The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	121691	130327	6252643		Enterobacteria_phage(83.33%)	12	NA	NA
AUV89672.1|121691_122285_-	hypothetical protein	NA	Q9JMN3	Wolbachia_phage	45.7	3.7e-37
AUV89673.1|122409_122697_-	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
AUV89674.1|122823_123015_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AUV89675.1|123031_123760_-	hypothetical protein	NA	NA	NA	NA	NA
AUV89676.1|124499_126833_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	81.3	0.0e+00
AUV89677.1|126847_127168_-	hypothetical protein	NA	NA	NA	NA	NA
AUV89678.1|127164_127392_-	hypothetical protein	NA	NA	NA	NA	NA
AUV89679.1|127388_127940_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	74.1	1.0e-36
AUV89680.1|128154_128382_-	hypothetical protein	NA	NA	NA	NA	NA
AUV89681.1|128763_129501_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	60.2	1.5e-72
AUV89682.1|129497_129743_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
AUV89683.1|129760_130327_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	3.3e-59
>prophage 2
CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	1387221	1501939	6252643	head,holin,integrase,plate,tail,tRNA,portal,transposase,capsid,terminase	Escherichia_phage(28.07%)	118	1439878:1439894	1472278:1472294
AUV90843.1|1387221_1388202_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
AUV90844.1|1388392_1388791_-	Cag pathogenicity island protein Cag12	NA	NA	NA	NA	NA
AUV90845.1|1388787_1389813_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
AUV90846.1|1389802_1391056_-	type VI secretion protein	NA	NA	NA	NA	NA
AUV90847.1|1391075_1391978_-	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
AUV90848.1|1391977_1392661_-	type IV secretion system protein	NA	NA	NA	NA	NA
AUV90849.1|1392883_1393948_-	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
AUV90850.1|1393958_1394186_-	hypothetical protein	NA	NA	NA	NA	NA
AUV90851.1|1394197_1394902_-	type IV secretion system protein VirB5	NA	NA	NA	NA	NA
AUV90852.1|1394922_1397667_-	ATPase	NA	NA	NA	NA	NA
AUV95156.1|1397677_1397971_-	TriB protein	NA	NA	NA	NA	NA
AUV95157.1|1397970_1398681_-	type VI secretion protein	NA	NA	NA	NA	NA
AUV95158.1|1398751_1398985_-	hypothetical protein	NA	NA	NA	NA	NA
AUV90853.1|1399379_1399589_-	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AUV90854.1|1399578_1400163_-	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
AUV95159.1|1400286_1400472_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	52.0	9.6e-08
AUV90855.1|1400658_1400844_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	52.0	9.6e-08
AUV90856.1|1400984_1401911_-	hypothetical protein	NA	NA	NA	NA	NA
AUV90857.1|1402261_1405333_-	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
AUV95160.1|1405329_1406310_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUV90858.1|1406567_1407530_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
AUV90859.1|1407528_1408509_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
AUV95161.1|1408547_1408685_-	ABC transporter	NA	NA	NA	NA	NA
AUV90860.1|1408733_1410182_+	sensor histidine kinase	NA	NA	NA	NA	NA
AUV90861.1|1410178_1410838_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUV90862.1|1411239_1412487_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	38.1	1.1e-67
AUV90863.1|1412765_1413839_-	2-methylthioadenine synthetase	NA	NA	NA	NA	NA
AUV90864.1|1413835_1414300_-	hypothetical protein	NA	NA	NA	NA	NA
AUV90865.1|1414289_1416008_-	hypothetical protein	NA	NA	NA	NA	NA
AUV90866.1|1417120_1418270_+	DDE domain-containing protein	NA	U5P429	Shigella_phage	41.5	5.4e-48
AUV90867.1|1418823_1419426_-	hypothetical protein	NA	NA	NA	NA	NA
AUV90868.1|1419422_1419860_-	hypothetical protein	NA	NA	NA	NA	NA
AUV90869.1|1420680_1421241_+	3'-5' exonuclease	NA	A0A2K9L1H6	Tupanvirus	28.0	1.0e-07
AUV95162.1|1421249_1421750_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95163.1|1421815_1422856_-	thiamine biosynthesis protein ThiF	NA	NA	NA	NA	NA
AUV95164.1|1423519_1424701_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AUV95165.1|1424807_1426187_-	hypothetical protein	NA	NA	NA	NA	NA
AUV90870.1|1426678_1427789_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	29.7	5.4e-05
AUV90871.1|1428314_1429556_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	46.3	2.9e-100
AUV90872.1|1430243_1430726_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	1.8e-29
AUV90873.1|1430836_1431313_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
AUV90874.1|1431302_1431593_+	RnfH family protein	NA	NA	NA	NA	NA
AUV90875.1|1431659_1432001_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AUV90876.1|1432148_1433810_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AUV90877.1|1433896_1434775_-	NAD(+) kinase	NA	NA	NA	NA	NA
AUV90878.1|1434870_1435491_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUV90879.1|1435555_1436845_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AUV90880.1|1436863_1437655_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AUV90881.1|1437819_1439187_+	signal recognition particle protein	NA	NA	NA	NA	NA
AUV90882.1|1439423_1439672_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUV90883.1|1439690_1440239_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
1439878:1439894	attL	GGCGCCACCACAATCAG	NA	NA	NA	NA
AUV90884.1|1440284_1441052_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AUV90885.1|1441091_1441439_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AUV90886.1|1441589_1441808_-	transcriptional regulator	NA	Q37973	Salmonella_virus	84.7	1.0e-32
AUV90887.1|1441884_1443042_-	hypothetical protein	NA	Q7Y4C6	Escherichia_virus	80.9	2.9e-174
AUV90888.1|1443041_1443521_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	77.7	1.4e-66
AUV90889.1|1443532_1445971_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	83.1	8.4e-293
AUV90890.1|1445963_1446101_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	91.1	2.2e-17
AUV90891.1|1446115_1446391_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
AUV90892.1|1446450_1446966_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
AUV90893.1|1446979_1448161_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	86.1	3.9e-195
AUV90894.1|1448270_1449431_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	49.3	6.0e-47
AUV90895.1|1449484_1449739_-	hypothetical protein	NA	L0ARW5	Klebsiella_phage	50.6	1.0e-15
AUV90896.1|1449741_1451847_-|tail	phage tail protein	tail	R9TMK5	Aeromonas_phage	40.2	5.9e-109
AUV90897.1|1451852_1452449_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	51.3	3.9e-50
AUV90898.1|1452441_1453350_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	72.2	8.9e-115
AUV90899.1|1453354_1453702_-|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	76.5	5.4e-44
AUV90900.1|1453698_1454334_-|plate	phage baseplate assembly protein V	plate	M1SV78	Escherichia_phage	84.4	4.5e-97
AUV90901.1|1454402_1454852_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.7	1.4e-49
AUV90902.1|1454844_1455312_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	73.5	1.0e-61
AUV90903.1|1455407_1455839_-	protein lysB	NA	O80310	Escherichia_phage	65.5	2.4e-41
AUV90904.1|1455835_1456333_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	87.3	7.9e-81
AUV90905.1|1456319_1456610_-|holin	holin	holin	O80308	Escherichia_phage	84.7	9.1e-37
AUV90906.1|1456614_1456818_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	79.1	2.8e-24
AUV90907.1|1456817_1457324_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.6	2.9e-62
AUV90908.1|1457419_1458178_-|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	64.9	2.1e-77
AUV90909.1|1458181_1459342_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	63.0	2.8e-129
AUV90910.1|1459373_1460237_-|capsid	capsid scaffolding protein	capsid	Q01088	Escherichia_phage	74.9	1.3e-118
AUV90911.1|1460401_1462171_+	oxidoreductase	NA	A0A218M4M1	Erwinia_phage	80.8	5.5e-286
AUV90912.1|1462170_1463205_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	81.5	2.0e-163
AUV90913.1|1463644_1463875_-	DinI family protein	NA	A0A218M4I0	Erwinia_phage	77.6	2.7e-28
AUV90914.1|1463878_1464064_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	77.0	6.0e-18
AUV90915.1|1464185_1466408_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	93.4	0.0e+00
AUV90916.1|1466398_1466680_-	DUF3850 domain-containing protein	NA	A0A0P0I3U9	Klebsiella_phage	50.0	1.3e-11
AUV90917.1|1466676_1466949_-	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	73.3	1.1e-31
AUV90918.1|1466945_1467527_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	77.7	2.6e-83
AUV90919.1|1467523_1467751_-	hypothetical protein	NA	A0A0M4S5Q7	Salmonella_phage	77.8	8.1e-25
AUV90920.1|1467750_1467975_-	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	71.9	4.4e-15
AUV90921.1|1468040_1468328_-	hypothetical protein	NA	F1BUS4	Erwinia_phage	57.0	2.3e-24
AUV90922.1|1468408_1468609_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	71.0	5.5e-17
AUV90923.1|1468616_1469126_-	hypothetical protein	NA	Q6K1F8	Salmonella_virus	94.1	6.0e-84
AUV90924.1|1469158_1469533_-	Cro/Cl family transcriptional regulator	NA	A0A0M4R4X7	Salmonella_phage	75.0	1.1e-45
AUV90925.1|1469654_1470500_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	65.2	1.4e-101
AUV90926.1|1470507_1470912_+	hypothetical protein	NA	B9A7A8	Serratia_phage	40.2	1.3e-20
AUV90927.1|1470939_1471989_+|integrase	integrase	integrase	A0A0M4S6G4	Salmonella_phage	92.8	3.1e-196
AUV90928.1|1472205_1472643_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
1472278:1472294	attR	CTGATTGTGGTGGCGCC	NA	NA	NA	NA
AUV90929.1|1472697_1474068_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
AUV90930.1|1474072_1474555_-	hypothetical protein	NA	NA	NA	NA	NA
AUV90931.1|1474566_1475790_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUV90932.1|1475782_1476292_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AUV90933.1|1476636_1477707_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	4.8e-91
AUV90934.1|1477716_1478838_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AUV95166.1|1478906_1479779_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AUV90935.1|1479775_1480936_-	prephenate dehydratase	NA	NA	NA	NA	NA
AUV95167.1|1481042_1481090_-	hypothetical protein	NA	NA	NA	NA	NA
AUV90936.1|1481197_1481533_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AUV90937.1|1481804_1482542_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AUV90938.1|1482674_1483655_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AUV90939.1|1483651_1484383_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AUV90940.1|1484510_1487084_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.7	3.1e-128
AUV95168.1|1492909_1493365_+	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	47.6	1.1e-31
AUV90941.1|1493638_1494937_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	1.8e-44
AUV90942.1|1494939_1495266_-	hypothetical protein	NA	NA	NA	NA	NA
AUV90943.1|1495305_1496661_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AUV90944.1|1496754_1499433_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AUV90945.1|1499468_1500167_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AUV90946.1|1500236_1500662_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	4.6e-13
AUV90947.1|1500865_1501939_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	1506325	1566180	6252643	holin,integrase,portal,tRNA,tail,terminase	Klebsiella_phage(22.0%)	78	1519627:1519642	1527420:1527435
AUV90952.1|1506325_1507066_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
AUV90953.1|1507050_1508670_-	L-aspartate oxidase	NA	NA	NA	NA	NA
AUV95169.1|1508641_1508779_-	L-aspartate oxidase	NA	NA	NA	NA	NA
AUV90954.1|1509094_1509670_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
AUV90955.1|1509702_1510353_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
AUV90956.1|1510352_1511309_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
AUV90957.1|1511305_1511785_+	SoxR reducing system protein RseC	NA	NA	NA	NA	NA
AUV90958.1|1511970_1513770_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.3	6.5e-24
AUV90959.1|1513785_1514760_+	signal peptidase I	NA	NA	NA	NA	NA
AUV90960.1|1514812_1515043_-	hypothetical protein	NA	NA	NA	NA	NA
AUV90961.1|1514986_1515667_+	ribonuclease 3	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.5	2.8e-20
AUV90962.1|1515663_1516569_+	GTPase Era	NA	NA	NA	NA	NA
AUV90963.1|1516582_1516768_+	hypothetical protein	NA	NA	NA	NA	NA
AUV95170.1|1516767_1517505_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AUV90964.1|1517516_1518248_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AUV90965.1|1518247_1518628_+	holo-ACP synthase	NA	NA	NA	NA	NA
AUV90966.1|1518674_1518935_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	1.9e-17
AUV90967.1|1519149_1520547_+	recombinase	NA	NA	NA	NA	NA
1519627:1519642	attL	GAACGGGAAGTATTTA	NA	NA	NA	NA
AUV90968.1|1520543_1520744_-	DNA-binding protein	NA	NA	NA	NA	NA
AUV90969.1|1520745_1521318_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	64.5	6.7e-68
AUV90970.1|1521368_1521605_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	55.4	1.0e-14
AUV90971.1|1521597_1522008_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	56.9	3.4e-05
AUV95171.1|1522004_1522223_-	hypothetical protein	NA	Q8HAA6	Salmonella_phage	63.8	1.6e-09
AUV90972.1|1522688_1522877_-	diguanylate phosphodiesterase	NA	A0A192Y8X2	Salmonella_phage	88.7	6.3e-23
AUV90973.1|1522876_1523251_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	93.3	5.6e-63
AUV90974.1|1523251_1524007_-	hypothetical protein	NA	NA	NA	NA	NA
AUV90975.1|1523999_1524308_-	hypothetical protein	NA	NA	NA	NA	NA
AUV90976.1|1524304_1524433_-|integrase	integrase	integrase	NA	NA	NA	NA
AUV90977.1|1524626_1525487_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	57.9	6.8e-72
AUV90978.1|1525567_1526380_-	hypothetical protein	NA	NA	NA	NA	NA
AUV90979.1|1526421_1526781_-	hypothetical protein	NA	NA	NA	NA	NA
AUV90980.1|1527119_1527479_-	hypothetical protein	NA	NA	NA	NA	NA
1527420:1527435	attR	GAACGGGAAGTATTTA	NA	NA	NA	NA
AUV90981.1|1527905_1528559_-	LexA family transcriptional repressor	NA	K7PLZ5	Enterobacterial_phage	59.4	2.2e-70
AUV90982.1|1528654_1528852_+	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	49.2	6.2e-13
AUV90983.1|1528877_1529348_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	76.3	5.0e-61
AUV90984.1|1529383_1529662_+	hypothetical protein	NA	NA	NA	NA	NA
AUV90985.1|1529825_1530101_+	hypothetical protein	NA	A0A1P8VVT6	Streptococcus_phage	43.6	5.1e-05
AUV90986.1|1530093_1531623_+	helicase	NA	A0A286N2P9	Klebsiella_phage	67.1	4.6e-204
AUV90987.1|1531619_1532591_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	61.1	1.7e-108
AUV95172.1|1532560_1533205_+	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	55.7	2.3e-40
AUV90988.1|1533201_1533846_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	66.4	7.8e-81
AUV90989.1|1533835_1534240_+	antitermination protein	NA	S5M7R9	Escherichia_phage	51.6	4.7e-31
AUV90990.1|1534419_1534611_+	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	85.7	2.9e-23
AUV90991.1|1534761_1535814_+	DNA adenine methylase	NA	A5LH81	Enterobacteria_phage	80.4	7.1e-172
AUV90992.1|1535961_1536357_+	hypothetical protein	NA	G8C7V8	Escherichia_phage	72.3	3.2e-45
AUV90993.1|1536343_1536625_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	73.1	1.7e-32
AUV90994.1|1536624_1537254_+	endolysin	NA	F1C591	Cronobacter_phage	75.8	7.6e-89
AUV90995.1|1537256_1537532_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	96.4	1.6e-06
AUV90996.1|1537482_1537674_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	83.9	7.0e-22
AUV90997.1|1537753_1538053_+	hypothetical protein	NA	NA	NA	NA	NA
AUV90998.1|1538123_1538363_+	hypothetical protein	NA	A0A286N2R1	Klebsiella_phage	89.2	3.7e-28
AUV90999.1|1538680_1539172_+|terminase	terminase	terminase	K7PJY2	Enterobacterial_phage	84.7	2.9e-67
AUV91000.1|1539171_1541280_+	DNA packaging protein	NA	K7PH52	Enterobacterial_phage	82.4	0.0e+00
AUV91001.1|1541276_1541492_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	78.6	3.4e-25
AUV91002.1|1541488_1542988_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.0	1.8e-245
AUV91003.1|1542932_1544945_+	peptidase S14	NA	K7PKX4	Enterobacterial_phage	83.8	0.0e+00
AUV95173.1|1545026_1545353_+	recombinase RecA	NA	K7PJY3	Enterobacterial_phage	70.1	5.1e-36
AUV91004.1|1545345_1545639_+	ATP-binding protein	NA	NA	NA	NA	NA
AUV91005.1|1545628_1546180_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	68.7	3.7e-55
AUV91006.1|1546176_1546575_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	58.6	3.2e-40
AUV91007.1|1546582_1547065_+|tail	phage tail protein	tail	O64327	Escherichia_phage	66.9	4.1e-58
AUV91008.1|1547107_1547506_+|tail	phage tail protein	tail	NA	NA	NA	NA
AUV91009.1|1547526_1547844_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	53.4	8.4e-20
AUV91010.1|1547824_1550521_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	58.2	4.6e-199
AUV91011.1|1550520_1550994_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	57.8	1.8e-50
AUV91012.1|1550980_1551463_+	ArsR family transcriptional regulator	NA	A0A286S2B1	Klebsiella_phage	63.9	2.6e-52
AUV91013.1|1551470_1551851_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	50.0	3.2e-34
AUV95174.1|1552351_1554901_+	kinase	NA	A0A286S259	Klebsiella_phage	67.2	0.0e+00
AUV91014.1|1554977_1557110_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	36.9	2.6e-11
AUV91015.1|1557266_1558667_+	hypothetical protein	NA	W6E8G0	Rhizobium_phage	30.3	4.3e-15
AUV91016.1|1558767_1560168_-	hypothetical protein	NA	W6E8G0	Rhizobium_phage	33.5	1.4e-21
AUV91017.1|1560297_1562286_-	hypothetical protein	NA	A0A2H4YH15	Raoultella_phage	45.7	1.4e-06
AUV95175.1|1562378_1562942_+	DNA-invertase	NA	A0A286S1P7	Klebsiella_phage	93.9	8.1e-90
AUV91018.1|1562960_1563200_-	DinI family protein	NA	K7P6H1	Enterobacteria_phage	84.4	1.2e-29
AUV91019.1|1563273_1563600_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.9	8.9e-25
AUV91020.1|1563921_1564770_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AUV91021.1|1564979_1565615_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
AUV91022.1|1565634_1566180_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	4.5e-05
>prophage 4
CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	1815240	1889509	6252643	transposase,plate,integrase,holin	Pseudomonas_phage(13.33%)	58	1810704:1810721	1843368:1843385
1810704:1810721	attL	CTGCTGGGCGGCGCGGTG	NA	NA	NA	NA
AUV91235.1|1815240_1815792_+|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	51.6	2.1e-50
AUV91236.1|1816217_1816754_+	fimbrial protein	NA	NA	NA	NA	NA
AUV91237.1|1816816_1817479_+	molecular chaperone	NA	NA	NA	NA	NA
AUV91238.1|1817509_1820059_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AUV91239.1|1820078_1821119_+	fimbrial protein	NA	NA	NA	NA	NA
AUV91240.1|1821131_1821641_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AUV91241.1|1821674_1822205_+	recombinase	NA	NA	NA	NA	NA
AUV91242.1|1822251_1823172_-	ribonuclease Z	NA	NA	NA	NA	NA
AUV91243.1|1823356_1823818_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUV91244.1|1823915_1825211_+	isochorismate synthase MenF	NA	NA	NA	NA	NA
AUV91245.1|1825288_1826959_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
AUV91246.1|1826955_1827714_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
AUV91247.1|1827728_1828586_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
AUV91248.1|1828585_1829551_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
AUV91249.1|1829547_1830939_+	o-succinylbenzoate--CoA ligase	NA	NA	NA	NA	NA
AUV91250.1|1830915_1831539_-	hypothetical protein	NA	NA	NA	NA	NA
AUV91251.1|1831644_1833165_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
AUV91252.1|1833176_1833608_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
AUV91253.1|1833623_1834604_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
AUV91254.1|1834738_1835413_+	transcriptional regulator TctD	NA	NA	NA	NA	NA
AUV91255.1|1835399_1836815_+	sensor histidine kinase	NA	NA	NA	NA	NA
AUV91256.1|1836806_1837232_-	nucleoside triphosphatase NudI	NA	NA	NA	NA	NA
AUV91257.1|1838351_1839800_-	catalase	NA	A0A2K9L0T1	Tupanvirus	46.7	6.9e-101
AUV91258.1|1840069_1840612_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91259.1|1840708_1841905_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
AUV91260.1|1842109_1842892_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUV91261.1|1842905_1844111_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.0	6.7e-25
1843368:1843385	attR	CTGCTGGGCGGCGCGGTG	NA	NA	NA	NA
AUV91262.1|1844163_1845453_+	MFS transporter	NA	NA	NA	NA	NA
AUV91263.1|1845467_1846271_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
AUV91264.1|1846293_1847472_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
AUV91265.1|1847468_1848728_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
AUV91266.1|1848717_1850340_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
AUV95193.1|1850611_1851958_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
AUV91267.1|1851967_1853035_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	42.9	3.9e-08
AUV91268.1|1853039_1853996_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUV91269.1|1854040_1855585_-|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0SI18	Klosneuvirus	28.2	6.8e-38
AUV91270.1|1855776_1856031_-	2Fe-2S ferredoxin	NA	G9IAA2	Pseudomonas_phage	64.0	8.2e-26
AUV91271.1|1856030_1857161_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	4.8e-174
AUV91272.1|1857264_1859550_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.9	3.5e-285
AUV91273.1|1859894_1860623_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
AUV91274.1|1860808_1863442_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.7	6.2e-92
AUV91275.1|1863572_1866419_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.3	3.4e-43
AUV91276.1|1866463_1867114_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
AUV91277.1|1867130_1869791_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
AUV91278.1|1870562_1871681_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.5	1.9e-119
AUV91279.1|1871783_1872836_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AUV91280.1|1872908_1873973_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	L7Y5F8	Megavirus	47.2	1.4e-18
AUV91281.1|1873972_1874623_+	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
AUV91282.1|1874699_1876343_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.6	1.2e-08
AUV91283.1|1876511_1877948_+	magnesium transporter	NA	NA	NA	NA	NA
AUV91284.1|1877910_1879158_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	44.6	7.3e-67
AUV91285.1|1879437_1881072_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AUV91286.1|1881116_1881608_-	ecotin	NA	NA	NA	NA	NA
AUV91287.1|1881810_1882917_-	AI-2E family transporter	NA	NA	NA	NA	NA
AUV91288.1|1883489_1884515_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV91289.1|1884809_1885778_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	8.7e-185
AUV91290.1|1886096_1887122_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV91291.1|1887745_1889509_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 5
CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	2004237	2012631	6252643		Planktothrix_phage(33.33%)	8	NA	NA
AUV95200.1|2004237_2005101_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	3.9e-11
AUV91388.1|2005111_2005885_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	7.8e-27
AUV91389.1|2006301_2007102_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
AUV91390.1|2007088_2007559_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91391.1|2007559_2008453_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.9	8.8e-14
AUV91392.1|2008697_2010059_-	U32 family peptidase	NA	Q6DW11	Phage_TP	91.8	4.7e-200
AUV91393.1|2010376_2011099_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	2.4e-30
AUV91394.1|2011095_2012631_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	27.6	2.8e-28
>prophage 6
CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	2226256	2250087	6252643	head,integrase,tail	Pectobacterium_phage(36.36%)	34	2224386:2224400	2246784:2246798
2224386:2224400	attL	TGCGGGCGCTGGCGA	NA	NA	NA	NA
AUV91562.1|2226256_2227273_-|integrase	integrase	integrase	H9C152	Pectobacterium_phage	64.2	3.7e-125
AUV91563.1|2227256_2227502_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	40.0	8.2e-07
AUV91564.1|2227437_2227662_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	59.2	1.7e-11
AUV91565.1|2227711_2227897_-	hypothetical protein	NA	NA	NA	NA	NA
AUV91566.1|2227898_2228465_-	hypothetical protein	NA	H9C156	Pectobacterium_phage	63.0	3.6e-53
AUV91567.1|2228464_2230618_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.0	9.0e-97
AUV95215.1|2230662_2230896_-	hypothetical protein	NA	NA	NA	NA	NA
AUV91568.1|2231618_2232083_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.7	2.1e-35
AUV91569.1|2232182_2232416_+	XRE family transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	44.4	2.9e-09
AUV91570.1|2232478_2232925_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.4	1.7e-26
AUV91571.1|2233008_2233167_+	adenylate cyclase	NA	NA	NA	NA	NA
AUV95216.1|2233184_2234129_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.5	1.9e-35
AUV95217.1|2234137_2235532_+	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	46.7	2.4e-103
AUV91572.1|2235570_2236239_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91573.1|2236242_2236476_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91574.1|2236621_2237227_+	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	84.7	2.0e-94
AUV91575.1|2237312_2238086_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91576.1|2238087_2238426_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	81.1	1.5e-46
AUV91577.1|2238608_2238800_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91578.1|2238868_2239465_+	DUF1367 domain-containing protein	NA	H9C173	Pectobacterium_phage	71.7	3.6e-80
AUV91579.1|2239454_2239778_+	DUF968 domain-containing protein	NA	A0A2H4FS95	Methylophilaceae_phage	52.9	3.7e-23
AUV91580.1|2239765_2240122_+	enterotoxin	NA	NA	NA	NA	NA
AUV91581.1|2240118_2240412_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	72.2	7.5e-31
AUV91582.1|2240481_2240715_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91583.1|2240698_2240959_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91584.1|2240965_2241418_+	DNA-packaging protein	NA	A3EYX3	Salmonella_phage	67.2	1.9e-49
AUV91585.1|2241502_2242897_+	hypothetical protein	NA	A0A0H5ARR1	Pseudomonas_phage	46.4	6.1e-46
AUV91586.1|2242896_2244561_+|head,tail	phage head-tail adapter protein	head,tail	A0A221SAN2	Ralstonia_phage	39.3	6.9e-105
AUV91587.1|2244563_2244887_+	GTP-binding protein	NA	NA	NA	NA	NA
AUV91588.1|2244873_2245626_+	hypothetical protein	NA	M1I7K2	Pelagibacter_phage	24.0	4.8e-05
AUV91589.1|2245636_2246632_+	hypothetical protein	NA	W6MW28	Pseudomonas_phage	59.9	1.0e-103
AUV91590.1|2246670_2247144_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	39.2	2.3e-13
2246784:2246798	attR	TGCGGGCGCTGGCGA	NA	NA	NA	NA
AUV91591.1|2247205_2247811_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91592.1|2247810_2250087_+	hypothetical protein	NA	A0A221SAL7	Ralstonia_phage	27.6	9.9e-70
>prophage 7
CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	2389670	2439740	6252643	integrase,plate,portal,tRNA,tail,capsid,terminase	Enterobacteria_phage(44.12%)	60	2398382:2398399	2419983:2420000
AUV91716.1|2389670_2390366_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AUV91717.1|2390409_2390994_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91718.1|2391202_2392888_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	4.2e-33
AUV91719.1|2392957_2394085_+	ribonuclease D	NA	NA	NA	NA	NA
AUV91720.1|2394149_2394419_-	cell division topological specificity factor	NA	NA	NA	NA	NA
AUV91721.1|2394422_2395235_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
AUV91722.1|2395258_2395957_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
AUV91723.1|2396083_2396365_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91724.1|2396382_2397042_+	isomerase/hydrolase	NA	NA	NA	NA	NA
AUV91725.1|2397121_2397583_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
AUV91726.1|2397591_2397936_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
AUV91727.1|2398052_2398583_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
2398382:2398399	attL	GCGATTTTGGCGCAATGG	NA	NA	NA	NA
AUV95229.1|2398711_2400265_-	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
AUV91728.1|2400510_2401230_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
AUV91729.1|2401290_2402823_-	SpoVR family protein	NA	NA	NA	NA	NA
AUV91730.1|2403144_2404443_+	D-amino acid dehydrogenase small subunit	NA	NA	NA	NA	NA
AUV91731.1|2404455_2405526_+	alanine racemase	NA	NA	NA	NA	NA
AUV95230.1|2405661_2405853_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95231.1|2405953_2406328_-	hypothetical protein	NA	NA	NA	NA	NA
AUV91732.1|2406344_2407340_-|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	47.1	1.6e-80
AUV91733.1|2407404_2407704_-	XRE family transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	56.2	1.0e-22
AUV91734.1|2407785_2408052_+	DNA-binding protein	NA	NA	NA	NA	NA
AUV95232.1|2408081_2408294_+	DUF4761 domain-containing protein	NA	NA	NA	NA	NA
AUV91735.1|2408306_2408546_+	hypothetical protein	NA	NA	NA	NA	NA
AUV95233.1|2408548_2408821_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91736.1|2409115_2409694_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	40.0	1.9e-33
AUV91737.1|2409704_2410658_+	adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	56.6	3.7e-87
AUV91738.1|2410657_2410927_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91739.1|2411057_2412074_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	54.9	7.2e-97
AUV91740.1|2412066_2414676_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.2	4.3e-194
AUV95234.1|2415002_2415209_+	hypothetical protein	NA	I7LEF4	Yersinia_phage	56.9	1.9e-12
AUV91741.1|2415310_2416006_+	DNA methylase	NA	A0A0M4S5U3	Salmonella_phage	71.1	1.0e-89
AUV91742.1|2416124_2416478_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91743.1|2416877_2417930_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.1	5.5e-140
AUV91744.1|2417929_2419651_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	66.0	6.2e-226
AUV91745.1|2419810_2420644_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	64.1	5.5e-95
2419983:2420000	attR	GCGATTTTGGCGCAATGG	NA	NA	NA	NA
AUV91746.1|2420668_2421718_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	54.5	5.1e-106
AUV95235.1|2421765_2422686_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	74.7	2.7e-87
AUV91747.1|2422788_2423286_+|capsid	capsid assembly protein	capsid	B9A7B7	Serratia_phage	70.9	3.4e-60
AUV91748.1|2423285_2423486_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	66.2	1.8e-15
AUV91749.1|2423476_2423758_+	hypothetical protein	NA	B9A7B8	Serratia_phage	58.4	7.5e-20
AUV91750.1|2423754_2424306_+	lysozyme	NA	A0A0H4TH14	Yersinia_phage	43.8	4.9e-31
AUV91751.1|2424546_2424846_+	peptidase	NA	NA	NA	NA	NA
AUV91752.1|2424842_2425304_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	47.7	1.5e-33
AUV91753.1|2425300_2425942_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	48.3	7.6e-44
AUV91754.1|2425941_2426526_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	62.4	1.9e-62
AUV91755.1|2426522_2426888_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	59.1	6.1e-30
AUV91756.1|2426874_2427774_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	59.2	8.4e-89
AUV91757.1|2427766_2428363_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	50.9	5.1e-42
AUV91758.1|2430475_2430730_+	hypothetical protein	NA	K4MPX1	Escherichia_phage	36.1	1.5e-06
AUV91759.1|2430795_2431956_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	47.7	1.3e-41
AUV91760.1|2432053_2432542_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	61.7	1.8e-53
AUV91761.1|2432556_2435502_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	44.2	1.9e-206
AUV95236.1|2435482_2435659_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	66.7	5.2e-11
AUV91762.1|2435655_2435955_-|tail	phage tail protein	tail	B9A7B2	Serratia_phage	76.8	1.6e-33
AUV91763.1|2436009_2436525_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.2	6.9e-64
AUV91764.1|2436524_2437706_-|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.3	5.2e-155
AUV91765.1|2437859_2439014_+	hypothetical protein	NA	B9A7A9	Serratia_phage	82.2	9.1e-181
AUV91766.1|2439058_2439307_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91767.1|2439353_2439740_-	hypothetical protein	NA	B9A7A8	Serratia_phage	54.1	3.6e-33
>prophage 8
CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	2662376	2699193	6252643	transposase,plate,protease	uncultured_Caudovirales_phage(25.0%)	31	NA	NA
AUV91952.1|2662376_2663717_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AUV91953.1|2663713_2664403_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AUV91954.1|2664399_2666109_+	OmpA family protein	NA	NA	NA	NA	NA
AUV91955.1|2666114_2666606_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUV91956.1|2666892_2667258_+|protease	Clp protease	protease	NA	NA	NA	NA
AUV91957.1|2667254_2669597_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.1	3.9e-05
AUV91958.1|2669596_2670469_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91959.1|2670493_2673631_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91960.1|2673642_2674449_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91961.1|2674482_2675292_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91962.1|2675325_2676126_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91963.1|2676159_2676960_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91964.1|2676993_2677803_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91965.1|2677838_2679113_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91966.1|2679109_2682580_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
AUV91967.1|2682866_2683094_+	hypothetical protein	NA	NA	NA	NA	NA
AUV91968.1|2683069_2683348_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
AUV91969.1|2683447_2685202_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AUV91970.1|2685165_2686251_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AUV91971.1|2686228_2686774_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AUV91972.1|2687277_2688366_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV91973.1|2688437_2690207_+	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AUV91974.1|2690199_2691270_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	9.8e-28
AUV91975.1|2691326_2692097_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUV91976.1|2692120_2693800_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
AUV91977.1|2693810_2694590_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
AUV91978.1|2694696_2695569_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.3e-05
AUV91979.1|2695597_2695810_-	cold-shock protein	NA	NA	NA	NA	NA
AUV91980.1|2696573_2696744_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AUV91981.1|2696880_2697906_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV91982.1|2698224_2699193_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	1.0e-180
>prophage 9
CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	3352796	3444781	6252643	holin,plate,tRNA,tail,transposase,protease	Enterobacteria_phage(17.24%)	81	NA	NA
AUV92565.1|3352796_3355694_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AUV92566.1|3355788_3356394_+	DNA resolvase	NA	A0A1W5LU24	Ralstonia_phage	31.2	8.6e-13
AUV92567.1|3356395_3357334_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
AUV92568.1|3357334_3357658_-	DUF1318 domain-containing protein	NA	NA	NA	NA	NA
AUV92569.1|3357665_3357851_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
AUV92570.1|3357850_3360490_-	YdbH family protein	NA	NA	NA	NA	NA
AUV92571.1|3360685_3361183_+	DedA family protein	NA	NA	NA	NA	NA
AUV92572.1|3361332_3362322_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.7	1.9e-70
AUV92573.1|3362447_3362888_+	META domain-containing protein	NA	NA	NA	NA	NA
AUV92574.1|3362884_3363157_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AUV95274.1|3363442_3370141_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	84.0	2.0e-142
AUV92575.1|3370203_3370818_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	70.1	5.5e-68
AUV92576.1|3370985_3371720_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	83.6	5.3e-126
AUV92577.1|3371721_3372474_-|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	76.7	2.5e-115
AUV92578.1|3372470_3372818_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	60.9	5.4e-36
AUV92579.1|3372840_3373950_-|tail	phage tail tape measure protein	tail	I6PCW3	Cronobacter_phage	48.5	5.9e-52
AUV92580.1|3374034_3374280_-	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	41.2	6.1e-10
AUV92581.1|3374342_3374654_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	62.1	1.5e-32
AUV92582.1|3374726_3375389_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	65.0	7.0e-77
AUV92583.1|3375508_3375928_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	51.5	9.4e-35
AUV92584.1|3375983_3376526_-	hypothetical protein	NA	A0A0U2I1S0	Escherichia_phage	66.7	6.8e-70
AUV92585.1|3376533_3376806_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	54.2	7.0e-15
AUV92586.1|3376795_3377188_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	66.2	1.3e-38
AUV92587.1|3377264_3377627_-	antitermination protein	NA	C6ZR44	Salmonella_phage	58.3	5.4e-31
AUV95275.1|3378088_3378625_-	phage repressor protein	NA	K7PKK1	Enterobacteria_phage	49.7	5.2e-30
AUV92588.1|3379259_3382787_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
AUV92589.1|3383144_3384251_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	57.1	4.2e-106
AUV92590.1|3384404_3384617_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
AUV92591.1|3384699_3385134_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.2e-30
AUV92592.1|3385322_3385613_+	lipoprotein bor	NA	C6ZCX3	Enterobacteria_phage	66.0	9.7e-31
AUV92593.1|3385720_3385954_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95276.1|3386016_3386955_-|protease	outer membrane protease PgtE	protease	NA	NA	NA	NA
AUV92594.1|3387766_3388702_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.4	7.0e-139
AUV92595.1|3388746_3390120_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	6.8e-50
AUV92596.1|3390603_3391587_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AUV92597.1|3391929_3392550_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUV92598.1|3393166_3393910_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.6	1.1e-14
AUV95277.1|3393926_3394994_+	oxidoreductase	NA	NA	NA	NA	NA
AUV92599.1|3395066_3396332_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	66.4	1.0e-156
AUV92600.1|3396331_3396754_-	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	50.4	4.4e-32
AUV92601.1|3397041_3397236_+	hypothetical protein	NA	NA	NA	NA	NA
AUV92602.1|3397392_3397584_+	hypothetical protein	NA	NA	NA	NA	NA
AUV92603.1|3397761_3398076_+	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
AUV92604.1|3398130_3398694_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
AUV92605.1|3398890_3399472_-	hypothetical protein	NA	NA	NA	NA	NA
AUV92606.1|3399597_3400227_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AUV92607.1|3400389_3400608_+	hypothetical protein	NA	NA	NA	NA	NA
AUV92608.1|3400596_3400785_-	cold-shock protein	NA	NA	NA	NA	NA
AUV92609.1|3401623_3402649_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUV92610.1|3402843_3403674_+	oxidoreductase	NA	NA	NA	NA	NA
AUV92611.1|3403718_3404699_-	nitronate monooxygenase	NA	NA	NA	NA	NA
AUV92612.1|3404857_3405754_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUV92613.1|3405854_3406739_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUV92614.1|3406910_3408047_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUV92615.1|3408255_3409377_+	MFS transporter	NA	NA	NA	NA	NA
AUV95278.1|3409474_3409819_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
AUV92616.1|3409919_3410645_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.4	3.5e-45
AUV92617.1|3410887_3411322_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AUV92618.1|3411318_3412038_+	KR domain-containing protein	NA	NA	NA	NA	NA
AUV92619.1|3412034_3413294_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUV92620.1|3413295_3414018_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
AUV92621.1|3414014_3415238_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUV92622.1|3415234_3415768_+	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
AUV92623.1|3415782_3416742_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AUV92624.1|3416805_3418188_-	carbohydrate porin	NA	NA	NA	NA	NA
AUV92625.1|3419068_3420523_+	MFS transporter	NA	NA	NA	NA	NA
AUV92626.1|3420577_3422257_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
AUV92627.1|3422419_3423754_-	hypothetical protein	NA	NA	NA	NA	NA
AUV92628.1|3423777_3424233_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AUV92629.1|3424234_3424774_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AUV92630.1|3424751_3425837_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AUV92631.1|3425800_3427561_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AUV95279.1|3427781_3431015_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AUV92632.1|3431156_3432590_-	hypothetical protein	NA	NA	NA	NA	NA
AUV92633.1|3432589_3432850_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AUV92634.1|3432851_3434819_-	hypothetical protein	NA	A0A077K801	Ralstonia_phage	32.4	5.0e-62
AUV92635.1|3437564_3440207_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.5	1.1e-96
AUV92636.1|3440454_3440946_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUV92637.1|3441090_3442779_-	OmpA family protein	NA	NA	NA	NA	NA
AUV92638.1|3442775_3443441_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AUV92639.1|3443437_3444781_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 10
CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	3447900	3491295	6252643	head,holin,plate,tail,portal,capsid,protease,terminase	Klebsiella_phage(28.57%)	58	NA	NA
AUV92642.1|3447900_3448149_+	damage-inducible protein DinI	NA	S5MQI1	Escherichia_phage	70.4	1.0e-25
AUV92643.1|3448543_3448966_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	1.9e-27
AUV92644.1|3449163_3449481_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	62.5	4.0e-30
AUV92645.1|3449482_3449722_-	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.7	7.5e-21
AUV92646.1|3449828_3451229_-	hypothetical protein	NA	W6E8G0	Rhizobium_phage	30.5	4.0e-13
AUV92647.1|3451231_3453388_-	hypothetical protein	NA	A0A248XD04	Klebsiella_phage	63.8	6.4e-10
AUV92648.1|3453521_3454193_-	hypothetical protein	NA	NA	NA	NA	NA
AUV92649.1|3454232_3454901_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
AUV92650.1|3454897_3456046_-|plate	phage baseplate protein	plate	R9TN81	Rhizobium_phage	25.5	1.4e-19
AUV92651.1|3456035_3456485_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	45.1	1.7e-18
AUV95281.1|3456481_3457021_-|plate	baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	37.8	1.4e-11
AUV92652.1|3457056_3458133_-|tail	phage tail protein	tail	Q8SBG7	Shigella_phage	31.3	1.4e-37
AUV92653.1|3458129_3459530_-	hypothetical protein	NA	NA	NA	NA	NA
AUV92654.1|3459598_3459988_-	hypothetical protein	NA	NA	NA	NA	NA
AUV92655.1|3460060_3461830_-	hypothetical protein	NA	I6ZXX9	Escherichia_phage	48.5	2.5e-28
AUV92656.1|3461974_3462253_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AUV92657.1|3462256_3462625_-|tail	phage tail protein	tail	NA	NA	NA	NA
AUV92658.1|3462628_3464146_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	43.8	1.7e-105
AUV92659.1|3464146_3464326_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AUV92660.1|3464329_3464875_-	ATP-binding protein	NA	NA	NA	NA	NA
AUV92661.1|3464871_3465231_-	hypothetical protein	NA	NA	NA	NA	NA
AUV92662.1|3465236_3465605_-	hypothetical protein	NA	NA	NA	NA	NA
AUV92663.1|3465606_3466656_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	2.1e-51
AUV92664.1|3466753_3467158_-|head	head decoration protein	head	NA	NA	NA	NA
AUV92665.1|3467737_3468607_-	S49 family peptidase	NA	K4I1N3	Providencia_phage	39.4	4.6e-52
AUV92666.1|3468603_3470241_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.8	1.4e-89
AUV92667.1|3470240_3470504_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AUV92668.1|3470512_3472636_-|terminase	terminase	terminase	A0A0C5ABH4	Bacteriophage	34.4	4.4e-96
AUV92669.1|3472577_3473141_-	hypothetical protein	NA	NA	NA	NA	NA
AUV92670.1|3473457_3473964_+	hypothetical protein	NA	NA	NA	NA	NA
AUV92671.1|3473995_3474634_-	hypothetical protein	NA	NA	NA	NA	NA
AUV92672.1|3475423_3475609_-	hypothetical protein	NA	NA	NA	NA	NA
AUV92673.1|3475682_3475886_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	81.0	8.3e-21
AUV92674.1|3475836_3476112_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	35.6	3.0e-05
AUV92675.1|3476108_3476453_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	84.2	2.9e-42
AUV92676.1|3476449_3476992_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	77.0	1.7e-76
AUV92677.1|3476988_3477300_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	98.0	2.7e-47
AUV92678.1|3477907_3478405_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	50.3	4.7e-33
AUV92679.1|3478693_3479509_-	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	75.3	2.3e-109
AUV92680.1|3479505_3479814_-	hypothetical protein	NA	NA	NA	NA	NA
AUV92681.1|3479815_3481687_-	bifunctional DNA primase/helicase	NA	I6S1U6	Salmonella_phage	59.7	1.3e-224
AUV92682.1|3481790_3482708_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	47.1	1.9e-35
AUV92683.1|3482704_3482902_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AUV92684.1|3482903_3483137_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	63.9	9.9e-18
AUV95282.1|3483282_3483957_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	79.5	3.9e-99
AUV92685.1|3484119_3484533_+	hypothetical protein	NA	NA	NA	NA	NA
AUV92686.1|3484712_3484922_+	hypothetical protein	NA	NA	NA	NA	NA
AUV92687.1|3484962_3485250_+	hypothetical protein	NA	NA	NA	NA	NA
AUV92688.1|3485242_3485455_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	73.4	5.6e-20
AUV92689.1|3485641_3486073_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	92.1	4.6e-69
AUV95283.1|3486116_3486644_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	83.6	1.6e-76
AUV92690.1|3486649_3487357_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	86.3	3.8e-105
AUV92691.1|3487346_3487784_+	hypothetical protein	NA	NA	NA	NA	NA
AUV92692.1|3487767_3487992_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	55.4	2.8e-17
AUV92693.1|3488145_3488337_+	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	78.7	2.3e-20
AUV92694.1|3488317_3489499_-	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	84.4	2.0e-199
AUV92695.1|3489688_3490240_+|protease	protease	protease	NA	NA	NA	NA
AUV92696.1|3490518_3491295_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.4	3.9e-34
>prophage 11
CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	3946655	4002663	6252643	tRNA,transposase,protease	Bacillus_phage(20.0%)	38	NA	NA
AUV93102.1|3946655_3947636_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
AUV93103.1|3947758_3948964_-	secretion protein HlyD	NA	NA	NA	NA	NA
AUV93104.1|3948960_3951108_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	25.1	1.6e-24
AUV93105.1|3951104_3952541_-	transporter	NA	NA	NA	NA	NA
AUV93106.1|3952708_3963472_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95312.1|3964074_3964488_-	CoA-binding protein	NA	NA	NA	NA	NA
AUV93107.1|3964642_3965101_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AUV93108.1|3965129_3967184_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.9	2.3e-17
AUV95313.1|3967306_3967753_+	YccF domain-containing protein	NA	NA	NA	NA	NA
AUV93109.1|3967770_3969906_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AUV93110.1|3969893_3970517_-	competence protein	NA	NA	NA	NA	NA
AUV93111.1|3970852_3971878_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV93112.1|3972196_3973165_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.5e-184
AUV93113.1|3973459_3974485_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV93114.1|3974793_3975303_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
AUV93115.1|3975223_3975457_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95314.1|3975656_3976727_+	porin OmpA	NA	NA	NA	NA	NA
AUV93116.1|3976829_3977282_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
AUV93117.1|3977467_3979225_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AUV93118.1|3979294_3979813_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
AUV93119.1|3979877_3980045_-	ribosome modulation factor	NA	NA	NA	NA	NA
AUV93120.1|3980006_3980234_+	hypothetical protein	NA	NA	NA	NA	NA
AUV93121.1|3980300_3980864_-	hypothetical protein	NA	NA	NA	NA	NA
AUV93122.1|3980863_3982501_-	paraquat-inducible protein B	NA	NA	NA	NA	NA
AUV93123.1|3982490_3983759_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AUV93124.1|3983773_3985681_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	5.6e-50
AUV93125.1|3985693_3987799_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
AUV93126.1|3987897_3989007_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AUV93127.1|3989003_3989546_-	cell division protein ZapC	NA	NA	NA	NA	NA
AUV93128.1|3989714_3990725_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AUV93129.1|3990973_3991549_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
AUV93130.1|3991605_3992397_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
AUV93131.1|3992393_3993167_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.0	8.1e-32
AUV93132.1|3993232_3995848_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
AUV95315.1|3996175_3997378_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.1	6.4e-44
AUV93133.1|3997681_3999082_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.0	5.0e-80
AUV93134.1|4000946_4002137_+	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AUV93135.1|4002228_4002663_-|transposase	IS200/IS605 family transposase	transposase	W0UUZ0	Sulfolobus_monocaudavirus	37.8	1.2e-19
>prophage 12
CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	4103193	4158504	6252643	portal,tail,transposase,protease,terminase	Enterobacterial_phage(16.67%)	66	NA	NA
AUV93216.1|4103193_4103679_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	2.3e-61
AUV93217.1|4105349_4105745_-	hypothetical protein	NA	NA	NA	NA	NA
AUV93218.1|4105747_4106674_-	cobyrinic acid a,c-diamide synthase	NA	E9LUK9	Lactobacillus_phage	28.5	7.9e-18
AUV93219.1|4106713_4106896_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95321.1|4107238_4107658_+	bacteriophage CI repressor	NA	A0A1S6KZZ7	Salmonella_phage	46.9	6.1e-26
AUV93220.1|4107698_4108679_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
AUV93221.1|4110098_4110680_+	hypothetical protein	NA	NA	NA	NA	NA
AUV93222.1|4110849_4111392_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUV93223.1|4111574_4112777_+	MFS transporter	NA	NA	NA	NA	NA
AUV93224.1|4112776_4113592_+	HAD family hydrolase	NA	NA	NA	NA	NA
AUV93225.1|4113639_4114875_-	multidrug transporter MdfA	NA	NA	NA	NA	NA
AUV93226.1|4115193_4115787_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
AUV93227.1|4115912_4116671_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.2	2.0e-11
AUV93228.1|4116702_4117905_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	46.7	2.7e-95
AUV93229.1|4118271_4118589_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.9	6.2e-23
AUV93230.1|4118762_4120016_+|tail	phage tail protein	tail	A0A1J0MHZ5	Klebsiella_phage	44.4	1.9e-86
AUV93231.1|4120016_4121222_-	polymerase	NA	NA	NA	NA	NA
AUV93232.1|4121586_4123020_-	hypothetical protein	NA	A0A1D8KLY0	Synechococcus_phage	30.3	9.4e-18
AUV93233.1|4123189_4125202_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	71.6	3.7e-52
AUV93234.1|4125279_4128345_-	kinase	NA	A0A286S259	Klebsiella_phage	69.5	0.0e+00
AUV93235.1|4128341_4128722_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	50.8	1.1e-34
AUV93236.1|4128729_4129212_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	65.2	3.6e-54
AUV93237.1|4129198_4129672_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	57.8	7.6e-49
AUV93238.1|4129671_4132368_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	59.0	8.9e-195
AUV93239.1|4132348_4132666_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	5.5e-19
AUV93240.1|4132686_4133085_-|tail	phage tail protein	tail	NA	NA	NA	NA
AUV93241.1|4133127_4133610_-|tail	phage tail protein	tail	O64327	Escherichia_phage	68.2	1.8e-58
AUV93242.1|4133617_4134016_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.2	8.3e-41
AUV93243.1|4134012_4134564_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	66.0	4.5e-53
AUV93244.1|4134553_4134847_-	ATP-binding protein	NA	NA	NA	NA	NA
AUV93245.1|4134839_4135166_-	DUF2190 domain-containing protein	NA	K7PJY3	Enterobacterial_phage	66.4	1.8e-33
AUV93246.1|4135247_4137263_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	83.9	0.0e+00
AUV93247.1|4137207_4138707_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.6	1.1e-247
AUV93248.1|4138703_4138919_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	78.6	4.5e-25
AUV93249.1|4138915_4141024_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	82.8	0.0e+00
AUV93250.1|4141023_4141515_-	DUF1441 domain-containing protein	NA	K7PJY2	Enterobacterial_phage	85.3	7.6e-68
AUV95322.1|4141872_4142133_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AUV95323.1|4142750_4142837_+	ABC transporter	NA	NA	NA	NA	NA
AUV93251.1|4142875_4143856_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
AUV93252.1|4144861_4145470_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	60.2	9.0e-71
AUV93253.1|4145603_4146245_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	76.1	1.8e-85
AUV93254.1|4146519_4146825_-	DUF968 domain-containing protein	NA	A0A2I7R8F9	Vibrio_phage	56.5	2.1e-23
AUV93255.1|4147003_4147273_-	hypothetical protein	NA	H6WRY4	Salmonella_phage	72.7	1.6e-32
AUV93256.1|4147346_4147664_-	hypothetical protein	NA	NA	NA	NA	NA
AUV93257.1|4147656_4147845_-	hypothetical protein	NA	R9TNE4	Aeromonas_phage	75.0	4.2e-19
AUV93258.1|4147844_4148042_-	hypothetical protein	NA	NA	NA	NA	NA
AUV93259.1|4148034_4148520_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	51.1	1.9e-10
AUV93260.1|4148516_4149131_-	hypothetical protein	NA	Q8HAA6	Salmonella_phage	66.0	3.4e-09
AUV93261.1|4149127_4149508_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	92.6	3.7e-62
AUV93262.1|4149966_4150176_-	hypothetical protein	NA	NA	NA	NA	NA
AUV93263.1|4150172_4150376_-	hypothetical protein	NA	A0A2P1JU43	Erwinia_phage	50.0	3.6e-08
AUV93264.1|4150369_4150831_-	hypothetical protein	NA	NA	NA	NA	NA
AUV93265.1|4150827_4151613_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	1.2e-62
AUV93266.1|4151605_4151818_-	hypothetical protein	NA	NA	NA	NA	NA
AUV93267.1|4151814_4152108_-	hypothetical protein	NA	NA	NA	NA	NA
AUV93268.1|4152120_4153197_-	hypothetical protein	NA	U5P0A0	Shigella_phage	36.2	9.5e-23
AUV93269.1|4153193_4153448_-	hypothetical protein	NA	NA	NA	NA	NA
AUV93270.1|4153462_4153876_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	69.8	3.2e-43
AUV93271.1|4153934_4154147_-	transcriptional regulator	NA	NA	NA	NA	NA
AUV93272.1|4154255_4154852_+	XRE family transcriptional regulator	NA	K7P850	Enterobacteria_phage	27.1	3.7e-08
AUV93273.1|4155190_4155514_+	hypothetical protein	NA	NA	NA	NA	NA
AUV93274.1|4155484_4155778_-	DUF2622 domain-containing protein	NA	NA	NA	NA	NA
AUV93275.1|4156251_4156545_+	hypothetical protein	NA	NA	NA	NA	NA
AUV93276.1|4156886_4157111_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	59.5	1.4e-16
AUV93277.1|4157107_4157803_+	hypothetical protein	NA	R9VWB9	Serratia_phage	59.5	4.2e-72
AUV93278.1|4157799_4158504_+	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	32.6	3.0e-25
>prophage 13
CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	4248348	4284157	6252643	transposase,head,plate,tail	Pseudomonas_phage(41.18%)	50	NA	NA
AUV93353.1|4248348_4248975_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	41.2	4.1e-34
AUV93354.1|4248974_4249718_-|tail	phage tail protein	tail	A0A060BN58	Escherichia_phage	57.1	6.2e-21
AUV93355.1|4249729_4250386_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	39.3	3.1e-32
AUV93356.1|4250382_4251444_-|tail	phage tail protein	tail	A0A0M3LQN4	Mannheimia_phage	50.1	1.1e-79
AUV93357.1|4251443_4251800_-	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	55.1	3.0e-26
AUV93358.1|4251865_4252447_-|plate	phage baseplate assembly protein V	plate	F6MIL4	Haemophilus_phage	51.2	1.7e-34
AUV93359.1|4252430_4253675_-|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	34.9	7.0e-70
AUV93360.1|4253658_4254972_-	multidrug DMT transporter permease	NA	A0A0M3LQ21	Mannheimia_phage	21.8	1.6e-24
AUV93361.1|4254971_4257194_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	36.5	2.8e-77
AUV95328.1|4257313_4257556_-	hypothetical protein	NA	NA	NA	NA	NA
AUV93362.1|4257717_4258092_-|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	52.5	8.4e-27
AUV93363.1|4258103_4259522_-|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	44.8	3.2e-87
AUV93364.1|4259521_4259719_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AUV93365.1|4259708_4260359_-	DUF1834 domain-containing protein	NA	NA	NA	NA	NA
AUV93366.1|4260355_4260784_-	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
AUV93367.1|4260796_4261249_-	hypothetical protein	NA	NA	NA	NA	NA
AUV93368.1|4261249_4262158_-|head	head protein	head	H1ZZF0	Pseudomonas_virus	56.3	6.4e-97
AUV93369.1|4262169_4262565_-	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	50.8	1.8e-24
AUV93370.1|4262557_4263643_-	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	39.9	4.6e-49
AUV93371.1|4263877_4264423_-	phage virion morphogenesis protein	NA	A0A2D1GNX5	Pseudomonas_phage	31.5	1.0e-09
AUV93372.1|4264412_4265684_-|head	phage head morphogenesis protein	head	H6V8N8	Pseudomonas_phage	36.0	1.2e-51
AUV93373.1|4265676_4267245_-	DUF935 domain-containing protein	NA	A0A1C6ZDK1	Pseudomonas_phage	46.3	1.3e-124
AUV93374.1|4267244_4268945_-	hypothetical protein	NA	H6V8N6	Pseudomonas_phage	64.7	6.7e-196
AUV93375.1|4268947_4269277_-	ammonia monooxygenase	NA	G8GWD9	Rhodobacter_phage	65.6	3.8e-31
AUV93376.1|4269280_4269484_-	hypothetical protein	NA	NA	NA	NA	NA
AUV93377.1|4269524_4270013_+	hypothetical protein	NA	NA	NA	NA	NA
AUV93378.1|4270057_4270558_-	DUF1804 domain-containing protein	NA	A0A0A1IX73	Pseudomonas_phage	53.6	2.8e-46
AUV93379.1|4270559_4270874_-	hypothetical protein	NA	NA	NA	NA	NA
AUV93380.1|4270870_4271116_-	hypothetical protein	NA	NA	NA	NA	NA
AUV93381.1|4271112_4271748_-	hypothetical protein	NA	NA	NA	NA	NA
AUV93382.1|4271737_4271986_-	DUF2644 domain-containing protein	NA	NA	NA	NA	NA
AUV93383.1|4271967_4272621_-	glycoside hydrolase family 19	NA	A0A2D1GNI0	Pseudomonas_phage	57.1	1.3e-59
AUV93384.1|4272701_4273229_-	hypothetical protein	NA	NA	NA	NA	NA
AUV93385.1|4273244_4273679_-	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	45.6	3.4e-27
AUV93386.1|4273623_4274100_-	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	63.7	8.2e-43
AUV93387.1|4274160_4274376_-	hypothetical protein	NA	A0A2D1GNS9	Pseudomonas_phage	63.4	1.3e-19
AUV93388.1|4274996_4275674_-	hypothetical protein	NA	A0A076G7C3	Sinorhizobium_phage	36.3	3.6e-28
AUV93389.1|4275822_4276362_-	hypothetical protein	NA	A0A2D1GNL9	Pseudomonas_phage	69.8	2.9e-60
AUV93390.1|4276358_4276583_-	hypothetical protein	NA	A0A2D1GNI2	Pseudomonas_phage	52.8	9.8e-15
AUV93391.1|4276756_4277128_-	hypothetical protein	NA	A0A1X9SG60	Bacillus_phage	48.3	2.1e-22
AUV93392.1|4277200_4277389_-	hypothetical protein	NA	NA	NA	NA	NA
AUV93393.1|4277390_4278029_-	DUF3164 domain-containing protein	NA	Q6QIE4	Burkholderia_phage	60.1	1.3e-67
AUV93394.1|4278021_4278213_-	hypothetical protein	NA	NA	NA	NA	NA
AUV93395.1|4278214_4278448_-	hypothetical protein	NA	NA	NA	NA	NA
AUV93396.1|4278466_4278685_-	hypothetical protein	NA	NA	NA	NA	NA
AUV93397.1|4278693_4279587_-	ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	59.8	3.0e-99
AUV93398.1|4279597_4281649_-|transposase	transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	48.8	5.2e-171
AUV93399.1|4281672_4281936_-	Nlp family transcriptional regulator	NA	A0A2P9JZG5	Alteromonadaceae_phage	62.7	1.2e-24
AUV93400.1|4282113_4282848_+	XRE family transcriptional regulator	NA	A5X9F5	Aeromonas_virus	38.5	4.2e-30
AUV93401.1|4283251_4284157_+	hypothetical protein	NA	A1IMD5	Streptococcus_phage	27.7	4.1e-27
>prophage 14
CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	5817521	5848989	6252643	transposase	Salmonella_phage(33.33%)	26	NA	NA
AUV94728.1|5817521_5818502_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
AUV95392.1|5818540_5818666_-	ABC transporter	NA	NA	NA	NA	NA
AUV94729.1|5819187_5819877_-	LrgB family protein	NA	NA	NA	NA	NA
AUV94730.1|5819869_5820280_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
AUV94731.1|5820383_5821265_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUV94732.1|5821313_5822960_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
AUV94733.1|5823107_5824457_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.8	6.7e-159
AUV94734.1|5824608_5824809_+	hypothetical protein	NA	NA	NA	NA	NA
AUV94735.1|5824845_5825514_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUV94736.1|5825771_5826230_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
AUV94737.1|5826314_5826644_+	DNA-binding transcriptional regulator SoxS	NA	NA	NA	NA	NA
AUV94738.1|5826628_5828233_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AUV94739.1|5828776_5829058_+	hypothetical protein	NA	NA	NA	NA	NA
AUV94740.1|5829214_5829604_-	anti-adapter protein IraM	NA	NA	NA	NA	NA
AUV94741.1|5829923_5832347_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AUV94742.1|5832792_5833143_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUV94743.1|5833412_5835674_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUV94744.1|5836269_5837847_+	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	2.4e-06
AUV94745.1|5838131_5838377_-	hypothetical protein	NA	NA	NA	NA	NA
AUV94746.1|5838481_5839754_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	3.0e-169
AUV94747.1|5840345_5841371_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV94748.1|5841665_5842634_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	1.0e-180
AUV94749.1|5842952_5843978_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV94750.1|5844285_5844606_+	hypothetical protein	NA	J9Q750	Salmonella_phage	51.9	9.1e-30
AUV94751.1|5845644_5847678_-	alpha-amylase	NA	NA	NA	NA	NA
AUV94752.1|5847963_5848989_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 15
CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	6067927	6151755	6252643	integrase,plate,tRNA,tail,portal,capsid,protease,terminase	Enterobacteria_phage(35.9%)	84	6114631:6114672	6147510:6147551
AUV94937.1|6067927_6069448_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AUV94938.1|6069471_6069810_-	DUF413 domain-containing protein	NA	NA	NA	NA	NA
AUV94939.1|6069928_6070750_+	HTH-type transcriptional regulator HdfR	NA	NA	NA	NA	NA
AUV94940.1|6076740_6077595_-	glutamate racemase	NA	NA	NA	NA	NA
AUV95406.1|6077539_6079408_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	27.7	2.8e-06
AUV94941.1|6079772_6080873_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
AUV94942.1|6080918_6081278_-	hypothetical protein	NA	NA	NA	NA	NA
AUV94943.1|6081293_6081929_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
AUV94944.1|6082125_6083526_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AUV94945.1|6083508_6084426_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
AUV94946.1|6084425_6084629_-	hypothetical protein	NA	NA	NA	NA	NA
AUV94947.1|6084693_6086067_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AUV94948.1|6086144_6086921_-	acetylglutamate kinase	NA	NA	NA	NA	NA
AUV94949.1|6086927_6087932_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AUV94950.1|6088116_6089268_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
AUV94951.1|6089521_6092173_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AUV94952.1|6092266_6092914_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
AUV94953.1|6093065_6093929_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUV94954.1|6094134_6094797_+	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	3.5e-28
AUV94955.1|6094852_6095956_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
AUV94956.1|6096084_6096834_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	34.1	6.0e-24
AUV94957.1|6096956_6097844_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AUV94958.1|6098010_6098916_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUV94959.1|6099006_6099378_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUV94960.1|6099417_6101850_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
AUV94961.1|6101852_6103013_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AUV94962.1|6103279_6103597_+	met repressor	NA	NA	NA	NA	NA
AUV94963.1|6103694_6103910_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
AUV94964.1|6104140_6106336_+	primosomal protein N'	NA	NA	NA	NA	NA
AUV94965.1|6106486_6107515_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
AUV94966.1|6107606_6108572_+	cell division protein FtsN	NA	NA	NA	NA	NA
AUV94967.1|6108662_6109193_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AUV94968.1|6109202_6110537_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	30.3	1.1e-44
AUV94969.1|6110686_6110902_-	hypothetical protein	NA	NA	NA	NA	NA
AUV94970.1|6110921_6111848_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AUV94971.1|6111940_6112426_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AUV94972.1|6112485_6113448_-	6-phosphofructokinase	NA	NA	NA	NA	NA
AUV94973.1|6113650_6114547_-	cation-efflux pump FieF	NA	NA	NA	NA	NA
6114631:6114672	attL	AAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
AUV95407.1|6114776_6115160_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	55.9	2.9e-38
AUV94974.1|6115251_6115500_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95408.1|6115544_6116699_-	hypothetical protein	NA	B9A7A9	Serratia_phage	80.9	6.5e-179
AUV94975.1|6116852_6118034_+|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.3	3.0e-155
AUV94976.1|6118033_6118549_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.8	3.1e-64
AUV94977.1|6118603_6118903_+|tail	phage tail protein	tail	B9A7B2	Serratia_phage	79.2	2.2e-33
AUV94978.1|6118899_6119076_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	71.4	3.0e-11
AUV94979.1|6119044_6121846_+|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	48.6	1.8e-126
AUV94980.1|6121857_6122346_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.3	1.8e-53
AUV94981.1|6122484_6123651_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	49.0	7.4e-45
AUV94982.1|6123716_6123971_-	hypothetical protein	NA	NA	NA	NA	NA
AUV94983.1|6126081_6126678_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	44.0	7.3e-41
AUV94984.1|6126670_6127570_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	59.5	2.9e-89
AUV94985.1|6127556_6127925_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	59.1	3.6e-30
AUV94986.1|6127921_6128506_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.9	3.0e-63
AUV94987.1|6128505_6129147_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	47.8	3.2e-42
AUV94988.1|6129143_6129602_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	46.4	9.0e-31
AUV94989.1|6129598_6129898_-	peptidase	NA	NA	NA	NA	NA
AUV94990.1|6130138_6130690_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	41.3	2.3e-28
AUV94991.1|6130686_6130968_-	hypothetical protein	NA	B9A7B8	Serratia_phage	54.5	3.1e-18
AUV94992.1|6130958_6131159_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	9.7e-14
AUV95409.1|6131158_6131656_-|capsid	capsid assembly protein	capsid	B9A7B7	Serratia_phage	69.7	1.3e-59
AUV95410.1|6131758_6132655_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	73.9	1.2e-90
AUV94993.1|6132702_6133752_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	54.8	1.8e-106
AUV94994.1|6133776_6134610_-|capsid	phage capsid protein	capsid	B9A7B4	Serratia_phage	74.7	6.9e-114
AUV94995.1|6134767_6136489_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	65.6	1.3e-223
AUV94996.1|6136488_6137541_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.0	2.7e-139
AUV94997.1|6138134_6138341_-	hypothetical protein	NA	NA	NA	NA	NA
AUV94998.1|6138347_6140963_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	51.1	8.1e-193
AUV94999.1|6140955_6141852_-	hypothetical protein	NA	H2BDG1	Pseudomonas_virus	54.8	2.5e-24
AUV95000.1|6142103_6142373_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95001.1|6142372_6143326_-	adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	56.6	3.4e-88
AUV95002.1|6143336_6143915_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	40.5	6.4e-34
AUV95003.1|6143911_6144136_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95004.1|6144205_6144478_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95005.1|6144493_6144880_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95006.1|6144896_6145115_-	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	9.6e-07
AUV95007.1|6145141_6145414_-	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	86.7	5.7e-41
AUV95008.1|6145536_6145728_+	hypothetical protein	NA	NA	NA	NA	NA
AUV95009.1|6146047_6146341_+	XRE family transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	76.3	5.9e-36
AUV95010.1|6146410_6147391_+|integrase	integrase	integrase	U5N0A8	Enterobacteria_phage	81.8	2.0e-152
AUV95011.1|6147575_6148079_-	stress adaptor protein CpxP	NA	NA	NA	NA	NA
6147510:6147551	attR	AAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
AUV95012.1|6148228_6148927_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
AUV95013.1|6148923_6150297_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	23.3	4.5e-09
AUV95014.1|6150388_6151063_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AUV95015.1|6151134_6151755_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
>prophage 1
CP026271	Klebsiella oxytoca strain KONIH4 plasmid pKOX-4655, complete sequence	73495	19911	28346	73495		Emiliania_huxleyi_virus(16.67%)	13	NA	NA
AUV95504.1|19911_21912_-	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	26.8	3.3e-21
AUV95505.1|21982_22231_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AUV95506.1|22280_22838_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	75.2	5.2e-49
AUV95507.1|23548_23755_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95508.1|23703_24024_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95557.1|24048_24312_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	53.8	3.4e-14
AUV95509.1|24512_24704_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95558.1|24744_25251_-	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.9	6.9e-08
AUV95559.1|25295_25724_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.9	2.2e-10
AUV95560.1|26156_26921_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95510.1|26967_27378_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AUV95511.1|27423_27645_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95512.1|27644_28346_-	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	34.3	2.6e-21
>prophage 1
CP026274	Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence	235655	0	100092	235655	transposase,protease,integrase	Escherichia_phage(24.24%)	109	55507:55523	90216:90232
AUV95916.1|813_1239_+	hypothetical protein	NA	NA	NA	NA	NA
AUV95917.1|1296_1701_+	antirestriction protein ArdR	NA	NA	NA	NA	NA
AUV95918.1|1710_1950_+	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
AUV95919.1|2835_3132_+	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
AUV95920.1|3128_3488_+	hypothetical protein	NA	NA	NA	NA	NA
AUV95921.1|3556_3841_+	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
AUV95922.1|4049_4382_+	hypothetical protein	NA	NA	NA	NA	NA
AUV95923.1|5734_6244_+	antirestriction protein	NA	NA	NA	NA	NA
AUV95924.1|6970_7150_+	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
AUV95925.1|7204_7525_+	CcgAII protein	NA	NA	NA	NA	NA
AUV96145.1|7635_7869_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95926.1|8161_8530_-	StbC	NA	NA	NA	NA	NA
AUV95927.1|8531_9248_-	StdB protein	NA	NA	NA	NA	NA
AUV96146.1|9256_9394_-	StbA	NA	NA	NA	NA	NA
AUV95928.1|10166_10583_+	traK protein	NA	NA	NA	NA	NA
AUV95929.1|10584_12114_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
AUV95930.1|12113_15350_+	conjugative relaxase	NA	U5J9B0	Bacillus_phage	27.3	2.4e-05
AUV95931.1|15349_15715_+	FipA	NA	NA	NA	NA	NA
AUV95932.1|16287_16992_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV95933.1|18093_19383_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.5	6.2e-170
AUV95934.1|19440_19869_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	5.2e-49
AUV95935.1|19941_20451_+	arsenate reductase ArsC	NA	A0A2H4J437	uncultured_Caudovirales_phage	39.1	1.0e-14
AUV95936.1|20629_21127_+	phosphatase	NA	NA	NA	NA	NA
AUV95937.1|21402_22416_+	permease	NA	NA	NA	NA	NA
AUV95938.1|22527_22851_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUV95939.1|22859_23582_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.0	2.2e-95
AUV95940.1|23671_24202_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUV95941.1|24348_24993_-	resolvase	NA	NA	NA	NA	NA
AUV95942.1|25252_25657_+	hypothetical protein	NA	A0A2L1IV36	Escherichia_phage	53.5	1.1e-19
AUV95943.1|25937_26642_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV95944.1|26968_27469_+	ferritin	NA	NA	NA	NA	NA
AUV95945.1|27669_30678_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	62.8	0.0e+00
AUV95946.1|30988_31693_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV95947.1|32724_33516_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AUV96147.1|33574_34921_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95948.1|35129_35612_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUV95949.1|35599_35866_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AUV95950.1|36041_36296_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95951.1|36371_36629_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95952.1|36677_36881_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AUV95953.1|36911_37280_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95954.1|37323_37818_-	DNA-binding protein	NA	NA	NA	NA	NA
AUV95955.1|37848_38415_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95956.1|38411_38675_-	hypothetical protein	NA	NA	NA	NA	NA
AUV96148.1|38964_39543_+	hypothetical protein	NA	NA	NA	NA	NA
AUV95957.1|39681_40683_-|protease	CAAX protease	protease	NA	NA	NA	NA
AUV95958.1|40838_41420_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95959.1|41706_41886_+	antitoxin	NA	NA	NA	NA	NA
AUV95960.1|41851_41971_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUV95961.1|42349_42784_-	copper-binding protein	NA	NA	NA	NA	NA
AUV95962.1|42999_44400_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.9	6.4e-19
AUV95963.1|44396_45077_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AUV95964.1|45131_46061_-	copper resistance protein D	NA	NA	NA	NA	NA
AUV95965.1|46065_46446_-	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AUV95966.1|46485_47382_-	copper resistance protein B	NA	NA	NA	NA	NA
AUV95967.1|47381_49199_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AUV95968.1|49433_49883_+	copper resistance protein	NA	NA	NA	NA	NA
AUV95969.1|50171_50909_+	peptidase	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
AUV95970.1|50942_51140_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AUV95971.1|51180_53628_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.4	3.8e-83
AUV95972.1|53754_54195_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95973.1|54281_57428_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.6	1.0e-61
55507:55523	attL	GTCATGCCAGGACGCCA	NA	NA	NA	NA
AUV95974.1|57438_58731_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUV95975.1|58844_59198_-	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV95976.1|59226_60612_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95977.1|60801_61482_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
AUV95978.1|61474_62950_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AUV95979.1|63195_63627_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AUV95980.1|63774_64125_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	6.0e-19
AUV96149.1|64310_65219_-	HNH endonuclease	NA	NA	NA	NA	NA
AUV95981.1|65763_66786_-	DNA helicase UvrD	NA	NA	NA	NA	NA
AUV95982.1|66770_68333_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AUV95983.1|68406_68823_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AUV95984.1|68819_69050_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AUV95985.1|69033_69510_+	hypothetical protein	NA	NA	NA	NA	NA
AUV95986.1|69619_69973_+	hypothetical protein	NA	NA	NA	NA	NA
AUV95987.1|70035_70644_+	hypothetical protein	NA	NA	NA	NA	NA
AUV95988.1|70872_71202_+	hypothetical protein	NA	NA	NA	NA	NA
AUV95989.1|71198_71987_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	4.2e-52
AUV95990.1|72043_72301_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95991.1|73112_74612_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AUV95992.1|74608_75364_+	hypothetical protein	NA	U5N3V8	Enterobacteria_phage	33.9	2.4e-33
AUV95993.1|77049_77805_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	2.0e-136
AUV95994.1|78552_79758_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
AUV95995.1|79754_80732_+	chromosome partitioning protein ParB	NA	Q38420	Escherichia_phage	53.8	8.5e-87
AUV95996.1|82084_82516_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AUV95997.1|82672_82924_+	hypothetical protein	NA	NA	NA	NA	NA
AUV95998.1|82923_84408_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
AUV95999.1|84656_85628_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.4e-73
AUV96000.1|85630_86302_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
AUV96001.1|86365_86596_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96002.1|87570_88251_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	35.5	2.4e-27
AUV96003.1|88250_88472_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96004.1|88483_88903_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AUV96005.1|88956_89742_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96006.1|89911_90340_+	antirestriction protein	NA	NA	NA	NA	NA
90216:90232	attR	TGGCGTCCTGGCATGAC	NA	NA	NA	NA
AUV96007.1|90417_90609_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96008.1|90788_91040_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	49.4	1.3e-12
AUV96009.1|91832_92063_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96150.1|92188_93496_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
AUV96010.1|93544_94108_+	SAM-dependent methyltransferase	NA	A0A2I7RHK4	Vibrio_phage	36.7	3.7e-18
AUV96011.1|94769_94964_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AUV96012.1|94941_95490_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	73.8	3.9e-49
AUV96013.1|95538_95772_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AUV96014.1|95839_97897_+	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	26.2	1.4e-22
AUV96015.1|97940_98372_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AUV96016.1|98368_99097_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AUV96017.1|99500_99830_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	3.1e-09
AUV96018.1|99810_100092_+	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
>prophage 2
CP026274	Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence	235655	106351	154249	235655	transposase,integrase	uncultured_archaeal_virus(20.0%)	41	106319:106378	154223:156742
106319:106378	attL	GGGGTCGGTTCCGGCTGAGGGCGAAATGACACCCTAAGCGTTAGCTCTGTGTCGTTGCAC	NA	NA	NA	NA
AUV96030.1|106351_106957_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AUV96031.1|108889_110605_-|integrase	integrase	integrase	NA	NA	NA	NA
AUV96032.1|110714_113744_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
AUV96033.1|113850_114876_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AUV96034.1|114872_115652_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AUV96035.1|116038_116920_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AUV96036.1|117169_118489_-|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AUV96037.1|119440_120070_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
AUV96038.1|120287_121481_+	enoyl-[acyl-carrier-protein] reductase FabV	NA	NA	NA	NA	NA
AUV96039.1|121614_121881_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AUV96040.1|121896_122538_-	DAK2 domain-containing protein	NA	NA	NA	NA	NA
AUV96041.1|122547_123561_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
AUV96042.1|123606_124269_-	class II aldolase family protein	NA	NA	NA	NA	NA
AUV96043.1|124371_126435_-	PRD domain-containing protein	NA	NA	NA	NA	NA
AUV96044.1|126503_127907_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
AUV96045.1|127952_128231_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
AUV96046.1|128232_128748_-	transcriptional regulator	NA	NA	NA	NA	NA
AUV96047.1|128994_130539_-	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
AUV96048.1|132660_132885_-	hypothetical protein	NA	NA	NA	NA	NA
AUV96049.1|133478_134270_+	hypothetical protein	NA	A0A2H4PB09	Aphanizomenon_phage	55.7	3.4e-09
AUV96050.1|134438_134708_+	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
AUV96051.1|134749_134950_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96052.1|135004_135502_+	ROS/MUCR transcriptional regulator domain protein	NA	NA	NA	NA	NA
AUV96053.1|137143_137350_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96054.1|137423_137606_+	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
AUV96152.1|137664_137868_-	hypothetical protein	NA	NA	NA	NA	NA
AUV96055.1|138078_138447_-	hypothetical protein	NA	NA	NA	NA	NA
AUV96056.1|138449_139166_-	StdB protein	NA	NA	NA	NA	NA
AUV96153.1|139174_139300_-	StbA	NA	NA	NA	NA	NA
AUV96154.1|140279_140498_+	TraK	NA	NA	NA	NA	NA
AUV96057.1|140497_142030_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
AUV96058.1|142034_145253_+	conjugative relaxase	NA	A0A2R8FDQ9	Cedratvirus	30.5	2.4e-05
AUV96059.1|145249_145915_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96060.1|145907_146270_+|transposase	transposase	transposase	NA	NA	NA	NA
AUV96061.1|146885_147197_-	hypothetical protein	NA	NA	NA	NA	NA
AUV96155.1|147193_147661_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	37.6	1.7e-24
AUV96062.1|147717_148719_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AUV96063.1|148769_149903_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
AUV96064.1|149902_150721_-	conjugal transfer protein TraO	NA	NA	NA	NA	NA
AUV96065.1|150651_153549_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AUV96066.1|153643_154249_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
154223:156742	attR	GTGCAACGACACAGAGCTAACGCTTAGGGTGTCATTTCGCCCTCAGCCGGAACCGACCCCGATATGTGTAAACAGGCCCACTACCGCATCAATTCGCACCACATCAACCGGGTTATAAACTACCGTTTTGATACGGTAGTCATACGGTGAACTTTTCGGCGCTTGAAGCGCCGCCGCGTTGAATGTGGCCCCGGCCAGCGCCATTGCGATCACTGCGGATAAGACTACTTTTTTCATAGTACAGTCCTCAGTTCGACTCAGGGTTAACGCGGTAACTGGTGACGCGGAAGCCGAGCGGGTTGATGTAGCGCTGCGAGGCGTTCATAGCCAGCGATTTGTACTCGTAGCCCAGGATGGCAATCCAGCGCTTCGGTGGATCGTCAAAGTTATTGCTACGAGAGCGGCGAACGGTCGTAAAGCGAATGGTCGCCACGCCATGCTCTCTATCGAGAATGGTTGAGTTGATACTTACTCGCGTCGTCTCGCTGTCACCCAGGACCTTATCAATCCCTTGCTTGCCCTTGAACCGGGAAAGGTAGGCTTCCGCCACGTTCGGCGTGGACATTAAACCTACTGCGTCATAGTCCACTTGCAGGGAATAAAAATCGTAGGATTCACGGTGGATAACGTATTGAGTAAGGAAATACTTATCAATTTCGTCGCCATAGGTGGCATCGTCACGCGTCAGCTTAACCTGTGATACCTCATGATTGCTGGGGTTCAGCGTCAACAGGAACGGCGGTATTGGCTGGCTATAGCGGTAATTCACAAAGGTAGCATTACCGATTGCGACGACAGCCACAACGGATGCGACCGCAGCGACTATCCACGCCGTGCGGCGTGAAGATAACACTTCGTTCATAACGTCCACTTCCAGCCCTTTACGGCTTTCGTTGAACTCTTTGATGGCCTCTTTGGTCAGCCCTTTCTTTTTCTCTCTCATAACAACCACCTTATCCCTGTGTATCTACTGGAAGCGTTTTATTGACTGGCACGGTGTGGCTCCAGTCCGGCTCCGGTGGTGGCTTGAAACTGCTGGAACATGCCCCTAACAACAACACCCCTAAAAGTACGATTGCGCGCATAGTTTCGACCTCATTTGTCCATTGCGTTCTATTATCTTATATCCGTGAAATTGCAATTTCAACGACTTTTGTTTATTTATGCAGCTTTTCCCCGGCTACCACGCGCCTTTCCTGTCAAACCTGAACCGCCAGCCCCTGCATTGCCGCTAGTGCTGGCACTTTGTCCACCGCCGCCGCCAGCTGCTGAAGGTCTTGCTGAAGGCTTCGCTCCACCAAAAATCCCATTAGAGGCAACATTACCCATCGTATTCATCGAGTGGCCCGCATGGCGGGCCGCAGAAGCTATATCAGCAGAAACACCGCTACCGAAATTCGACGCTACCGCTGGAACCTGGAACAACACATAGACGGAAACAATGGTGAGAATGACCAGTCCAATTGCTGTTGATAAGGCATCAAAGCCTTCGCTGCCGTTAAGACCGGAAATCATTTTTGTAAAGAGGCTCATTAACAACCCAAATACGAGAGCCAAAAGAACTATGACTAGGCTGTAATTAATAACGGTCCCCATCCACTTAGCAAATATGCCTTTTGTTGGATTCCACAGGAGACAGAATATAGCTATTGGCCCTAAACACAGGCTTATAGCCAGTAGCACTTTAGCCATAATTACAAAGGCAGAACCCAACCCACAAAGAACTACGGTCGCTGCTATTAGAATGAGTCCGATTACTGCGCTCATTATGCCATTAGCGCTAATGCCAGCCCCTTCGAACGCCGTTTGTATTGCCGTTATAGACTGGTCTACCCCAGTATCAATAATGGCTGCCATCCCTGTACTTGAGGTTTTATTTTGAGTAACCAATATTGAAGCAAAGTTATCAGGTAGGTTTAAAGCCAAATGTACAAGGTCGGTTTGATATAAACCGCCAGCCGTTGCAAAACTCAAAACAACGGCAGCTTTCATATATTGTGTAATTAAATCCCCAAGCGCCTCCCCGCCCCCTCCGGGGCTAAGAGCGGAATATGCACCTTGAGCCATAAACTTGATGGTCAAAAATATTGCAACCGTTGGTGTGACGGTTGCAATAATGGTTGTTACGTTGGTATCAACCATAATATTTATCAGATCATCAATTATGTCAAATATCTGTTGAACAGTATCAAATGCCATAACTACATCCTGAAATTTAGTTTAACTTCGGCACACTATGAGAGTTATCTTTCCCATGAACAAAAAGTTCAGTCTCTGCGTCTCTTGCATTTTTACAATCAGCATCCTGCAAGGATTCTGCATTCTTTTTGCATTCAACAAGCATTTGTTTTCGTTCTGTCTCATGCGACTTATACCAATCTTTGTCATGCTCAGGCTTACAACCAGCGAGAGCGGAAACACCGATAAAAACTAAAGCTACTTTTAAAGTCGTTTTCATATAATCACCTTATTTCAACGGAGCGGGGTTATGACCACCATCAGTACCATAAATAAAATTAC	NA	NA	NA	NA
>prophage 3
CP026274	Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence	235655	158589	205289	235655	transposase,integrase	Salmonella_phage(41.67%)	46	155354:155381	213816:213843
155354:155381	attL	GAAATTGCAATTTCAACGACTTTTGTTT	NA	NA	NA	NA
AUV96071.1|158589_159615_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV96072.1|159909_160878_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	6.1e-186
AUV96073.1|161196_162222_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV96074.1|163794_164112_-	type IV secretion system protein VirB3	NA	NA	NA	NA	NA
AUV96075.1|164151_164448_-	conjugal transfer protein TraM	NA	NA	NA	NA	NA
AUV96076.1|164456_164735_-	transcriptional regulator	NA	NA	NA	NA	NA
AUV96077.1|164694_165477_-	traL protein	NA	NA	NA	NA	NA
AUV96078.1|165576_165894_+	KorB	NA	NA	NA	NA	NA
AUV96079.1|165897_166248_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96158.1|166358_166583_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96080.1|166586_166895_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96081.1|167179_167365_+	ribbon-helix-helix domain-containing protein	NA	A0A0A7RUX5	Clostridium_phage	57.8	2.6e-05
AUV96082.1|167361_167970_-	resolvase	NA	Q2A092	Sodalis_phage	27.2	5.1e-05
AUV96083.1|168135_168468_-	hypothetical protein	NA	NA	NA	NA	NA
AUV96084.1|168607_169489_+	replication protein	NA	NA	NA	NA	NA
AUV96085.1|170063_170393_+	ArdK family transcriptional regulator	NA	NA	NA	NA	NA
AUV96086.1|170509_170998_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	79.5	3.5e-49
AUV96087.1|171157_172405_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AUV96088.1|172391_173954_+	recombinase	NA	NA	NA	NA	NA
AUV96089.1|173946_175980_+|integrase	integrase	integrase	NA	NA	NA	NA
AUV96159.1|176131_176392_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96090.1|176520_177546_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV96091.1|177840_178809_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.2	1.5e-181
AUV96092.1|179064_181098_+	alpha-amylase	NA	NA	NA	NA	NA
AUV96093.1|182136_182457_-	hypothetical protein	NA	J9Q750	Salmonella_phage	51.9	9.1e-30
AUV96094.1|182710_183679_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	1.0e-180
AUV96095.1|184239_185513_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	3.0e-169
AUV96096.1|185617_185863_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96097.1|186135_186924_-	sprT domain-containing protein	NA	NA	NA	NA	NA
AUV96098.1|187103_187526_+	ArdB protein	NA	NA	NA	NA	NA
AUV96160.1|187642_187834_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96099.1|187837_188401_+	antirestriction protein ArdR	NA	NA	NA	NA	NA
AUV96100.1|188384_188765_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96101.1|188813_189098_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96102.1|190055_190529_+	MFS sugar transporter	NA	NA	NA	NA	NA
AUV96103.1|190540_192034_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
AUV96104.1|192091_192373_+	peptidylprolyl isomerase C	NA	NA	NA	NA	NA
AUV96105.1|192449_193925_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AUV96106.1|194200_195103_+	HTH-type transcriptional activator IlvY	NA	NA	NA	NA	NA
AUV96107.1|195223_195682_+	hypothetical protein	NA	NA	NA	NA	NA
AUV96108.1|195689_197405_-|integrase	integrase	integrase	NA	NA	NA	NA
AUV96109.1|197514_200544_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
AUV96110.1|200650_201676_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AUV96111.1|201672_202452_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AUV96112.1|202838_203720_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AUV96113.1|203969_205289_-|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
213816:213843	attR	GAAATTGCAATTTCAACGACTTTTGTTT	NA	NA	NA	NA
>prophage 4
CP026274	Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence	235655	209306	209840	235655		Wolbachia_phage(100.0%)	1	NA	NA
AUV96114.1|209306_209840_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
>prophage 5
CP026274	Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence	235655	222886	235626	235655	transposase,integrase	Burkholderia_phage(37.5%)	14	222153:222170	229337:229354
222153:222170	attL	CCTGATAGATTTGCTCAC	NA	NA	NA	NA
AUV96131.1|222886_224320_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AUV96132.1|224353_225562_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AUV96133.1|225574_225787_-	resolvase	NA	NA	NA	NA	NA
AUV96134.1|225828_226593_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AUV96135.1|226735_227002_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AUV96136.1|227222_227705_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	6.6e-16
AUV96137.1|227851_228865_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUV96138.1|228803_229118_+|transposase	transposase	transposase	NA	NA	NA	NA
AUV96139.1|229257_229827_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
229337:229354	attR	GTGAGCAAATCTATCAGG	NA	NA	NA	NA
AUV96140.1|230178_231177_-	hypothetical protein	NA	NA	NA	NA	NA
AUV96141.1|231783_232503_-	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
AUV96142.1|233062_233404_+	ArdK family transcriptional regulator	NA	NA	NA	NA	NA
AUV96164.1|233418_234210_-	sprT domain-containing protein	NA	NA	NA	NA	NA
AUV96143.1|234360_235626_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	53.8	2.2e-119
>prophage 1
CP026272	Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence	144055	2553	47039	144055	transposase,integrase	Escherichia_phage(29.41%)	38	13769:13782	47980:47993
AUV95568.1|2553_3348_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
AUV95683.1|3843_4023_-	Par-like protein	NA	NA	NA	NA	NA
AUV95569.1|4142_4769_-	cobyrinic acid ac-diamide synthase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
AUV95570.1|5401_6277_-	replication initiation protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
AUV95571.1|6688_7888_-	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	62.6	1.0e-134
AUV95572.1|7912_8617_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV95573.1|10513_11518_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AUV95574.1|11699_11876_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AUV95575.1|12205_13021_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AUV95576.1|13081_13885_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
13769:13782	attL	GCGCCAGATGAAGC	NA	NA	NA	NA
AUV95577.1|13884_14721_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AUV95578.1|15647_16652_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AUV95579.1|16730_19703_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AUV95580.1|19705_20263_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AUV95581.1|20392_20605_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AUV95684.1|20567_20687_+	mercury resistance protein	NA	NA	NA	NA	NA
AUV95582.1|20670_20907_-	mercury resistance protein	NA	NA	NA	NA	NA
AUV95583.1|20903_21269_-	transcriptional regulator	NA	NA	NA	NA	NA
AUV95584.1|21286_22969_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-38
AUV95585.1|23007_23415_-	mercury transport protein MerC	NA	NA	NA	NA	NA
AUV95586.1|23442_23718_-	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AUV95587.1|23733_24084_-	mercuric transporter	NA	NA	NA	NA	NA
AUV95588.1|24155_24611_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUV95589.1|26083_26944_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AUV95590.1|27643_28468_-	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
AUV95591.1|28527_29316_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AUV95685.1|29385_29940_-	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
AUV95592.1|30173_30731_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
AUV95593.1|31845_33561_-|integrase	integrase	integrase	NA	NA	NA	NA
AUV95594.1|33670_36700_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
AUV95595.1|36806_37832_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AUV95596.1|37828_38608_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AUV95597.1|38994_39876_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AUV95598.1|40125_41445_-|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AUV95599.1|42920_43466_-	response regulator	NA	NA	NA	NA	NA
AUV95600.1|43462_44590_-	regulator	NA	NA	NA	NA	NA
AUV95601.1|44874_45042_-|integrase	integrase	integrase	NA	NA	NA	NA
AUV95602.1|46043_47039_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.9	4.1e-20
47980:47993	attR	GCGCCAGATGAAGC	NA	NA	NA	NA
>prophage 2
CP026272	Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence	144055	76652	140968	144055	transposase	Salmonella_phage(45.45%)	51	NA	NA
AUV95626.1|76652_77678_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV95627.1|77972_78941_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.5e-184
AUV95628.1|80809_81193_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95629.1|81279_81579_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95689.1|81575_81794_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95630.1|82061_82340_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95631.1|82451_83021_-	type IV conjugative transfer system protein TraV	NA	NA	NA	NA	NA
AUV95632.1|83194_84616_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AUV95633.1|84615_85350_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
AUV95634.1|85336_85903_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
AUV95635.1|86192_89090_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AUV95636.1|89184_89790_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AUV95637.1|90598_91624_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV95638.1|92624_94847_-	glycosyl transferase family 1	NA	NA	NA	NA	NA
AUV95639.1|94944_95754_+	hypothetical protein	NA	NA	NA	NA	NA
AUV95640.1|96896_97922_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV95641.1|98240_99209_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	7.7e-181
AUV95642.1|99503_100529_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV95643.1|100604_100802_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95644.1|102173_102497_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AUV95645.1|102480_103029_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUV95646.1|103531_106213_-	DNA repair protein	NA	NA	NA	NA	NA
AUV95647.1|106411_106594_+	hypothetical protein	NA	NA	NA	NA	NA
AUV95648.1|106590_107616_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV95649.1|107934_108903_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	6.1e-186
AUV95650.1|109197_110223_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV95651.1|110312_111245_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95652.1|111248_112244_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AUV95653.1|113748_115941_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
AUV95654.1|116070_117354_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
AUV95655.1|117443_118877_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
AUV95656.1|118895_121343_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	70.5	9.4e-26
AUV95657.1|121447_123091_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	25.0	1.5e-22
AUV95658.1|123616_124642_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV95659.1|124960_125929_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	6.1e-186
AUV95660.1|126223_127249_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV95661.1|128168_128447_+	hypothetical protein	NA	NA	NA	NA	NA
AUV95662.1|129845_131123_-	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
AUV95663.1|131470_132112_-	ABC transporter	NA	NA	NA	NA	NA
AUV95664.1|132111_133050_-	MCE family protein	NA	NA	NA	NA	NA
AUV95690.1|133051_133852_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	1.8e-10
AUV95665.1|133848_134994_-	ABC transporter permease	NA	NA	NA	NA	NA
AUV95666.1|135236_135941_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV95667.1|136853_137144_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AUV95668.1|137140_137542_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AUV95669.1|137531_137888_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AUV95670.1|138142_138469_+	hypothetical protein	NA	NA	NA	NA	NA
AUV95671.1|138465_138966_+|transposase	transposase	transposase	NA	NA	NA	NA
AUV95672.1|138962_139334_+	hypothetical protein	NA	NA	NA	NA	NA
AUV95673.1|139327_139885_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
AUV95674.1|139963_140968_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP026270	Klebsiella oxytoca strain KONIH4 plasmid unnamed, complete sequence	52919	1026	52152	52919	terminase,tail,head,capsid,portal	Klebsiella_phage(90.38%)	58	NA	NA
AUV95415.1|1026_2190_+	plasmid-partitioning protein SopA	NA	Q6UAV7	Klebsiella_phage	99.5	1.3e-227
AUV95416.1|2192_3164_+	chromosome partitioning protein ParB	NA	Q6UAV8	Klebsiella_phage	97.8	5.2e-177
AUV95417.1|3246_3630_-	DNA polymerase V	NA	Q6UAV9	Klebsiella_phage	90.6	5.2e-64
AUV95418.1|3747_4890_-|tail	phage tail protein	tail	A0A0H4TGH1	Klebsiella_phage	37.7	3.6e-36
AUV95419.1|4928_15476_-	hypothetical protein	NA	A0A0P0IKE4	Klebsiella_phage	52.2	0.0e+00
AUV95420.1|15540_16131_-|tail	phage tail protein	tail	K7PHE5	Enterobacteria_phage	72.9	3.8e-74
AUV95421.1|16183_16531_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95422.1|16563_17274_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	94.5	5.1e-142
AUV95423.1|17275_18031_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	90.0	8.2e-138
AUV95424.1|18027_18366_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	96.4	2.5e-62
AUV95468.1|18365_21713_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	96.8	0.0e+00
AUV95469.1|21712_21931_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	98.6	4.0e-37
AUV95425.1|21951_22320_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	100.0	2.2e-59
AUV95426.1|22383_22851_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	99.4	4.6e-83
AUV95427.1|22885_23287_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	100.0	2.0e-66
AUV95428.1|23283_23673_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	100.0	1.6e-68
AUV95429.1|23653_23992_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	100.0	3.4e-59
AUV95430.1|23988_24306_-	hypothetical protein	NA	Q6UAX4	Klebsiella_phage	95.9	9.5e-48
AUV95431.1|24286_24559_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	67.5	1.1e-23
AUV95432.1|24617_25904_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.5	5.7e-216
AUV95433.1|25978_26899_-	serine peptidase	NA	Q6UAX7	Klebsiella_phage	96.4	3.2e-160
AUV95434.1|26935_28201_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	100.0	9.8e-245
AUV95435.1|28200_28380_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	100.0	1.3e-22
AUV95436.1|28373_30083_-|terminase	terminase	terminase	Q6UAY0	Klebsiella_phage	99.6	0.0e+00
AUV95437.1|30117_30441_-|terminase	terminase	terminase	Q6UAY1	Klebsiella_phage	100.0	3.7e-55
AUV95470.1|30683_30884_-	hypothetical protein	NA	Q6UAR8	Klebsiella_phage	92.4	1.5e-11
AUV95438.1|30969_31398_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	60.6	4.2e-38
AUV95439.1|31397_31712_-	hypothetical protein	NA	Q6UAS1	Klebsiella_phage	44.2	1.6e-07
AUV95440.1|31708_32071_-	endonuclease	NA	Q6UAS2	Klebsiella_phage	92.5	9.2e-63
AUV95441.1|32070_32793_-	hypothetical protein	NA	Q6UAS3	Klebsiella_phage	76.6	6.9e-102
AUV95442.1|33071_33371_-	nucleoside 2-deoxyribosyltransferase	NA	Q6UAS4	Klebsiella_phage	94.9	6.7e-51
AUV95443.1|33624_34095_-	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	82.1	5.9e-62
AUV95444.1|34111_34603_-	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	90.2	1.1e-82
AUV95445.1|34605_34911_-	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	91.1	1.5e-45
AUV95446.1|34969_36031_-	DNA adenine methylase	NA	Q6UAT0	Klebsiella_phage	92.9	2.4e-172
AUV95447.1|36301_36529_-	winged helix-turn-helix domain-containing protein	NA	Q6UAT1	Klebsiella_phage	85.3	1.9e-29
AUV95471.1|36538_36760_-	hypothetical protein	NA	Q6UAT2	Klebsiella_phage	98.6	1.7e-35
AUV95448.1|36929_37238_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	94.2	3.9e-46
AUV95449.1|37237_37525_+	XRE family transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	95.8	2.2e-43
AUV95472.1|37571_37775_-	hypothetical protein	NA	Q6UAT5	Klebsiella_phage	78.1	2.0e-19
AUV95450.1|37878_38106_-	hypothetical protein	NA	O64355	Escherichia_phage	74.6	3.4e-23
AUV95451.1|38126_38453_-	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	95.4	1.0e-52
AUV95452.1|38445_39093_-	hypothetical protein	NA	Q6UAT8	Klebsiella_phage	65.1	1.1e-63
AUV95453.1|39514_39718_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95454.1|39714_39942_-	hypothetical protein	NA	NA	NA	NA	NA
AUV95455.1|40402_41011_-	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	92.5	4.8e-104
AUV95456.1|41196_41499_-	hypothetical protein	NA	A0A2I6TCB2	Escherichia_phage	71.0	4.8e-41
AUV95457.1|41422_42160_-	phage antitermination protein	NA	Q6UAU4	Klebsiella_phage	94.3	4.2e-131
AUV95458.1|42149_42359_-	hypothetical protein	NA	Q6UAU5	Klebsiella_phage	91.3	1.3e-29
AUV95459.1|42439_43048_+	XRE family transcriptional regulator	NA	Q6UAU6	Klebsiella_phage	97.0	6.4e-109
AUV95460.1|43298_47303_+	origin of replication binding family protein	NA	A0A2I6TD01	Escherichia_phage	81.5	0.0e+00
AUV95461.1|47295_47592_+	hypothetical protein	NA	NA	NA	NA	NA
AUV95462.1|47709_48282_+	hypothetical protein	NA	Q6UAU9	Klebsiella_phage	89.7	5.5e-86
AUV95463.1|48271_48655_+	hypothetical protein	NA	NA	NA	NA	NA
AUV95464.1|49015_49180_+	host cell division inhibitor Icd-like protein	NA	Q6UAV3	Klebsiella_phage	96.3	2.8e-19
AUV95465.1|49176_49407_+	hypothetical protein	NA	NA	NA	NA	NA
AUV95466.1|49403_50174_+	hypothetical protein	NA	O64341	Escherichia_phage	79.0	7.3e-118
AUV95467.1|50229_52152_-	protelomerase	NA	Q6UAV6	Klebsiella_phage	98.0	0.0e+00
