023878_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUW10630.1|2023867_2024827_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUW10631.1|2024924_2027261_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUW10632.1|2027319_2028222_+	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AUW10633.1|2028218_2029217_+	iron-dicitrate transporter permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.4	1.2e-11
AUW10634.1|2029213_2030167_+	iron-dicitrate transporter subunit FecD	NA	NA	NA	NA	NA
AUW10635.1|2030167_2030935_+	ferric citrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	26.7	6.8e-15
AUW10636.1|2030971_2032015_-	type II asparaginase	NA	NA	NA	NA	NA
AUW10637.1|2032294_2033485_+	HD domain-containing protein	NA	NA	NA	NA	NA
AUW10638.1|2033562_2035347_+	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	37.2	7.3e-20
AUW10639.1|2035492_2036743_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	4.4e-19
AUW10640.1|2036979_2037630_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AUW10641.1|2037650_2038127_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AUW10642.1|2038120_2039272_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 11
CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	3617249	3706908	6190364	integrase,capsid,terminase,plate,tRNA,portal,protease,transposase,tail	Enterobacteria_phage(32.5%)	88	3621032:3621072	3658068:3658108
AUW12044.1|3617249_3618236_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUW12045.1|3618285_3619659_-	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	23.3	4.5e-09
AUW12046.1|3619655_3620354_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
AUW12047.1|3620503_3621007_+	stress adaptor protein CpxP	NA	NA	NA	NA	NA
3621032:3621072	attL	CACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTT	NA	NA	NA	NA
AUW12048.1|3621191_3622172_-|integrase	integrase	integrase	U5N0A8	Enterobacteria_phage	83.0	1.4e-153
AUW12049.1|3622241_3622535_-	XRE family transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	74.2	1.3e-35
AUW12050.1|3622688_3622871_+	hypothetical protein	NA	NA	NA	NA	NA
AUW12051.1|3622858_3623065_-	hypothetical protein	NA	NA	NA	NA	NA
AUW12052.1|3623186_3623459_+	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	85.6	8.2e-40
AUW12053.1|3623485_3623704_+	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	48.1	3.6e-06
AUW12054.1|3623719_3623950_+	hypothetical protein	NA	A0A0M4S6M9	Salmonella_phage	68.6	1.5e-23
AUW12055.1|3623964_3624237_+	hypothetical protein	NA	NA	NA	NA	NA
AUW12056.1|3624306_3624534_+	hypothetical protein	NA	NA	NA	NA	NA
AUW12057.1|3624526_3625072_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	26.1	5.5e-11
AUW12058.1|3625080_3625308_+	hypothetical protein	NA	NA	NA	NA	NA
AUW12059.1|3625304_3625499_+	hypothetical protein	NA	NA	NA	NA	NA
AUW12060.1|3625491_3626445_+	adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	54.9	2.8e-82
AUW12061.1|3626444_3626717_+	hypothetical protein	NA	NA	NA	NA	NA
AUW12062.1|3627028_3628039_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	55.9	4.1e-100
AUW14464.1|3628272_3630519_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	43.4	9.6e-134
AUW12063.1|3631154_3631847_+	DNA methylase	NA	A0A0M4S5U3	Salmonella_phage	70.3	5.3e-91
AUW12064.1|3632019_3633168_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AUW12065.1|3633157_3633676_+	hypothetical protein	NA	NA	NA	NA	NA
AUW12066.1|3634099_3635152_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	1.1e-140
AUW12067.1|3635151_3636873_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	66.0	3.1e-225
AUW12068.1|3637030_3637864_+|capsid	phage capsid protein	capsid	B9A7B4	Serratia_phage	73.3	9.4e-111
AUW12069.1|3637888_3638938_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	54.8	2.3e-106
AUW14465.1|3638985_3639882_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	75.3	5.4e-88
AUW14466.1|3639984_3640482_+|capsid	capsid assembly protein	capsid	B9A7B7	Serratia_phage	68.5	3.8e-59
AUW12070.1|3640481_3640682_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	5.7e-14
AUW12071.1|3640672_3640954_+	hypothetical protein	NA	B9A7B8	Serratia_phage	55.8	1.1e-18
AUW12072.1|3640950_3641502_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	41.3	1.3e-28
AUW12073.1|3641742_3642042_+	peptidase	NA	NA	NA	NA	NA
AUW12074.1|3642038_3642500_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	47.1	2.2e-32
AUW12075.1|3642496_3643138_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	46.8	9.9e-44
AUW12076.1|3643137_3643722_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.6	2.8e-61
AUW12077.1|3643718_3644087_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	58.3	1.8e-29
AUW12078.1|3644073_3644973_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	61.9	4.0e-91
AUW12079.1|3644965_3645568_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	47.7	3.0e-42
AUW12080.1|3645906_3649227_+	hypothetical protein	NA	A0A286S1R8	Klebsiella_phage	77.3	0.0e+00
AUW12081.1|3649281_3650310_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	45.6	1.1e-25
AUW12082.1|3650408_3650897_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	60.9	4.4e-52
AUW12083.1|3650911_3653671_-|tail	phage tail tape measure protein	tail	B9A7B3	Serratia_phage	70.6	1.1e-208
AUW12084.1|3653660_3653837_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	71.4	3.0e-11
AUW12085.1|3653833_3654133_-|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	72.6	3.4e-31
AUW12086.1|3654187_3654703_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	64.7	2.2e-57
AUW12087.1|3654702_3655884_-|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.8	2.7e-156
AUW12088.1|3656036_3657191_+	hypothetical protein	NA	B9A7A9	Serratia_phage	80.7	2.5e-178
AUW12089.1|3657235_3657484_+	hypothetical protein	NA	NA	NA	NA	NA
AUW14467.1|3657583_3657967_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	57.5	6.8e-40
AUW12090.1|3658191_3659088_+	cation-efflux pump FieF	NA	NA	NA	NA	NA
3658068:3658108	attR	CACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTT	NA	NA	NA	NA
AUW12091.1|3659290_3660253_+	6-phosphofructokinase	NA	NA	NA	NA	NA
AUW12092.1|3660312_3660798_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AUW12093.1|3660890_3661817_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AUW12094.1|3662007_3663342_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	30.3	1.1e-44
AUW12095.1|3663351_3663882_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AUW12096.1|3663972_3664941_-	cell division protein FtsN	NA	NA	NA	NA	NA
AUW12097.1|3665032_3666061_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
AUW12098.1|3666211_3668407_-	primosomal protein N'	NA	NA	NA	NA	NA
AUW12099.1|3668648_3668864_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
AUW12100.1|3668961_3669279_-	met repressor	NA	NA	NA	NA	NA
AUW12101.1|3669545_3670706_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AUW12102.1|3670708_3673141_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
AUW12103.1|3673180_3673552_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUW12104.1|3673642_3674548_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUW12105.1|3674714_3675602_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AUW12106.1|3675724_3676474_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	34.1	6.0e-24
AUW12107.1|3676602_3677706_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
AUW12108.1|3677762_3678425_-	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	3.5e-28
AUW12109.1|3678630_3679494_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUW12110.1|3679645_3680293_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AUW12111.1|3680389_3683041_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AUW12112.1|3683299_3684451_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
AUW12113.1|3684635_3685640_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AUW12114.1|3685646_3686423_+	acetylglutamate kinase	NA	NA	NA	NA	NA
AUW12115.1|3686500_3687874_+	argininosuccinate lyase	NA	NA	NA	NA	NA
AUW12116.1|3687938_3688142_+	hypothetical protein	NA	NA	NA	NA	NA
AUW12117.1|3688141_3689059_+	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
AUW12118.1|3689041_3690442_-	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AUW12119.1|3690638_3691274_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
AUW12120.1|3691289_3691649_+	hypothetical protein	NA	NA	NA	NA	NA
AUW12121.1|3691695_3692796_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
AUW12122.1|3693326_3694730_+|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
AUW12123.1|3694758_3695391_-	hypothetical protein	NA	NA	NA	NA	NA
AUW12124.1|3697256_3698111_+	glutamate racemase	NA	NA	NA	NA	NA
AUW12125.1|3704085_3704907_-	HTH-type transcriptional regulator HdfR	NA	NA	NA	NA	NA
AUW12126.1|3705025_3705364_+	DUF413 domain-containing protein	NA	NA	NA	NA	NA
AUW12127.1|3705387_3706908_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
>prophage 12
CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	4976174	5023072	6190364	coat,head,integrase,lysis,terminase,tRNA,tail	Enterobacteria_phage(23.08%)	66	4979308:4979345	5027940:5027977
AUW13211.1|4976174_4977560_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.1	1.0e-45
AUW13212.1|4977854_4978067_-	ribosome-associated protein	NA	NA	NA	NA	NA
AUW13213.1|4978068_4978935_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	6.5e-30
4979308:4979345	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAACCCTGTAGGG	NA	NA	NA	NA
AUW13214.1|4979367_4980531_-|integrase	integrase	integrase	G8C7S0	Escherichia_phage	86.0	7.2e-202
AUW13215.1|4980407_4980743_-	excisionase	NA	NA	NA	NA	NA
AUW13216.1|4980744_4980963_-	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AUW13217.1|4980959_4981169_-	hypothetical protein	NA	NA	NA	NA	NA
AUW13218.1|4981165_4981822_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	88.9	3.8e-115
AUW13219.1|4981818_4981995_-	DUF1317 domain-containing protein	NA	M1FJ61	Enterobacteria_phage	50.0	7.7e-07
AUW13220.1|4982006_4982711_-	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	39.6	3.0e-25
AUW13221.1|4982722_4983391_-	ATP-binding protein	NA	G9L667	Escherichia_phage	44.3	1.1e-48
AUW13222.1|4983392_4984052_-	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	33.3	6.0e-20
AUW13223.1|4984182_4984578_-	hypothetical protein	NA	NA	NA	NA	NA
AUW13224.1|4984657_4984864_-	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	92.6	5.3e-31
AUW14529.1|4985104_4985380_-	hypothetical protein	NA	A0A2D1GLY1	Escherichia_phage	66.3	1.2e-27
AUW13225.1|4986023_4986683_-	LexA family transcriptional repressor	NA	K7P7K3	Enterobacteria_phage	61.5	1.9e-69
AUW13226.1|4986791_4987010_+	XRE family transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	50.7	1.4e-13
AUW13227.1|4987050_4987272_+	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AUW13228.1|4987497_4988397_+	DNA replication protein	NA	F1C5C3	Cronobacter_phage	54.9	1.6e-87
AUW13229.1|4988386_4989817_+	helicase DnaB	NA	Q9MCT4	Escherichia_phage	66.9	3.8e-184
AUW13230.1|4989816_4990122_+	hypothetical protein	NA	NA	NA	NA	NA
AUW13231.1|4990118_4990604_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	35.3	1.8e-13
AUW13232.1|4990600_4990807_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	97.1	8.1e-32
AUW13233.1|4990955_4991288_+	hypothetical protein	NA	NA	NA	NA	NA
AUW13234.1|4991287_4991500_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	6.2e-11
AUW13235.1|4991842_4992172_+	hypothetical protein	NA	R9TQX3	Aeromonas_phage	88.9	8.2e-10
AUW13236.1|4992302_4992521_+	hypothetical protein	NA	NA	NA	NA	NA
AUW13237.1|4992548_4992848_+	hypothetical protein	NA	A0A1I9LJU9	Stx_converting_phage	54.1	1.2e-15
AUW13238.1|4992840_4993071_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	1.7e-09
AUW13239.1|4993329_4993779_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	51.7	2.2e-37
AUW13240.1|4994567_4994798_+	hypothetical protein	NA	NA	NA	NA	NA
AUW13241.1|4994931_4995741_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	75.8	5.3e-119
AUW14530.1|4996729_4997587_+	site-specific DNA-methyltransferase	NA	H2EQJ0	Salmonella_phage	69.5	3.3e-50
AUW13242.1|4997639_4997921_+	hypothetical protein	NA	NA	NA	NA	NA
AUW13243.1|4998078_4998303_+|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	87.8	6.3e-30
AUW13244.1|4998280_4998775_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	89.0	2.4e-82
AUW13245.1|4998863_4999331_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	74.2	7.5e-57
AUW13246.1|4999366_4999642_+	hypothetical protein	NA	K7P6G5	Enterobacteria_phage	61.5	5.4e-23
AUW13247.1|4999963_5000611_+	hypothetical protein	NA	I6S676	Salmonella_phage	79.6	1.5e-100
AUW13248.1|5000641_5001130_+	hypothetical protein	NA	I6S1P9	Salmonella_phage	75.2	9.2e-50
AUW13249.1|5001126_5002686_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	88.0	3.8e-291
AUW13250.1|5002698_5004168_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.9	4.5e-148
AUW13251.1|5004094_5005102_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.1	4.9e-114
AUW13252.1|5005223_5006585_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	52.2	3.1e-127
AUW13253.1|5006584_5007046_+	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
AUW13254.1|5007042_5008098_+|coat	phage coat protein	coat	B1GS73	Salmonella_phage	53.1	3.8e-101
AUW13255.1|5008130_5008394_+	hypothetical protein	NA	NA	NA	NA	NA
AUW13256.1|5008396_5008777_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	9.1e-29
AUW13257.1|5008776_5008950_+	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	53.6	5.4e-13
AUW13258.1|5008949_5009312_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	50.0	1.9e-20
AUW13259.1|5009314_5009740_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
AUW13260.1|5009736_5010129_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.9	3.3e-34
AUW13261.1|5010197_5010950_+	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
AUW13262.1|5011002_5011680_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	58.4	9.7e-74
AUW13263.1|5011855_5012611_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
AUW13264.1|5012613_5012868_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
AUW14531.1|5012942_5013281_+	hypothetical protein	NA	NA	NA	NA	NA
AUW14532.1|5013288_5013609_+	hypothetical protein	NA	NA	NA	NA	NA
AUW13265.1|5013660_5014095_-	hypothetical protein	NA	NA	NA	NA	NA
AUW13266.1|5014099_5014348_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	72.8	8.0e-26
AUW13267.1|5014435_5014597_+	Arc family DNA-binding protein	NA	I6S1K8	Salmonella_phage	63.3	1.6e-11
AUW13268.1|5015705_5019230_+	hypothetical protein	NA	R9TMK1	Aeromonas_phage	67.1	2.8e-297
AUW14533.1|5019329_5019749_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.1	4.1e-30
AUW13269.1|5019748_5020219_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	39.7	2.4e-26
AUW13270.1|5020215_5020611_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.8	6.1e-36
AUW13271.1|5020597_5023072_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	45.6	3.8e-200
5027940:5027977	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAACCCTGTAGGG	NA	NA	NA	NA
>prophage 13
CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	6057396	6069938	6190364	tRNA,transposase	Escherichia_coli_O157_typing_phage(37.5%)	10	NA	NA
AUW14187.1|6057396_6059874_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	84.2	0.0e+00
AUW14188.1|6059877_6061686_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	71.1	6.8e-239
AUW14583.1|6061682_6063998_-	lytic transglycosylase domain-containing protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	35.7	1.6e-107
AUW14189.1|6064231_6064729_-	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	42.9	3.4e-07
AUW14190.1|6064820_6065120_+	hypothetical protein	NA	A0A2H4JEE3	uncultured_Caudovirales_phage	40.3	7.4e-10
AUW14191.1|6065187_6065697_-|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	41.8	6.1e-20
AUW14584.1|6065836_6066091_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	46.5	2.4e-09
AUW14192.1|6066400_6067663_-	O-antigen ligase domain-containing protein	NA	NA	NA	NA	NA
AUW14193.1|6067669_6068701_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
AUW14194.1|6068921_6069938_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
>prophage 1
CP026281	Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence	198115	0	5701	198115		unidentified_phage(100.0%)	7	NA	NA
AUW08048.1|1153_1720_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08049.1|1724_2012_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08050.1|1996_3097_+	plasmid replication protein	NA	NA	NA	NA	NA
AUW08269.1|3442_3724_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08270.1|3744_3930_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08051.1|4133_4568_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08052.1|4585_5701_-	phosphohydrolase	NA	H7BVI4	unidentified_phage	29.1	6.4e-46
>prophage 2
CP026281	Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence	198115	9342	15197	198115		Wolbachia_phage(25.0%)	11	NA	NA
AUW08058.1|9342_10320_+	S49 family peptidase	NA	Q9JMP1	Wolbachia_phage	31.5	7.1e-17
AUW08059.1|10335_11196_+	protein-disulfide isomerase	NA	NA	NA	NA	NA
AUW08060.1|11229_11658_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08061.1|11714_12074_+	hypothetical protein	NA	A0A076G835	Escherichia_phage	49.4	5.6e-20
AUW08062.1|12073_12520_+	Fe3+-siderophore ABC transporter permease	NA	NA	NA	NA	NA
AUW08063.1|12516_13035_+	nitrite reductase	NA	NA	NA	NA	NA
AUW08064.1|13034_13265_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08065.1|13251_14109_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08066.1|14134_14323_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08067.1|14339_14867_+	nuclease	NA	O64020	Bacillus_phage	37.0	1.3e-09
AUW08068.1|14924_15197_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	59.6	4.2e-20
>prophage 3
CP026281	Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence	198115	18826	54246	198115	transposase	Pseudomonas_phage(14.29%)	51	NA	NA
AUW08077.1|18826_19288_+	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	60.5	1.5e-46
AUW08078.1|19290_19788_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08079.1|19891_20155_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08080.1|20349_21282_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08081.1|21355_22819_+	ATPase	NA	U5XGM6	Phormidium_phage	38.2	2.4e-45
AUW08082.1|22974_23304_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08083.1|23308_23701_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08084.1|23749_23944_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08085.1|23937_24936_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08086.1|24943_25780_-|transposase	IS5 family transposase ISEc61	transposase	NA	NA	NA	NA
AUW08087.1|26017_26332_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08088.1|26345_27140_+	APH(3')-II family aminoglycoside O-phosphotransferase	NA	Q75ZG1	Hepacivirus	74.3	6.4e-109
AUW08089.1|27166_27526_+	BLMT family bleomycin binding protein	NA	NA	NA	NA	NA
AUW08090.1|27456_27645_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08091.1|27688_28636_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
AUW08273.1|28718_29867_+	cephalosporin-hydrolyzing class C beta-lactamase FOX-5	NA	NA	NA	NA	NA
AUW08092.1|30191_31364_+	multidrug transporter MdtL	NA	NA	NA	NA	NA
AUW08093.1|31382_32345_+	HTH-type transcriptional regulator YidZ	NA	NA	NA	NA	NA
AUW08094.1|32659_32866_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08095.1|32956_33904_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
AUW08096.1|34625_34874_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
AUW08097.1|35000_35576_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	52.7	5.6e-46
AUW08098.1|35846_36869_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUW08099.1|37687_38524_+|transposase	IS5 family transposase ISEc61	transposase	NA	NA	NA	NA
AUW08100.1|38747_39095_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08101.1|39091_39520_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08102.1|39512_39794_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08103.1|39858_40077_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08104.1|40088_40658_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08105.1|40660_41206_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08106.1|41322_42261_+	chromosome partitioning protein ParB	NA	A0A2P9HXK7	Yersinia_phage	50.2	1.5e-69
AUW08107.1|42260_42458_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08108.1|42444_42696_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08109.1|42695_42938_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08110.1|42940_43303_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08111.1|43295_43508_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08112.1|43567_44323_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.0	5.8e-59
AUW08113.1|44337_45879_-|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	4.4e-130
AUW08114.1|46123_47158_+	site-specific DNA-methyltransferase	NA	H8ZMF1	Synechococcus_phage	20.9	1.0e-05
AUW08115.1|47171_47621_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08116.1|47602_47914_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08117.1|48087_48873_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
AUW08118.1|48876_50058_+	chromosome partitioning protein ParB	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
AUW08119.1|50106_50379_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08120.1|50431_51067_-	restriction endonuclease subunit M	NA	NA	NA	NA	NA
AUW08121.1|51620_51998_+	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	2.2e-22
AUW08122.1|51990_52272_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08123.1|52246_52921_+	thymidylate kinase	NA	NA	NA	NA	NA
AUW08274.1|52988_53420_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08124.1|53404_53737_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08125.1|53745_54246_+	hypothetical protein	NA	I3UMJ0	Colwellia_phage	43.3	1.7e-19
>prophage 4
CP026281	Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence	198115	57679	60766	198115		Caulobacter_phage(50.0%)	3	NA	NA
AUW08131.1|57679_57979_+	RNA-binding protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	2.1e-20
AUW08132.1|58070_58559_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08133.1|58573_60766_-	DNA topoisomerase 3	NA	A0A1X9I6W8	Streptococcus_phage	29.2	2.9e-42
>prophage 5
CP026281	Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence	198115	92917	97553	198115		Rhizobium_phage(25.0%)	5	NA	NA
AUW08163.1|92917_93886_+	CbbQ/NirQ/NorQ/GpvN family protein	NA	L7TKP0	Rhizobium_phage	32.6	2.8e-29
AUW08164.1|93896_94805_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08165.1|94865_95396_+	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	71.8	2.6e-42
AUW08166.1|95490_96480_+	phage recombination protein Bet	NA	B5AX97	Iodobacteriophage	39.6	1.1e-52
AUW08167.1|96542_97553_+	endonuclease	NA	E0YQ48	Mycobacterium_phage	28.7	5.6e-09
>prophage 6
CP026281	Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence	198115	106788	108414	198115		Staphylococcus_phage(100.0%)	1	NA	NA
AUW08182.1|106788_108414_+	DNA cytosine methyltransferase	NA	A0A0N9SK84	Staphylococcus_phage	25.8	1.2e-05
>prophage 7
CP026281	Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence	198115	114975	118576	198115		Bacillus_phage(50.0%)	3	NA	NA
AUW08192.1|114975_115827_+	NgrC	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
AUW08193.1|116284_116671_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08276.1|116848_118576_+	DNA primase	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
>prophage 8
CP026281	Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence	198115	123973	161158	198115	transposase,integrase	Escherichia_phage(26.09%)	38	136677:136736	155555:156416
AUW08198.1|123973_124978_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AUW08199.1|125056_128029_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AUW08200.1|128031_128589_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AUW08201.1|128626_128950_-|transposase	transposase	transposase	NA	NA	NA	NA
AUW08202.1|128894_129908_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUW08277.1|130113_130980_+	PSE family carbenicillin-hydrolyzing class A beta-lactamase CARB-2	NA	A0A077SL40	Escherichia_phage	44.1	4.8e-57
AUW08278.1|131097_131889_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AUW08203.1|131977_133327_-	group II intron reverse transcriptase/maturase	NA	H7BV81	unidentified_phage	28.1	5.2e-10
AUW08279.1|134127_135387_+	chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
AUW08204.1|135511_136144_+	type B-2 chloramphenicol O-acetyltransferase CatB11	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	43.0	7.1e-26
AUW08205.1|136122_136404_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08206.1|136333_136681_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AUW08207.1|136674_137514_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
136677:136736	attL	GGTGACGGTGTTCGGCATTCTGAATCTCACCGAGGACTCCTTCTTCGATGAGAGCCGGCG	NA	NA	NA	NA
AUW08208.1|137918_139460_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AUW08209.1|139792_140449_+	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
AUW08210.1|140648_141488_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUW08211.1|141892_143434_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AUW08212.1|143699_144200_+	hypothetical protein	NA	A0A1V0SB21	Catovirus	31.7	3.3e-10
AUW08213.1|144199_144769_+	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	A0A1V0SD48	Indivirus	27.2	3.5e-08
AUW08214.1|145151_145433_-|transposase	transposase	transposase	NA	NA	NA	NA
AUW08215.1|145371_146385_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUW08280.1|146530_147064_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
AUW08216.1|147146_147779_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
AUW08217.1|147935_148283_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AUW08218.1|148276_149116_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUW08219.1|149045_149225_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08220.1|149290_150055_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AUW08221.1|150231_150936_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUW08222.1|151385_152861_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
AUW08223.1|152916_153801_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AUW08224.1|153884_154589_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUW08225.1|154479_155439_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
AUW08226.1|155540_156392_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.1e-11
AUW08227.1|156321_156501_-	hypothetical protein	NA	NA	NA	NA	NA
155555:156416	attR	GGTGACGGTGTTCGGCATTCTGAATCTCACCGAGGACTCCTTCTTCGATGAGAGCCGGCGGCTAGACCCCGCCGGCGCTGTCACCGCGGCGATCGAAATGCTGCGAGTCGGATCAGACGTCGTGGATGTCGGACCGGCCGCCAGCCATCCGGACGCGAGGCCTGTATCGCCGGCCGATGAGATCAGACGTATTGCGCCGCTCTTAGACGCCCTGTCCGATCAGATGCACCGTGTTTCAATCGACAGCTTCCAACCGGAAACCCAGCGCTATGCGCTCAAGCGCGGCGTGGGCTACCTGAACGATATCCAAGGATTTCCTGACCCTGCGCTCTATCCCGATATTGCTGAGGCGGACTGCAGGCTGGTGGTTATGCACTCAGCGCAGCGGGATGGCATCGCCACCCGCACCGGTCACCTTCGACCCGAAGACGCGCTCGACGAGATTGTGCGGTTCTTCGAGGCGCGGGTTTCCGCCTTGCGACGGAGCGGGGTCGCTGCCGACCGGCTCATCCTCGATCCGGGGATGGGATTTTTCTTGAGCCCCGCACCGGAAACATCGCTGCACGTGCTGTCGAACCTTCAAAAGCTGAAGTCGGCGTTGGGGCTTCCGCTATTGGTCTCGGTGTCGCGGAAATCCTTCTTGGGCGCCACCGTTGGCCTTCCTGTAAAGGATCTGGGTCCAGCGAGCCTTGCGGCGGAACTTCACGCGATCGGCAATGGCGCTGACTACGTCCGCACCCACGCGCCTGGAGATCTGCGAAGCGCAATCACCTTCTCGGAAACCCTCGCGAAATTTCGCAGTCGCGACGCCAGAGACCGAGGGTTAGATCATGCCTAGCATTCACCTTCCGGCCGCCCGCTA	NA	NA	NA	NA
AUW08228.1|156519_157020_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUW08281.1|157195_157978_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
AUW08229.1|157967_159491_-|transposase	IS21 family transposase IS1326	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
AUW08230.1|159613_161158_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
>prophage 9
CP026281	Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence	198115	165142	182687	198115	transposase	uncultured_Caudovirales_phage(55.56%)	19	NA	NA
AUW08236.1|165142_166837_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AUW08237.1|166875_167301_-	mercury transport protein MerC	NA	NA	NA	NA	NA
AUW08238.1|167328_167604_-	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AUW08239.1|167619_167985_-	mercuric transport protein	NA	NA	NA	NA	NA
AUW08240.1|168056_168512_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUW08241.1|168848_169202_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
AUW08242.1|169249_169612_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AUW08243.1|169629_171381_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AUW08244.1|171429_172719_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.5e-171
AUW08245.1|172731_173157_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
AUW08282.1|173187_173592_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AUW08246.1|173600_174173_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	89.0	2.0e-83
AUW08247.1|175301_176792_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	82.2	8.6e-224
AUW08248.1|176826_177681_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	48.6	1.3e-67
AUW08249.1|177771_178104_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AUW08250.1|178221_178842_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	37.1	1.1e-26
AUW08251.1|179011_179272_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AUW08252.1|179271_179583_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUW08253.1|179606_182687_+|transposase	DDE transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
>prophage 10
CP026281	Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence	198115	186210	187722	198115		Pseudoalteromonas_phage(100.0%)	1	NA	NA
AUW08258.1|186210_187722_+	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
>prophage 11
CP026281	Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence	198115	195050	195323	198115		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUW08263.1|195050_195323_+	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
>prophage 1
CP026278	Klebsiella oxytoca strain KONIH2 plasmid pKOR-0e8e, complete sequence	48636	1424	20015	48636	lysis	Escherichia_phage(30.77%)	32	NA	NA
AUW07751.1|1424_1643_-	conjugal transfer protein TraR	NA	A0A0N7C211	Escherichia_phage	49.3	7.1e-10
AUW07752.1|1639_1849_-	hypothetical protein	NA	NA	NA	NA	NA
AUW07753.1|1845_2502_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	88.9	3.8e-115
AUW07754.1|2498_2675_-	DUF1317 domain-containing protein	NA	M1FJ61	Enterobacteria_phage	50.0	7.7e-07
AUW07755.1|2686_3391_-	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	39.6	3.0e-25
AUW07756.1|3402_4071_-	ATP-binding protein	NA	G9L667	Escherichia_phage	44.3	1.1e-48
AUW07757.1|4072_4732_-	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	33.3	6.0e-20
AUW07758.1|4862_5258_-	hypothetical protein	NA	NA	NA	NA	NA
AUW07759.1|5337_5544_-	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	92.6	5.3e-31
AUW07804.1|5784_6060_-	hypothetical protein	NA	A0A2D1GLY1	Escherichia_phage	66.3	1.2e-27
AUW07760.1|6703_7363_-	LexA family transcriptional repressor	NA	K7P7K3	Enterobacteria_phage	61.5	1.9e-69
AUW07761.1|7471_7690_+	XRE family transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	50.7	1.4e-13
AUW07762.1|7730_7952_+	transcriptional regulator	NA	A2SY75	Escherichia_phage	52.0	1.4e-05
AUW07763.1|8177_9077_+	DNA replication protein	NA	F1C5C3	Cronobacter_phage	54.9	1.6e-87
AUW07764.1|9066_10497_+	helicase DnaB	NA	Q9MCT4	Escherichia_phage	66.9	3.8e-184
AUW07765.1|10496_10802_+	hypothetical protein	NA	NA	NA	NA	NA
AUW07766.1|10798_11284_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	35.3	1.8e-13
AUW07767.1|11280_11487_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	97.1	8.1e-32
AUW07768.1|11483_11969_+	hypothetical protein	NA	NA	NA	NA	NA
AUW07769.1|11968_12181_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	6.2e-11
AUW07805.1|13032_13530_+	hypothetical protein	NA	A0A1I9LJU9	Stx_converting_phage	54.1	2.0e-15
AUW07770.1|13522_13753_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	1.7e-09
AUW07771.1|14011_14461_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	51.7	2.2e-37
AUW07772.1|14453_14624_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	71.4	5.7e-15
AUW07773.1|14616_15255_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	68.9	7.0e-74
AUW07774.1|15251_15482_+	hypothetical protein	NA	NA	NA	NA	NA
AUW07775.1|15615_16425_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	75.8	5.3e-119
AUW07806.1|17413_18271_+	site-specific DNA-methyltransferase	NA	H2EQJ0	Salmonella_phage	69.5	3.3e-50
AUW07776.1|18323_18605_+	hypothetical protein	NA	NA	NA	NA	NA
AUW07777.1|18762_18987_+|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	87.8	6.3e-30
AUW07778.1|18964_19459_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	89.0	2.4e-82
AUW07779.1|19547_20015_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	74.2	7.5e-57
>prophage 2
CP026278	Klebsiella oxytoca strain KONIH2 plasmid pKOR-0e8e, complete sequence	48636	23380	43755	48636	tail,head,coat	Cronobacter_phage(45.45%)	26	NA	NA
AUW07780.1|23380_24850_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.9	4.5e-148
AUW07781.1|24776_25784_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.1	4.9e-114
AUW07782.1|25905_27267_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	52.2	3.1e-127
AUW07783.1|27266_27728_+	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
AUW07784.1|27724_28780_+|coat	phage coat protein	coat	B1GS73	Salmonella_phage	53.1	3.8e-101
AUW07785.1|28812_29076_+	hypothetical protein	NA	NA	NA	NA	NA
AUW07786.1|29078_29459_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	9.1e-29
AUW07787.1|29458_29632_+	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	53.6	5.4e-13
AUW07788.1|29631_29994_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	52.5	4.3e-28
AUW07789.1|29996_30422_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
AUW07790.1|30418_30811_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.9	3.3e-34
AUW07791.1|30879_31632_+	DNA breaking-rejoining protein	NA	F1C5E5	Cronobacter_phage	44.9	3.2e-33
AUW07792.1|31684_32362_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	58.4	9.7e-74
AUW07793.1|32537_33293_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
AUW07794.1|33295_33550_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
AUW07807.1|33624_33963_+	hypothetical protein	NA	NA	NA	NA	NA
AUW07808.1|33970_34291_+	hypothetical protein	NA	NA	NA	NA	NA
AUW07795.1|34342_34777_-	hypothetical protein	NA	NA	NA	NA	NA
AUW07796.1|34781_35030_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	72.8	8.0e-26
AUW07797.1|35117_35279_+	Arc family DNA-binding protein	NA	I6S1K8	Salmonella_phage	63.3	1.6e-11
AUW07798.1|35347_36289_+	antirepressor protein Ant	NA	I6S627	Salmonella_phage	68.0	1.5e-77
AUW07799.1|36388_39913_+	hypothetical protein	NA	R9TMK1	Aeromonas_phage	67.1	2.8e-297
AUW07809.1|40012_40432_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.1	4.1e-30
AUW07800.1|40431_40902_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	39.7	2.4e-26
AUW07801.1|40898_41294_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.8	6.1e-36
AUW07802.1|41280_43755_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	45.6	3.8e-200
>prophage 1
CP026284	Klebsiella oxytoca strain KONIH2 plasmid pKOR-5873, complete sequence	132994	15328	43508	132994	transposase	Escherichia_phage(42.86%)	30	NA	NA
AUW08703.1|15328_16033_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUW08704.1|16009_16291_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08705.1|16906_17242_-|transposase	transposase	transposase	G8DH70	Emiliania_huxleyi_virus	35.7	2.8e-05
AUW08706.1|17133_17361_-	protein SamB	NA	NA	NA	NA	NA
AUW08707.1|17400_18048_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08708.1|18112_18487_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AUW08709.1|18510_19074_+	chlorite dismutase	NA	NA	NA	NA	NA
AUW08710.1|20455_21160_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUW08711.1|21421_23083_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUW08712.1|23402_24107_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUW08713.1|24319_27304_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.3	2.8e-306
AUW08714.1|27382_28387_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AUW08715.1|28761_29028_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08716.1|29124_29682_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUW08717.1|29894_30155_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AUW08718.1|30185_30692_+	DUF417 domain-containing protein	NA	NA	NA	NA	NA
AUW08719.1|30926_31388_+	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AUW08720.1|31377_31872_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AUW08721.1|32412_33816_+|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
AUW08722.1|33844_34477_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08723.1|34829_35108_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AUW08724.1|35095_35407_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUW08725.1|35777_36209_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08726.1|36315_36531_-	mobilization protein	NA	NA	NA	NA	NA
AUW08727.1|36537_37029_-	mobilization protein	NA	NA	NA	NA	NA
AUW08728.1|37076_37298_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08729.1|37313_37919_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AUW08730.1|38013_40911_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	7.9e-181
AUW08731.1|41550_41922_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08732.1|42239_43508_+|transposase	IS4 family transposase ISApu1	transposase	NA	NA	NA	NA
>prophage 1
CP026282	Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence	262864	0	55863	262864	transposase	Escherichia_phage(43.75%)	48	NA	NA
AUW08285.1|702_2136_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
AUW08286.1|2225_3509_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
AUW08287.1|3638_5831_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
AUW08288.1|6203_7172_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
AUW08289.1|7472_7673_+	glycogen synthesis protein GlgS	NA	NA	NA	NA	NA
AUW08290.1|8934_9939_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUW08291.1|12521_13127_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AUW08292.1|13516_16204_-	carbonate dehydratase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.5	1.2e-71
AUW08293.1|16254_16686_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	44.1	2.0e-24
AUW08294.1|17210_18296_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUW08295.1|18295_21352_+	MFS transporter	NA	S5VTK5	Leptospira_phage	22.0	1.9e-52
AUW08296.1|21502_22468_+	acyltransferase	NA	NA	NA	NA	NA
AUW08297.1|22475_23051_-	phospholipid:lipid A palmitoyltransferase	NA	NA	NA	NA	NA
AUW08298.1|23099_23555_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUW08299.1|23626_23977_+	mercuric transport protein	NA	NA	NA	NA	NA
AUW08300.1|23992_24268_+	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AUW08301.1|24295_24721_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AUW08302.1|24759_26445_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
AUW08303.1|26462_26828_+	transcriptional regulator	NA	NA	NA	NA	NA
AUW08304.1|26824_27061_+	mercury resistance protein	NA	NA	NA	NA	NA
AUW08541.1|27044_27164_-	mercury resistance protein	NA	NA	NA	NA	NA
AUW08305.1|27126_27339_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AUW08306.1|27468_28026_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	3.4e-48
AUW08307.1|28110_28815_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.6e-138
AUW08308.1|28848_28983_-	ABC transporter	NA	NA	NA	NA	NA
AUW08309.1|29135_29636_-	ferritin	NA	NA	NA	NA	NA
AUW08310.1|29962_30667_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.6e-138
AUW08311.1|30786_31767_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
AUW08312.1|32044_32326_-	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
AUW08313.1|32306_32636_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
AUW08314.1|32856_33135_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08315.1|33682_34705_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUW08542.1|37667_38372_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUW08316.1|38614_39741_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.8	1.4e-48
AUW08317.1|42920_43118_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08318.1|43322_45980_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
AUW08319.1|46024_46795_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08320.1|46922_47453_-	transcriptional regulator	NA	NA	NA	NA	NA
AUW08321.1|47455_47986_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08322.1|47978_48539_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
AUW08323.1|48568_49099_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08324.1|49113_50136_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AUW08325.1|51459_52476_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
AUW08543.1|53392_53599_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08326.1|53737_53977_+	antitoxin	NA	NA	NA	NA	NA
AUW08327.1|53979_54288_+	cytotoxin	NA	NA	NA	NA	NA
AUW08328.1|54621_55176_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08329.1|55245_55863_+	hypothetical protein	NA	A0A076G6Q2	Escherichia_phage	53.4	4.1e-63
>prophage 2
CP026282	Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence	262864	65059	65902	262864		Salmonella_phage(100.0%)	1	NA	NA
AUW08344.1|65059_65902_+	HNH endonuclease	NA	G0X580	Salmonella_phage	39.5	1.8e-16
>prophage 3
CP026282	Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence	262864	69782	79222	262864		Escherichia_phage(50.0%)	11	NA	NA
AUW08347.1|69782_70787_+	peptide transporter	NA	A0A1B0V750	Salmonella_phage	27.2	3.0e-18
AUW08348.1|70910_71312_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08349.1|71283_72984_+	ATPase	NA	A0A172JHZ0	Bacillus_phage	36.7	3.5e-96
AUW08350.1|73121_73346_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08351.1|73625_73943_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08352.1|73944_74694_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08353.1|74714_75401_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08354.1|75559_76735_+	hypothetical protein	NA	A0A088FQX6	Escherichia_phage	31.3	6.5e-17
AUW08355.1|76908_77430_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08356.1|77426_77795_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08357.1|77803_79222_+	replicative DNA helicase	NA	O80281	Escherichia_phage	73.6	4.3e-188
>prophage 4
CP026282	Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence	262864	82961	126707	262864	transposase	Salmonella_phage(50.0%)	42	NA	NA
AUW08362.1|82961_84082_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AUW08363.1|84195_84543_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08364.1|84793_85144_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08365.1|85176_85476_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08366.1|86367_87372_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUW08367.1|87450_90435_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.4	5.4e-302
AUW08368.1|90489_91113_-	serine recombinase	NA	NA	NA	NA	NA
AUW08369.1|91537_93016_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	3.1e-197
AUW08370.1|93033_93861_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	40.2	9.8e-52
AUW08371.1|95263_96268_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUW08372.1|99486_99681_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08373.1|99696_100020_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08374.1|100111_100303_-	transcriptional regulator	NA	NA	NA	NA	NA
AUW08375.1|100446_100971_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08376.1|101042_101588_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08377.1|101724_102027_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08378.1|102138_102564_+	hypothetical protein	NA	A0A0K1YBA5	Cronobacter_phage	42.8	1.6e-26
AUW08379.1|102717_103437_+	HNH endonuclease	NA	G0X580	Salmonella_phage	39.5	2.2e-07
AUW08380.1|104641_104911_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08547.1|104965_106048_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	56.5	1.1e-79
AUW08381.1|107009_107258_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08382.1|107830_108697_+	repA protein	NA	J9Q7H0	Salmonella_phage	37.2	8.4e-46
AUW08383.1|109107_109593_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08384.1|109680_109998_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08385.1|110019_110418_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08548.1|110736_110964_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08386.1|111144_112068_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08387.1|112103_112427_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08388.1|112709_112928_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08389.1|113188_113425_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08390.1|113985_115599_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	37.0	2.2e-07
AUW08391.1|115714_116014_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08392.1|116428_116635_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08393.1|116735_116987_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08394.1|117023_117521_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08395.1|118025_120092_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
AUW08396.1|120088_121480_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08397.1|121641_122610_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
AUW08398.1|123636_124341_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUW08399.1|124399_124651_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08400.1|124764_125910_+	ABC transporter permease	NA	NA	NA	NA	NA
AUW08549.1|125906_126707_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	1.8e-10
>prophage 5
CP026282	Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence	262864	132624	221568	262864	transposase,integrase	Salmonella_phage(18.18%)	104	137163:137222	184716:185936
AUW08406.1|132624_132981_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	91.2	1.7e-32
AUW08407.1|132937_134089_+|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AUW08408.1|135571_136603_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
AUW08550.1|136741_137017_-	hypothetical protein	NA	NA	NA	NA	NA
137163:137222	attL	TGACCTGCTCCCCGTTGATTAGTACACCCCGATGTTAGTAATGTCTTCATAAGCCACATG	NA	NA	NA	NA
AUW08409.1|137233_138353_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AUW08410.1|138528_138843_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08411.1|139057_140461_+|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
AUW08412.1|140489_141122_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08413.1|141326_141557_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08551.1|143499_144462_+	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	41.1	9.6e-59
AUW08414.1|144475_144862_+	plasmid stability protein	NA	NA	NA	NA	NA
AUW08415.1|144888_145293_-	FCD domain-containing protein	NA	NA	NA	NA	NA
AUW08416.1|145494_145836_-	toxin	NA	NA	NA	NA	NA
AUW08417.1|145856_146174_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AUW08418.1|146193_146415_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	38.9	3.1e-05
AUW08419.1|146423_146900_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08420.1|146915_147374_-	antirestriction protein	NA	NA	NA	NA	NA
AUW08421.1|147471_147711_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AUW08422.1|147787_148255_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08423.1|148280_148721_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08424.1|148720_148960_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08425.1|148996_149698_-	WYL domain-containing protein	NA	NA	NA	NA	NA
AUW08426.1|149914_150736_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	4.7e-46
AUW08427.1|150827_151691_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08428.1|151993_153010_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
AUW08429.1|153227_153386_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08552.1|153382_153937_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
AUW08430.1|154001_155318_-|integrase	integrase	integrase	A0A248SL35	Klebsiella_phage	29.5	6.6e-34
AUW08431.1|155556_155886_+	acid-resistance protein	NA	NA	NA	NA	NA
AUW08432.1|155937_156741_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	1.6e-14
AUW08433.1|156794_158606_-	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
AUW08434.1|158616_159045_-	propanediol dehydratase small subunit PduE	NA	NA	NA	NA	NA
AUW08435.1|159047_159632_-	propanediol dehydratase medium subunit PduD	NA	NA	NA	NA	NA
AUW08436.1|159643_161311_-	propanediol dehydratase large subunit PduC	NA	NA	NA	NA	NA
AUW08437.1|161702_162131_+	heme-binding protein	NA	NA	NA	NA	NA
AUW08438.1|162153_163317_+	1,3-propanediol dehydrogenase	NA	NA	NA	NA	NA
AUW08439.1|163333_163687_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08440.1|163687_164218_+	ATP:cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
AUW08441.1|164195_166121_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUW08442.1|166212_167310_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
AUW08443.1|167866_168937_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
AUW08444.1|168947_169580_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
AUW08445.1|169590_171009_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
AUW08446.1|171083_172733_+	glycerone kinase	NA	NA	NA	NA	NA
AUW08447.1|172836_173607_-	siderophore-interacting protein	NA	NA	NA	NA	NA
AUW08448.1|173813_174011_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08449.1|173989_174655_+	DNA methylase	NA	NA	NA	NA	NA
AUW08450.1|174651_177225_+	type III restriction endonuclease subunit R	NA	NA	NA	NA	NA
AUW08451.1|177315_177942_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AUW08452.1|177923_178904_-|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AUW08453.1|178999_179155_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08553.1|179151_179706_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
AUW08454.1|179770_181087_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.0	4.6e-35
AUW08455.1|181231_181597_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08456.1|181928_182534_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08457.1|182544_182967_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08458.1|183583_184704_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AUW08459.1|185302_185983_-	hypothetical protein	NA	NA	NA	NA	NA
184716:185936	attR	CATGTGGCTTATGAAGACATTACTAACATCGGGGTGTACTAATCAACGGGGAGCAGGTCACCCAACCTACGTAAGTCACTCAAAACATTGCAGCAAAATGGCTATGTATGGAAGTACCGGAACAAAAACGATCTTACAGTTTCATTTGAGTTAACTTCATCAGGAGAACTCCAGGCAACTTCATTTCGGGTGCGAAGATTAGAGGCATGGGGCCAGGCAGACGAGTAAAACTCGTCTGCTGGTGGTTACACAGAAAGATACTTTTTACTGATAGTTAAAGCGCTGCGTCGTTTTAATGCAAATGGACGATTATCAGAAAGTCTGGAAGCATTACCGGCGCGAATGAATATGCGTTTCATCCTGCGGTCAAAATGTTCTTCTGACCAGCCGAAGGGATACGTACCCTTAATACCATCTATTGGCCCGGCAAGAATGCGAGCGGTTTCGCTACGAAGAGTACTTCCCCTTAAACCAAATGAGCTAAGTTTATTTCTTATCAGACTTACAGAAAATTTCCTGGGTTTTAAAACACCCTTAATACAGTACAGATGTTTACTCATAGCATTACCCTTTTATTATGGGAACGATTAGCTGCGCTGCATAAAGTCGATGGATTGGCGTTTGTTTTCTTCGATTATCTTCATTGCCTCTTCAAGCCATCCAGCATCTTCACCCCGGCTGGTTAGCTCTTTGTGCTTTAGTTTGAGTGCAAATACTGCGTCATCAGCACCGGCAGTAAACAATTCTTGTCTGACTTGTTGTGTGCTGGTTGTACCATTTATAACACCAACCATATAATTCACGATATCAATAACTTGGGGGAGTAAATCTGGATCCTCATGATTAATCTCCTCGATACTGACAAACGGCAGTAACCGGTCAATCAGCATATGGGCTAGGTTGGTGATATTCAGCAGGAATAGGTTATCGTTCTCGGTGTCGCTTTTGCTTTTTACTTCTGATGCGGTAAACGACTGAACCCGGCGATTGTATTCGCACTGCCACTCCTTACAGGCACTGATCATCCAGTTCTGTATCTCTTCATCAGAAGCGTTGGATGATGGAATGTCCATCGCAGCAGGGAGAACTTGATCCCACGGGTAAACATGAGAATCAATCATCACGCCTTCCGCGTTACGCATTAACTCAGATAAAGCCACTATGATGCGGCGCATCAGATGGTTTTCAGTGAGGAGAGTAAACTCTTGTTTCGATGCACCA	NA	NA	NA	NA
AUW08460.1|186200_186398_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08461.1|186669_187227_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AUW08462.1|187864_188896_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
AUW08463.1|189317_189770_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08464.1|189782_190088_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08465.1|190093_190474_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08466.1|190700_191585_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08467.1|191784_192186_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08468.1|192276_192738_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08554.1|192812_193010_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08469.1|193121_193457_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AUW08555.1|193465_193777_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08470.1|193892_194963_-	phosphohydrolase	NA	H7BVI4	unidentified_phage	28.4	6.5e-40
AUW08471.1|194955_195279_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08472.1|195401_196391_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08473.1|196417_196822_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08474.1|197148_197700_-	DNA-binding protein	NA	NA	NA	NA	NA
AUW08475.1|197729_197966_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08476.1|198043_198334_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08477.1|198519_198921_-	DNA-binding protein	NA	Q1MVE8	Enterobacteria_phage	69.9	3.5e-47
AUW08478.1|199469_199961_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08479.1|200046_200538_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUW08480.1|200708_200966_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	65.7	8.3e-18
AUW08481.1|201254_201833_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08482.1|201947_202838_-	DNA replication protein	NA	NA	NA	NA	NA
AUW08483.1|202987_204253_-	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	60.6	9.8e-144
AUW08556.1|204252_204669_-	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	54.7	1.0e-36
AUW08484.1|204922_205426_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08485.1|205409_205682_+	hypothetical protein	NA	NA	NA	NA	NA
AUW08486.1|205782_206805_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUW08487.1|206828_209867_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.5	5.0e-295
AUW08488.1|210034_210676_+	resolvase	NA	NA	NA	NA	NA
AUW08489.1|210939_212598_-	CoA-disulfide reductase	NA	NA	NA	NA	NA
AUW08490.1|212758_213109_+	transcriptional regulator	NA	NA	NA	NA	NA
AUW08491.1|213413_213890_-	DNA starvation/stationary phase protection protein	NA	G0X506	Salmonella_phage	28.7	6.7e-05
AUW08492.1|214004_214442_-	PaaI family thioesterase	NA	NA	NA	NA	NA
AUW08493.1|214602_215064_-	dinitrogenase iron-molybdenum cofactor	NA	NA	NA	NA	NA
AUW08494.1|215038_215359_-	DUF134 domain-containing protein	NA	NA	NA	NA	NA
AUW08495.1|215818_216823_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AUW08496.1|216901_218299_-	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	32.1	1.3e-117
AUW08497.1|218301_218859_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	3.4e-48
AUW08498.1|218988_219201_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AUW08557.1|219163_219283_+	mercury resistance protein	NA	NA	NA	NA	NA
AUW08499.1|219266_219503_-	mercury resistance protein	NA	NA	NA	NA	NA
AUW08500.1|219499_219865_-	transcriptional regulator	NA	NA	NA	NA	NA
AUW08501.1|219882_221568_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
>prophage 6
CP026282	Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence	262864	225927	231362	262864	transposase	Wolbachia_phage(50.0%)	6	NA	NA
AUW08508.1|225927_226461_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
AUW08509.1|226633_226948_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08510.1|227202_227559_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AUW08511.1|227548_227950_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AUW08512.1|227946_228237_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AUW08513.1|228395_231362_+|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
>prophage 7
CP026282	Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence	262864	247844	256341	262864	transposase	uncultured_Caudovirales_phage(60.0%)	8	NA	NA
AUW08531.1|247844_250853_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
AUW08532.1|251016_251589_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	89.0	2.0e-83
AUW08560.1|251597_252002_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AUW08533.1|252032_252458_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
AUW08534.1|252470_253760_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.5e-171
AUW08535.1|253808_255560_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AUW08536.1|255577_255940_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AUW08537.1|255987_256341_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
>prophage 8
CP026282	Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence	262864	259343	260987	262864		Streptococcus_phage(100.0%)	1	NA	NA
AUW08540.1|259343_260987_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	25.0	1.5e-22
>prophage 1
CP026283	Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence	125961	15615	26013	125961	transposase	uncultured_Caudovirales_phage(28.57%)	14	NA	NA
AUW08567.1|15615_15894_-	XRE family transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
AUW08568.1|15883_16204_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
AUW08569.1|16284_16509_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08570.1|16519_16732_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08571.1|16792_17149_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	4.4e-25
AUW08572.1|17780_18131_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08573.1|18127_18400_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08574.1|18627_21708_-|transposase	DDE transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
AUW08575.1|21731_22043_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUW08576.1|22042_22303_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AUW08577.1|22472_23093_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	37.1	1.1e-26
AUW08578.1|23210_23543_-	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AUW08579.1|23633_24488_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	48.6	1.3e-67
AUW08580.1|24522_26013_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	82.2	8.6e-224
>prophage 1
CP026280	Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence	152041	3547	47152	152041	transposase,integrase	Escherichia_phage(41.67%)	49	9544:9559	50398:50413
AUW07883.1|3547_4552_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AUW07884.1|5670_5886_+	hypothetical protein	NA	NA	NA	NA	NA
AUW07885.1|6000_6705_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUW07886.1|7273_7855_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUW07887.1|7859_8198_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AUW07888.1|8227_8557_-	thioredoxin	NA	V9SJ74	Achromobacter_phage	34.7	1.3e-10
AUW07889.1|8770_9877_+	alkene reductase	NA	NA	NA	NA	NA
9544:9559	attL	CGGTCAGCGGGAACTG	NA	NA	NA	NA
AUW07890.1|9942_10644_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
AUW07891.1|10709_11483_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AUW07892.1|12944_13913_-	AAA family ATPase	NA	NA	NA	NA	NA
AUW07893.1|13902_15564_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUW07894.1|15547_16108_-	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	41.8	1.9e-30
AUW07895.1|16446_16923_-	hypothetical protein	NA	NA	NA	NA	NA
AUW07896.1|17015_17282_-	hypothetical protein	NA	NA	NA	NA	NA
AUW08041.1|17422_18043_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUW07897.1|18503_19373_-	EamA family transporter	NA	NA	NA	NA	NA
AUW07898.1|19613_20366_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUW07899.1|20805_21810_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUW07900.1|23936_24941_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AUW07901.1|25661_26156_-	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AUW07902.1|26145_26607_-	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AUW07903.1|26841_27348_-	DUF417 domain-containing protein	NA	NA	NA	NA	NA
AUW07904.1|27378_27639_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AUW07905.1|27851_28409_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUW07906.1|28505_28772_-	hypothetical protein	NA	NA	NA	NA	NA
AUW07907.1|29145_30150_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AUW07908.1|31203_31908_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUW07909.1|31954_32191_-	hypothetical protein	NA	NA	NA	NA	NA
AUW07910.1|32264_32681_-	PIN domain nuclease	NA	NA	NA	NA	NA
AUW07911.1|32677_32908_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AUW07912.1|32891_33326_+	hypothetical protein	NA	NA	NA	NA	NA
AUW07913.1|33249_33444_-	hypothetical protein	NA	NA	NA	NA	NA
AUW07914.1|33495_33714_+	plasmid maintenance protein CcdA	NA	NA	NA	NA	NA
AUW07915.1|33715_34021_+	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AUW08042.1|34225_34585_+	hypothetical protein	NA	NA	NA	NA	NA
AUW07916.1|34611_34926_+	hypothetical protein	NA	NA	NA	NA	NA
AUW07917.1|34936_35953_+	hypothetical protein	NA	NA	NA	NA	NA
AUW07918.1|36150_36945_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
AUW08043.1|37384_37564_-	Par-like protein	NA	NA	NA	NA	NA
AUW07919.1|37683_38310_-	cobyrinic acid ac-diamide synthase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
AUW07920.1|38942_39818_-	replication initiation protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
AUW07921.1|40229_41501_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
AUW07922.1|41500_41932_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AUW07923.1|42090_42342_+	hypothetical protein	NA	NA	NA	NA	NA
AUW07924.1|42341_43826_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AUW07925.1|44074_45046_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AUW07926.1|45048_45720_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
AUW07927.1|45783_46014_+	hypothetical protein	NA	NA	NA	NA	NA
AUW07928.1|46450_47152_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	3.2e-27
50398:50413	attR	CGGTCAGCGGGAACTG	NA	NA	NA	NA
