The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026226	Aeromonas sp. ASNIH7 chromosome, complete genome	4817060	70400	78055	4817060		Mycoplasma_phage(33.33%)	7	NA	NA
AUV15266.1|70400_71684_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.4	3.3e-30
AUV15267.1|71680_72982_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	41.9	2.9e-34
AUV15268.1|73139_73478_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AUV15269.1|73479_75327_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.0	2.2e-104
AUV15270.1|76063_76387_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	43.9	1.2e-21
AUV15271.1|76402_76786_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.0	2.8e-54
AUV15272.1|76840_78055_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.3	3.0e-33
>prophage 2
CP026226	Aeromonas sp. ASNIH7 chromosome, complete genome	4817060	340975	445305	4817060	transposase,tRNA	Enterobacteria_phage(20.83%)	93	NA	NA
AUV18978.1|340975_342179_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.5	1.2e-114
AUV18979.1|342381_342918_-	hypothetical protein	NA	NA	NA	NA	NA
AUV15456.1|342942_344262_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
AUV15457.1|344503_345214_-	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
AUV15458.1|345393_346212_-	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	27.8	2.8e-14
AUV15459.1|346316_347966_-	phosphate ABC transporter, permease protein PstA	NA	NA	NA	NA	NA
AUV15460.1|347983_350221_-	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AUV15461.1|350389_350938_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
AUV15462.1|351434_351659_-	hypothetical protein	NA	NA	NA	NA	NA
AUV15463.1|352490_354098_+	malate synthase A	NA	NA	NA	NA	NA
AUV15464.1|354167_355481_+	isocitrate lyase	NA	NA	NA	NA	NA
AUV15465.1|355906_356650_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
AUV15466.1|356710_357739_-	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
AUV15467.1|357880_358507_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AUV15468.1|358682_359720_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	47.1	3.2e-76
AUV18980.1|359740_360388_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	37.8	6.8e-24
AUV15469.1|360502_361264_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AUV15470.1|361371_362706_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUV18981.1|363915_365334_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUV15471.1|365573_366413_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AUV15472.1|366671_367184_+	ACT domain-containing protein	NA	NA	NA	NA	NA
AUV15473.1|367260_369330_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
AUV15474.1|369319_370810_+	exopolyphosphatase	NA	NA	NA	NA	NA
AUV15475.1|371086_372313_-|transposase	transposase	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
AUV15476.1|372370_372775_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	6.7e-30
AUV15477.1|372694_374011_-	magnesium transporter	NA	NA	NA	NA	NA
AUV15478.1|374356_375496_-|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	68.7	7.2e-146
AUV15479.1|375893_376844_+|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
AUV15480.1|377258_378467_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
AUV15481.1|378470_380468_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
AUV15482.1|380471_381572_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A0A7RU71	Clostridium_phage	36.5	4.4e-15
AUV15483.1|381618_382716_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
AUV15484.1|382776_383448_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
AUV15485.1|383464_384253_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
AUV15486.1|384267_385014_-	flagellar basal-body rod protein FlgF	NA	NA	NA	NA	NA
AUV15487.1|385160_386507_-	flagellar hook protein FlgE	NA	NA	NA	NA	NA
AUV15488.1|387338_387758_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
AUV15489.1|387754_388156_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
AUV15490.1|388217_389042_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
AUV15491.1|389059_389971_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.3e-36
AUV15492.1|390130_390814_+	flagella basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
AUV15493.1|390908_391229_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
AUV18982.1|391228_391642_+	flagellar protein FlgN	NA	NA	NA	NA	NA
AUV15494.1|391685_392228_-	phosphodiesterase	NA	NA	NA	NA	NA
AUV15495.1|392291_393518_-|transposase	transposase	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
AUV15496.1|393575_393980_+|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	6.7e-30
AUV15497.1|394033_395674_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV15498.1|395963_396866_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AUV15499.1|396967_397660_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
AUV15500.1|397832_399023_+	HD domain-containing protein	NA	NA	NA	NA	NA
AUV15501.1|399232_400459_-|transposase	transposase	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
AUV15502.1|400516_400921_+|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	6.7e-30
AUV15503.1|401184_402078_+	EamA family transporter	NA	NA	NA	NA	NA
AUV15504.1|402168_404019_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV15505.1|404087_404381_+	hypothetical protein	NA	NA	NA	NA	NA
AUV15506.1|404306_405320_-|transposase	IS110 family transposase ISAeca3	transposase	NA	NA	NA	NA
AUV15507.1|405448_405841_-	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
AUV15508.1|405935_406484_-	hypothetical protein	NA	NA	NA	NA	NA
AUV15509.1|406730_406979_+	TIGR02647 family protein	NA	NA	NA	NA	NA
AUV15510.1|406965_407277_-	hypothetical protein	NA	NA	NA	NA	NA
AUV15511.1|407354_407564_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	61.4	2.8e-16
AUV15512.1|407770_408871_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
AUV15513.1|408965_409952_-	alpha-ketoacid dehydrogenase subunit beta	NA	A0A0K0KW14	Prochlorococcus_phage	28.8	3.0e-07
AUV15514.1|409948_411037_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
AUV15515.1|411308_412328_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
AUV15516.1|412597_412807_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
AUV15517.1|413337_414231_+	DNA replication protein	NA	NA	NA	NA	NA
AUV15518.1|414312_418149_-	ATP-dependent helicase	NA	A0A160DHD3	Gordonia_phage	29.4	1.7e-45
AUV15519.1|418367_419021_-	DUF480 domain-containing protein	NA	NA	NA	NA	NA
AUV15520.1|419284_421003_-	ligase	NA	NA	NA	NA	NA
AUV18983.1|421090_423142_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AUV15521.1|423171_423927_-	hypothetical protein	NA	NA	NA	NA	NA
AUV18984.1|423923_424613_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AUV15522.1|424664_424892_-	hypothetical protein	NA	NA	NA	NA	NA
AUV15523.1|425042_427220_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
AUV15524.1|427275_427704_-	protein tyrosine phosphatase	NA	NA	NA	NA	NA
AUV15525.1|427767_428883_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
AUV15526.1|428942_429974_-|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
AUV15527.1|430477_431599_-	glycosyl transferase	NA	NA	NA	NA	NA
AUV15528.1|431667_432753_-	glycosyl transferase	NA	NA	NA	NA	NA
AUV15529.1|432759_433563_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AUV15530.1|433559_434495_-	rhamnosyl transferase	NA	NA	NA	NA	NA
AUV15531.1|434467_434785_-	hypothetical protein	NA	Q9AYY5	Salmonella_phage	45.6	5.1e-17
AUV15532.1|434769_435684_-	hypothetical protein	NA	Q9AYY5	Salmonella_phage	35.3	8.3e-36
AUV15533.1|435760_436999_-	hypothetical protein	NA	NA	NA	NA	NA
AUV18985.1|436995_437553_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.5	5.1e-52
AUV15534.1|437614_438493_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.1	1.1e-104
AUV15535.1|438607_439495_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.7	8.1e-28
AUV15536.1|439494_440580_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	51.2	1.6e-97
AUV15537.1|441436_442858_+|transposase	IS66 family transposase ISKpn15	transposase	NA	NA	NA	NA
AUV15538.1|442840_443158_-	hypothetical protein	NA	NA	NA	NA	NA
AUV15539.1|443419_444337_-|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	58.6	4.1e-99
AUV15540.1|444366_445305_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.6	8.3e-39
>prophage 3
CP026226	Aeromonas sp. ASNIH7 chromosome, complete genome	4817060	456324	463714	4817060		Enterobacteria_phage(33.33%)	7	NA	NA
AUV15545.1|456324_457641_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	4.4e-14
AUV15546.1|457630_458449_-	ABC transporter permease	NA	NA	NA	NA	NA
AUV18987.1|458532_459075_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	60.9	1.1e-54
AUV15547.1|459136_460015_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.1	1.1e-104
AUV15548.1|460129_461017_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.7	8.1e-28
AUV15549.1|461016_462102_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	50.6	3.5e-97
AUV15550.1|463006_463714_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.1	1.9e-27
>prophage 4
CP026226	Aeromonas sp. ASNIH7 chromosome, complete genome	4817060	483255	543700	4817060	integrase,transposase	Acinetobacter_phage(22.22%)	58	477940:477957	484717:484734
477940:477957	attL	ATTCGTAATGCGAAGGTC	NA	NA	NA	NA
AUV15564.1|483255_484560_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	25.3	2.1e-16
AUV15565.1|484686_484914_+	hypothetical protein	NA	NA	NA	NA	NA
484717:484734	attR	ATTCGTAATGCGAAGGTC	NA	NA	NA	NA
AUV15566.1|485002_485998_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV15567.1|486327_487743_-	multidrug transporter	NA	NA	NA	NA	NA
AUV15568.1|492236_492872_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUV18990.1|493043_493526_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AUV15569.1|493694_494870_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
AUV15570.1|494933_495797_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
AUV15571.1|495978_496350_-	endonuclease domain-containing protein	NA	NA	NA	NA	NA
AUV15572.1|496563_497487_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
AUV15573.1|497479_498172_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.3	1.7e-20
AUV15574.1|498213_499116_-	segregation/condensation protein A	NA	NA	NA	NA	NA
AUV15575.1|499087_499708_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AUV15576.1|499832_500714_-	PHP domain-containing protein	NA	NA	NA	NA	NA
AUV15577.1|501138_502773_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
AUV15578.1|502765_503365_+	type 1 glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	36.3	3.5e-27
AUV15579.1|503375_504389_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.7	3.4e-54
AUV18991.1|504508_505894_+	bifunctional indole-3-glycerol phosphate synthase/phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AUV15580.1|505970_507164_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AUV15581.1|507160_507967_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AUV15582.1|508356_509307_-|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
AUV15583.1|509401_510931_-	flagellin	NA	NA	NA	NA	NA
AUV15584.1|511244_511541_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUV15585.1|511524_512841_+	phosphatidylinositol kinase	NA	NA	NA	NA	NA
AUV15586.1|512939_513182_+	DUF3297 domain-containing protein	NA	NA	NA	NA	NA
AUV15587.1|513178_513358_-	hypothetical protein	NA	NA	NA	NA	NA
AUV15588.1|513454_513889_-	hypothetical protein	NA	NA	NA	NA	NA
AUV15589.1|513899_514388_-	hypothetical protein	NA	NA	NA	NA	NA
AUV15590.1|514488_515382_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUV15591.1|515532_516636_+	YdcF family protein	NA	NA	NA	NA	NA
AUV15592.1|516924_517899_+	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV15593.1|517915_518683_+	taurine transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	36.4	1.2e-22
AUV15594.1|518679_519510_+	taurine transporter subunit	NA	NA	NA	NA	NA
AUV15595.1|519589_520441_+	taurine dioxygenase	NA	NA	NA	NA	NA
AUV15596.1|520582_521920_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
AUV15597.1|522024_522393_-	DUF1428 domain-containing protein	NA	NA	NA	NA	NA
AUV15598.1|522476_523838_-	MFS transporter	NA	NA	NA	NA	NA
AUV15599.1|524002_524896_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AUV15600.1|524904_525234_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
AUV15601.1|525234_525930_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AUV15602.1|525850_527827_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AUV15603.1|527830_528919_-	cytochrome o ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AUV15604.1|529842_530751_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUV18992.1|530841_531156_-	DUF3634 domain-containing protein	NA	NA	NA	NA	NA
AUV15605.1|531266_532253_-	nucleoside hydrolase	NA	NA	NA	NA	NA
AUV15606.1|532287_533514_-|transposase	transposase	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
AUV15607.1|533571_533976_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.0	3.3e-29
AUV15608.1|534167_534467_-	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
AUV15609.1|534548_534971_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUV15610.1|535100_535670_+	hypothetical protein	NA	NA	NA	NA	NA
AUV15611.1|535666_535870_-	hypothetical protein	NA	NA	NA	NA	NA
AUV15612.1|536051_536492_-	azurin	NA	NA	NA	NA	NA
AUV15613.1|536791_537835_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AUV15614.1|537876_538302_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	40.0	1.0e-12
AUV15615.1|538572_540219_+	hypothetical protein	NA	NA	NA	NA	NA
AUV15616.1|540279_541242_+	potassium transporter Kef	NA	NA	NA	NA	NA
AUV15617.1|541494_542301_+	exodeoxyribonuclease III	NA	A0A0N9QXX6	Chrysochromulina_ericina_virus	26.4	2.8e-11
AUV15618.1|542362_543700_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
>prophage 5
CP026226	Aeromonas sp. ASNIH7 chromosome, complete genome	4817060	1274238	1284207	4817060	tRNA	uncultured_Mediterranean_phage(25.0%)	10	NA	NA
AUV16208.1|1274238_1276104_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
AUV16209.1|1276317_1278105_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.1	1.2e-73
AUV16210.1|1278194_1278638_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	47.9	1.3e-26
AUV16211.1|1278653_1278869_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AUV16212.1|1279048_1280062_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.0	2.0e-107
AUV16213.1|1280135_1281119_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	33.7	3.8e-34
AUV16214.1|1281165_1282236_-	LysM peptidoglycan-binding domain-containing protein	NA	I2E8W3	Clostridium_phage	34.9	1.7e-11
AUV19033.1|1282245_1282821_-	DedA family protein	NA	NA	NA	NA	NA
AUV16215.1|1282823_1283441_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.4	5.3e-34
AUV16216.1|1283445_1284207_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.6	4.8e-69
>prophage 6
CP026226	Aeromonas sp. ASNIH7 chromosome, complete genome	4817060	1486625	1504412	4817060	transposase,protease	Liberibacter_phage(25.0%)	15	NA	NA
AUV16386.1|1486625_1487393_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUV16387.1|1488253_1489867_+|transposase	IS1634-like element ISAs25 family transposase	transposase	NA	NA	NA	NA
AUV16388.1|1490295_1491327_-|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
AUV16389.1|1492101_1494090_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	25.8	7.4e-29
AUV16390.1|1495063_1496080_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.9e-186
AUV19057.1|1496117_1496243_-	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	100.0	5.1e-13
AUV16391.1|1496179_1496686_+	hypothetical protein	NA	NA	NA	NA	NA
AUV16392.1|1496701_1497733_-|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
AUV16393.1|1497860_1498361_+	DUF1643 domain-containing protein	NA	A0A142F2K6	Mycobacterium_phage	50.0	2.0e-31
AUV16394.1|1498389_1501569_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
AUV16395.1|1501565_1501850_+	hypothetical protein	NA	NA	NA	NA	NA
AUV16396.1|1501849_1502074_+	hypothetical protein	NA	NA	NA	NA	NA
AUV19058.1|1502180_1503191_+	hypothetical protein	NA	NA	NA	NA	NA
AUV16397.1|1503090_1503357_-	hypothetical protein	NA	NA	NA	NA	NA
AUV16398.1|1503380_1504412_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
>prophage 7
CP026226	Aeromonas sp. ASNIH7 chromosome, complete genome	4817060	1507566	1565691	4817060	integrase,transposase,protease,tRNA	Klosneuvirus(20.0%)	52	1520684:1520700	1525519:1525535
AUV16401.1|1507566_1508508_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	41.9	4.0e-65
AUV16402.1|1508619_1510302_+|transposase	transposase	transposase	NA	NA	NA	NA
AUV16403.1|1510304_1511213_+|transposase	transposase	transposase	NA	NA	NA	NA
AUV16404.1|1511209_1512427_+|transposase	transposase	transposase	NA	NA	NA	NA
AUV16405.1|1512487_1513102_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	51.9	1.3e-37
AUV16406.1|1513154_1513391_-	mercury resistance protein	NA	NA	NA	NA	NA
AUV16407.1|1513387_1513753_-	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AUV16408.1|1513769_1515416_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	1.0e-39
AUV16409.1|1515412_1515658_-	hypothetical protein	NA	NA	NA	NA	NA
AUV16410.1|1515660_1515936_-	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AUV16411.1|1515951_1516302_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
AUV16412.1|1516373_1516808_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUV16413.1|1516835_1517162_-	hypothetical protein	NA	NA	NA	NA	NA
AUV16414.1|1517180_1517360_+	hypothetical protein	NA	NA	NA	NA	NA
AUV16415.1|1517289_1518129_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AUV16416.1|1518122_1518470_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AUV19059.1|1518633_1519425_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AUV16417.1|1519570_1520584_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUV16418.1|1520522_1520795_+|transposase	transposase	transposase	NA	NA	NA	NA
1520684:1520700	attL	GATGGCCGGCAGCAGCC	NA	NA	NA	NA
AUV16419.1|1521085_1522111_-	hypothetical protein	NA	NA	NA	NA	NA
AUV16420.1|1522209_1523229_-|integrase	site-specific integrase	integrase	K7PHM9	Enterobacterial_phage	25.2	4.1e-15
AUV16421.1|1523447_1524083_+	RDD family protein	NA	NA	NA	NA	NA
AUV16422.1|1524227_1525298_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AUV19060.1|1525323_1526430_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
1525519:1525535	attR	GATGGCCGGCAGCAGCC	NA	NA	NA	NA
AUV16423.1|1526608_1528120_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.6	1.4e-48
AUV16424.1|1528289_1528745_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AUV16425.1|1528747_1531663_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.0	1.9e-137
AUV16426.1|1531870_1533163_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
AUV16427.1|1533181_1533847_+	DedA family protein	NA	NA	NA	NA	NA
AUV16428.1|1533983_1534811_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
AUV16429.1|1536007_1536196_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	5.0e-12
AUV16430.1|1536289_1537537_-	aspartate kinase	NA	NA	NA	NA	NA
AUV16431.1|1537553_1540178_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.5	1.8e-75
AUV16432.1|1540457_1540964_-	RecX family transcriptional regulator	NA	NA	NA	NA	NA
AUV16433.1|1541005_1542070_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	64.4	1.2e-115
AUV19061.1|1542150_1542642_-	damage-inducible protein CinA	NA	B5TK85	Pseudomonas_phage	49.0	9.0e-29
AUV16434.1|1542841_1543249_+	hypothetical protein	NA	NA	NA	NA	NA
AUV16435.1|1543512_1546083_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	24.9	2.2e-33
AUV16436.1|1546153_1547752_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.7	1.2e-26
AUV16437.1|1547761_1548289_-	hypothetical protein	NA	NA	NA	NA	NA
AUV16438.1|1548452_1548932_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUV16439.1|1550655_1551366_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
AUV16440.1|1551489_1551861_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AUV16441.1|1551860_1552370_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AUV16442.1|1552487_1552970_+	DNA-binding protein	NA	NA	NA	NA	NA
AUV16443.1|1554428_1555547_-	GTP-binding protein	NA	NA	NA	NA	NA
AUV16444.1|1555627_1557034_-	FAD-binding protein	NA	NA	NA	NA	NA
AUV16445.1|1557149_1557767_-	amino acid transporter	NA	NA	NA	NA	NA
AUV16446.1|1557843_1558761_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.3	1.4e-14
AUV16447.1|1558757_1560329_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AUV16448.1|1560560_1563158_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
AUV16449.1|1563387_1565691_-|protease	serine protease	protease	A0A2H4T2U1	Tomelloso_virus	23.6	2.3e-05
>prophage 8
CP026226	Aeromonas sp. ASNIH7 chromosome, complete genome	4817060	1889760	1968483	4817060	transposase,integrase,tRNA	Bacillus_phage(18.75%)	57	1950283:1950299	1961770:1961786
AUV16745.1|1889760_1890147_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
AUV16746.1|1890161_1891607_-	amino acid permease	NA	NA	NA	NA	NA
AUV16747.1|1891708_1892164_-	beta-galactosidase subunit beta	NA	NA	NA	NA	NA
AUV16748.1|1892160_1895247_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.7	1.0e-157
AUV16749.1|1895568_1896534_-	transcriptional regulator EbgR	NA	C6ZCU4	Enterobacteria_phage	25.2	1.6e-16
AUV19074.1|1902671_1903211_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AUV16750.1|1903291_1906045_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	33.0	1.4e-73
AUV16751.1|1906446_1907097_+	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AUV16752.1|1907169_1907601_-	cell division protein ZapB	NA	NA	NA	NA	NA
AUV16753.1|1907600_1908881_-	hypothetical protein	NA	NA	NA	NA	NA
AUV16754.1|1908902_1909682_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
AUV16755.1|1909690_1910602_-	divalent metal cation transporter FieF	NA	NA	NA	NA	NA
AUV16756.1|1910689_1911382_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.4	1.7e-33
AUV16757.1|1911378_1912734_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.0	1.3e-16
AUV16758.1|1912804_1913269_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
AUV19075.1|1913300_1914671_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AUV16759.1|1914685_1915312_-	SCO family protein	NA	NA	NA	NA	NA
AUV16760.1|1915502_1915793_-	hypothetical protein	NA	NA	NA	NA	NA
AUV16761.1|1916143_1916770_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	35.7	6.4e-11
AUV16762.1|1916974_1919398_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AUV16763.1|1919515_1920853_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
AUV16764.1|1920903_1921767_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AUV16765.1|1921763_1922315_-	chorismate lyase	NA	NA	NA	NA	NA
AUV16766.1|1922460_1922892_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
AUV16767.1|1922948_1923119_+	hypothetical protein	NA	NA	NA	NA	NA
AUV19076.1|1923176_1923521_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
AUV16768.1|1923683_1923806_-	hypothetical protein	NA	NA	NA	NA	NA
AUV16769.1|1924072_1925095_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	3.3e-25
AUV16770.1|1925347_1925791_+	PTS mannitol transporter subunit IIA	NA	NA	NA	NA	NA
AUV16771.1|1925787_1926111_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
AUV16772.1|1926170_1927427_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
AUV16773.1|1927642_1928692_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
AUV16774.1|1928713_1929409_-	mannosyltransferase	NA	NA	NA	NA	NA
AUV16775.1|1929405_1930137_-	hypothetical protein	NA	A0A1D8KPY1	Synechococcus_phage	30.4	7.2e-14
AUV16776.1|1930117_1930708_-	hypothetical protein	NA	NA	NA	NA	NA
AUV16777.1|1930710_1931439_-	hypothetical protein	NA	NA	NA	NA	NA
AUV16778.1|1933273_1934233_-	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	A0A2K9L0I7	Tupanvirus	26.3	4.1e-17
AUV16779.1|1934387_1935032_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUV16780.1|1935215_1936406_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	27.2	2.2e-36
AUV16781.1|1936495_1937521_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	4.7e-19
AUV19077.1|1937783_1938194_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
AUV16782.1|1938278_1940582_+	GGDEF-domain containing protein	NA	G3MA91	Bacillus_virus	34.9	2.4e-23
AUV16783.1|1940568_1942581_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	39.3	1.9e-120
AUV16784.1|1942733_1943954_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	45.4	3.9e-97
AUV16785.1|1943904_1944402_+	SufE protein	NA	NA	NA	NA	NA
AUV16786.1|1944423_1945260_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	34.4	1.8e-16
AUV16787.1|1945688_1946294_+	hypothetical protein	NA	NA	NA	NA	NA
AUV16788.1|1946286_1948521_+	hypothetical protein	NA	NA	NA	NA	NA
AUV16789.1|1948505_1951868_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1950283:1950299	attL	GCAATGAGCGCGATCTC	NA	NA	NA	NA
AUV16790.1|1952300_1953167_-	HDIG domain-containing protein	NA	NA	NA	NA	NA
AUV16791.1|1953163_1954342_-|integrase	site-specific integrase	integrase	R9TMP3	Vibrio_phage	23.9	6.8e-22
AUV16792.1|1954351_1954564_-	hypothetical protein	NA	NA	NA	NA	NA
AUV16793.1|1954709_1954952_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUV16794.1|1956210_1957347_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
AUV16795.1|1959182_1960268_+	DNA sulfur modification protein DndB	NA	NA	NA	NA	NA
AUV16796.1|1965272_1966304_-|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
1961770:1961786	attR	GCAATGAGCGCGATCTC	NA	NA	NA	NA
AUV16797.1|1967532_1968483_-|transposase	IS1595-like element ISAeca5 family transposase	transposase	NA	NA	NA	NA
>prophage 9
CP026226	Aeromonas sp. ASNIH7 chromosome, complete genome	4817060	1972264	2050150	4817060	integrase,transposase	Acidithiobacillus_phage(40.0%)	50	1982241:1982300	1998979:2000420
AUV16801.1|1972264_1973539_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
AUV16802.1|1973663_1974419_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.5	3.4e-59
AUV16803.1|1974433_1975975_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	3.2e-128
AUV16804.1|1979040_1979475_-	transporter	NA	NA	NA	NA	NA
AUV16805.1|1979663_1981277_-|transposase	IS1634-like element ISAs25 family transposase	transposase	NA	NA	NA	NA
AUV16806.1|1981471_1981834_-	hypothetical protein	NA	NA	NA	NA	NA
1982241:1982300	attL	CAGGGCGAGATCGTGAACATTTTGTTAAAAATTAAAAATAGTTTTTTGCCTACAAAACAA	NA	NA	NA	NA
AUV16807.1|1982520_1983657_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
AUV19078.1|1984069_1984687_-|integrase	integrase	integrase	K4K327	Caulobacter_virus	28.0	5.9e-09
AUV19079.1|1985550_1986754_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.1	7.7e-114
AUV16808.1|1986888_1989276_+	hypothetical protein	NA	NA	NA	NA	NA
AUV16809.1|1989278_1989566_-	hypothetical protein	NA	NA	NA	NA	NA
AUV16810.1|1990037_1991459_-|transposase	IS66 family transposase ISKpn15	transposase	NA	NA	NA	NA
AUV16811.1|1993416_1994976_-	hypothetical protein	NA	NA	NA	NA	NA
AUV16812.1|1994972_1995584_-	hypothetical protein	NA	NA	NA	NA	NA
AUV16813.1|1995812_1996778_-	hypothetical protein	NA	NA	NA	NA	NA
AUV19080.1|1996894_1998325_-|transposase	IS4 family transposase ISAeme22	transposase	NA	NA	NA	NA
AUV16814.1|1999258_2000395_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
AUV16815.1|2000411_2000591_-	hypothetical protein	NA	NA	NA	NA	NA
1998979:2000420	attR	CAGGGCGAGATCGTGAACATTTTGTTAAAAATTAAAAATAGTTTTTTGCCTACAAAACAAATACTTATAGGCCTGTGATATGCAGTTAACTTTATAGTCAGGATCGCCTTCACACTTTTTAATCGTCACTGCACGTCATTTCAGCTCAAAAAATGCGCATGAAATCCAAAAAATGATAATTTCCATGATTTCCATAGTTAACAATTTGCTCACATCCTCACCCTGAAATTTGACCTGGTGATCCGGCTGTGATCTCATGCTCCTTTTCAGGAGTGCTCTCATGTCTATTGATGCCGTTTTCGCTCAGTTCTTCGACAATATTCACGACCCTCGCCAGCATGCCAAGATTTATTATCCCTTCTACGATGTCCTGTTTCTCACCGTCTGTGCCGTGATCGGCGGGGCTGAGGGCTGGGAAGATATTGAGGATTTCGGCGAGGTTCATCTTCCCTGGTTTCAATCCAAGGGACTGTTTAAAAACGGCATTCCTGTCCATGACACCATTGCCAGGATCATCTCCGGCATCAAACCAGAGCCGTTTCAGGCCGCCTTTGTGCGGTGGACTCAAGCCATTAACCAGCACACCGATGGCGCCCTGGTCGCTATCGATGGCAAAACCCTGCGCAGTTCCTATGACCGTGAGGATCGAACGTCGACCATTCACATGGTCAGTGCCTATGCCGCCGCCAATAAGCTGGTGCTCGGACAGATAAAAACCGACGCCAAGTCCAATGAAATTACCGCTATTCCCGAGTTGCTGGCGCTGCTCGACATCAAAGGCTGCCTGGTATCCATCGATGCGATGGGGTGCCAGACCGAGATCGCCGAGACCATCCTTCAGCAAGGTGGCGATTACTTATTGGCCGTCAAAGGCAACCAACCCAAGTTGTTCGAGGCGGTTCGACAGGCCCTCGCCCCGCTGGCGGCCACCCCGTTATGCGCAGAGACGATGACGCTTGAGAAGGCTCATGGCCGCATCGATGGTCGTGAGTACCATGTCATGGCGGCGGGCGAGTTGGCCGCCCAGTTTCCTCATTGGAAACAGTTGCACAGCATTGGCGTGGCCATCTCCTATCGCGTTGAAAATATGCAAAAAATTACCATAGAGCAGCGTTATTTCATCAGTTCCAAAGCGTTGGTGCAGGATGAGTTTGCGCGAGCGGTGCGTGGGCACTGGGCCATCGAAAATAGCCTGCACTGGGTGCTGGACGTCACGATGGGCGAGGATGATTGCCCGATTTATCGCGGTGATGCCGCAGAGATTTTGGCGTGCATCCGGCACATGGGGCTGAACATGCTCAGGGCCGAGACTTCACGCAAGGCGAGCGTAAGACGGAAGCAAAAAATCGCAGGAATGAGCAGTGAATATCTGGAAACGGTACTCAATGCGGGTCTCAAAAAACTGGGTGAAATTTAACAAAATGTTCACGCTCTCACCCTGG	NA	NA	NA	NA
AUV16816.1|2000618_2001569_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AUV16817.1|2001842_2002982_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUV16818.1|2002972_2004298_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
AUV16819.1|2004287_2004953_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUV16820.1|2005120_2006437_+	ferric reductase	NA	NA	NA	NA	NA
AUV16821.1|2006513_2006894_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
AUV16822.1|2006948_2007422_+	DUF2271 domain-containing protein	NA	NA	NA	NA	NA
AUV16823.1|2007444_2009661_+	nitric oxide synthase	NA	NA	NA	NA	NA
AUV16824.1|2009736_2010489_+	hypothetical protein	NA	NA	NA	NA	NA
AUV16825.1|2011201_2012476_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUV16826.1|2013380_2014136_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.0	2.4e-52
AUV16827.1|2014158_2015724_-|transposase	IS21 family transposase ISAs27	transposase	K4I413	Acidithiobacillus_phage	45.8	2.9e-121
AUV16828.1|2017837_2018638_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.7	2.3e-13
AUV16829.1|2018887_2019496_-	YitT family protein	NA	NA	NA	NA	NA
AUV16830.1|2019540_2019762_+	hypothetical protein	NA	NA	NA	NA	NA
AUV19081.1|2019799_2021161_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.0	3.3e-81
AUV16831.1|2021157_2022156_+	NAD-dependent epimerase	NA	A0A1V0SKV4	Klosneuvirus	30.8	5.7e-30
AUV16832.1|2022239_2023928_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
AUV16833.1|2023917_2024283_-	hypothetical protein	NA	NA	NA	NA	NA
AUV16834.1|2026259_2027015_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.5	3.4e-59
AUV19082.1|2028254_2029459_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.1	7.7e-114
AUV16835.1|2031126_2031474_+	DNA sulfur modification protein DndE	NA	NA	NA	NA	NA
AUV16836.1|2032137_2033169_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
AUV16837.1|2033634_2034408_-	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	100.0	5.4e-36
AUV16838.1|2034716_2036294_+	chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	97.8	8.0e-95
AUV16839.1|2036478_2037495_+|transposase	IS5/IS1182 family transposase	transposase	Q38213	Escherichia_phage	98.8	1.4e-185
AUV16840.1|2037601_2038876_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
AUV16841.1|2039360_2040392_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
AUV16842.1|2040416_2045519_-	DNA phosphorothioation-dependent restriction protein DptH	NA	NA	NA	NA	NA
AUV16843.1|2045499_2046828_-	DNA phosphorothioation-dependent restriction protein DptG	NA	NA	NA	NA	NA
AUV16844.1|2046830_2048417_-	DNA phosphorothioation-dependent restriction protein DptF	NA	NA	NA	NA	NA
AUV16845.1|2048608_2050150_+|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	4.4e-130
>prophage 10
CP026226	Aeromonas sp. ASNIH7 chromosome, complete genome	4817060	2295190	2351923	4817060	holin,transposase	Acidithiobacillus_phage(22.22%)	49	NA	NA
AUV19104.1|2295190_2295379_+|holin	holin	holin	NA	NA	NA	NA
AUV17021.1|2295494_2296331_-	mechanosensitive ion channel protein	NA	NA	NA	NA	NA
AUV17022.1|2296837_2297434_-	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
AUV17023.1|2297504_2297963_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	64.0	1.4e-52
AUV17024.1|2298039_2299242_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.0	6.4e-44
AUV17025.1|2299389_2300064_+	JAB domain-containing protein	NA	NA	NA	NA	NA
AUV17026.1|2300200_2300437_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AUV17027.1|2300448_2300616_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AUV17028.1|2300706_2301162_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17029.1|2301176_2301989_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	30.0	6.1e-22
AUV17030.1|2302165_2303038_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AUV17031.1|2303111_2303594_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.8	1.8e-29
AUV17032.1|2303815_2304859_+	lipopolysaccharide heptosyltransferase family protein	NA	NA	NA	NA	NA
AUV19105.1|2305199_2305976_-	glycosyltransferase family 2 protein	NA	A0A1C3NFH8	Phage_NCTB	35.8	2.2e-05
AUV17033.1|2306315_2307413_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
AUV17034.1|2307414_2308683_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
AUV17035.1|2308794_2309673_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AUV17036.1|2309856_2310720_-	YicC family protein	NA	NA	NA	NA	NA
AUV17037.1|2310809_2311583_+	ribonuclease PH	NA	NA	NA	NA	NA
AUV17038.1|2311924_2312578_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
AUV17039.1|2312757_2315187_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.7	1.7e-107
AUV17040.1|2315183_2315573_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUV19106.1|2315765_2316881_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUV17041.1|2316911_2317175_+	DUF1040 domain-containing protein	NA	NA	NA	NA	NA
AUV17042.1|2317372_2318821_+	cytochrome c oxidase accessory protein CcoG	NA	NA	NA	NA	NA
AUV17043.1|2318895_2319885_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AUV17044.1|2320094_2320703_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
AUV17045.1|2320777_2321956_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AUV17046.1|2322057_2322693_-	nicotinamidase	NA	NA	NA	NA	NA
AUV17047.1|2322767_2323418_+	DNA mismatch repair protein MutT	NA	NA	NA	NA	NA
AUV17048.1|2323494_2323980_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AUV17049.1|2323925_2324882_-	acyltransferase	NA	NA	NA	NA	NA
AUV17050.1|2324889_2325789_-	acyltransferase	NA	NA	NA	NA	NA
AUV19107.1|2326710_2327400_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
AUV17051.1|2329317_2330208_+|transposase	transposase	transposase	NA	NA	NA	NA
AUV17052.1|2330165_2331299_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17053.1|2331548_2331779_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17054.1|2332051_2332726_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17055.1|2332715_2332898_-	hypothetical protein	NA	NA	NA	NA	NA
AUV17056.1|2334985_2336527_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	5.8e-130
AUV17057.1|2336540_2337296_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.5	4.4e-59
AUV17058.1|2338087_2339944_-	hypothetical protein	NA	NA	NA	NA	NA
AUV17059.1|2339970_2341116_-	DNA (cytosine-5-)-methyltransferase	NA	M1PSQ0	Streptococcus_phage	32.7	2.0e-42
AUV17060.1|2342340_2343741_-	ATP-binding protein	NA	NA	NA	NA	NA
AUV17061.1|2344058_2344331_-	hypothetical protein	NA	NA	NA	NA	NA
AUV17062.1|2344423_2345845_+|transposase	IS66 family transposase ISKpn15	transposase	NA	NA	NA	NA
AUV17063.1|2346575_2348966_-	hypothetical protein	NA	NA	NA	NA	NA
AUV17064.1|2348962_2350753_-	hypothetical protein	NA	NA	NA	NA	NA
AUV17065.1|2350891_2351923_-|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
>prophage 11
CP026226	Aeromonas sp. ASNIH7 chromosome, complete genome	4817060	2547038	2611395	4817060	integrase,transposase	Bacillus_virus(16.67%)	55	2596323:2596338	2614426:2614441
AUV17220.1|2547038_2548376_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
AUV17221.1|2548425_2549505_-	hypothetical protein	NA	NA	NA	NA	NA
AUV17222.1|2549520_2550915_-	phosphatidic acid phosphatase	NA	NA	NA	NA	NA
AUV19114.1|2551069_2551447_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17223.1|2551527_2552934_-	hypothetical protein	NA	NA	NA	NA	NA
AUV17224.1|2553153_2553471_+	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
AUV17225.1|2554490_2555939_-	catalase	NA	A0A2K9L0T1	Tupanvirus	47.3	7.1e-98
AUV17226.1|2556091_2556580_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUV17227.1|2556576_2557434_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUV17228.1|2557503_2558403_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AUV19115.1|2558512_2558953_-	DUF2214 domain-containing protein	NA	NA	NA	NA	NA
AUV17229.1|2559063_2560668_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	26.9	1.4e-09
AUV17230.1|2560691_2561351_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AUV17231.1|2561416_2562424_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	6.4e-29
AUV17232.1|2562430_2563207_-	ABC transporter permease	NA	NA	NA	NA	NA
AUV17233.1|2563199_2564096_-	ABC transporter permease	NA	NA	NA	NA	NA
AUV17234.1|2564095_2564929_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
AUV17235.1|2564939_2565986_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV19116.1|2566184_2566982_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
AUV17236.1|2567028_2567793_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUV17237.1|2568236_2569151_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUV17238.1|2569408_2569741_+	hypothetical protein	NA	NA	NA	NA	NA
AUV19117.1|2569771_2570458_+	pirin family protein	NA	NA	NA	NA	NA
AUV17239.1|2570541_2570934_+	DoxX family protein	NA	NA	NA	NA	NA
AUV17240.1|2571166_2574523_+	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
AUV17241.1|2574522_2578137_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.7	1.8e-09
AUV17242.1|2578145_2580200_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	27.1	1.1e-27
AUV17243.1|2580202_2580757_+	hypothetical protein	NA	NA	NA	NA	NA
AUV19118.1|2580838_2581438_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17244.1|2581606_2583220_-|transposase	IS1634-like element ISAs25 family transposase	transposase	NA	NA	NA	NA
AUV17245.1|2583487_2583886_-	glyoxalase	NA	NA	NA	NA	NA
AUV19119.1|2583964_2584876_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUV17246.1|2584935_2586177_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	37.0	1.4e-57
AUV17247.1|2586202_2586541_-	transcriptional regulator	NA	NA	NA	NA	NA
AUV17248.1|2586927_2587929_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
AUV17249.1|2588058_2588472_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17250.1|2588534_2590529_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.7	6.3e-28
AUV17251.1|2591015_2591372_-	hypothetical protein	NA	NA	NA	NA	NA
AUV19120.1|2591571_2592294_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.7	5.2e-33
AUV17252.1|2593863_2594076_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	73.5	3.9e-21
AUV17253.1|2594464_2594749_-	hypothetical protein	NA	NA	NA	NA	NA
AUV19121.1|2595044_2595167_+	hypothetical protein	NA	NA	NA	NA	NA
2596323:2596338	attL	TTTATTCTTACACTTT	NA	NA	NA	NA
AUV17254.1|2597530_2597839_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUV17255.1|2597937_2598408_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17256.1|2598617_2598809_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17257.1|2599016_2600033_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.9e-186
AUV19122.1|2600070_2600199_-	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	97.2	4.0e-13
AUV17258.1|2600307_2601921_-|transposase	IS1634-like element ISAs25 family transposase	transposase	NA	NA	NA	NA
AUV17259.1|2602067_2602703_-	tetracycline repressor protein class E	NA	NA	NA	NA	NA
AUV17260.1|2603816_2604848_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
AUV17261.1|2605248_2605917_-	hypothetical protein	NA	NA	NA	NA	NA
AUV17262.1|2606454_2608617_-	AAA family ATPase	NA	A0A2I2L5Q3	Orpheovirus	26.2	1.8e-20
AUV17263.1|2608613_2609051_-	hypothetical protein	NA	NA	NA	NA	NA
AUV17264.1|2609050_2609530_-	hypothetical protein	NA	NA	NA	NA	NA
AUV17265.1|2609517_2611395_-|integrase	integrase	integrase	NA	NA	NA	NA
2614426:2614441	attR	TTTATTCTTACACTTT	NA	NA	NA	NA
>prophage 12
CP026226	Aeromonas sp. ASNIH7 chromosome, complete genome	4817060	3371790	3423731	4817060	transposase,tRNA	Acinetobacter_phage(14.29%)	57	NA	NA
AUV17858.1|3371790_3372795_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUV17859.1|3372914_3373130_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17860.1|3373451_3374033_+	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.5	7.3e-70
AUV17861.1|3374310_3375528_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.1	4.0e-25
AUV17862.1|3375603_3376623_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
AUV17863.1|3376690_3378160_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUV17864.1|3378229_3379027_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
AUV17865.1|3379207_3379459_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17866.1|3379498_3380125_-	beta-phosphoglucomutase family hydrolase	NA	A0A1D8KPI1	Synechococcus_phage	26.8	9.2e-10
AUV19176.1|3381756_3382113_-	DUF1622 domain-containing protein	NA	NA	NA	NA	NA
AUV17867.1|3382204_3383125_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	32.0	1.3e-25
AUV17868.1|3383212_3383545_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
AUV17869.1|3383815_3385648_+	SLC13 family permease	NA	NA	NA	NA	NA
AUV17870.1|3387105_3388527_-|transposase	IS66 family transposase ISKpn15	transposase	NA	NA	NA	NA
AUV17871.1|3388960_3389248_-	hypothetical protein	NA	NA	NA	NA	NA
AUV17872.1|3389660_3390935_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
AUV17873.1|3391970_3392183_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AUV17874.1|3392361_3393228_+	RepA	NA	NA	NA	NA	NA
AUV17875.1|3393688_3393919_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUV19177.1|3394336_3394828_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17876.1|3394847_3395492_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17877.1|3395451_3396006_+	molybdenum cofactor carrier	NA	NA	NA	NA	NA
AUV17878.1|3395992_3396277_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17879.1|3396302_3396743_-	hypothetical protein	NA	NA	NA	NA	NA
AUV17880.1|3396864_3397422_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
AUV17881.1|3397415_3397787_-	hypothetical protein	NA	NA	NA	NA	NA
AUV17882.1|3397783_3398284_-|transposase	transposase	transposase	NA	NA	NA	NA
AUV17883.1|3398280_3398607_-	hypothetical protein	NA	NA	NA	NA	NA
AUV17884.1|3398861_3399218_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AUV17885.1|3399454_3399841_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AUV17886.1|3399837_3400128_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AUV17887.1|3400262_3400838_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	52.7	5.6e-46
AUV17888.1|3400964_3401393_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
AUV17889.1|3401992_3402481_+	DUF417 domain-containing protein	NA	NA	NA	NA	NA
AUV19178.1|3402539_3402722_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17890.1|3402957_3403533_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUV17891.1|3403929_3404955_-	oxidoreductase	NA	NA	NA	NA	NA
AUV19179.1|3404954_3405548_-	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AUV17892.1|3405550_3406783_-	OsmC family protein	NA	NA	NA	NA	NA
AUV17893.1|3406927_3407887_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUV17894.1|3408033_3408477_+	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AUV17895.1|3408478_3409018_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AUV17896.1|3409150_3409855_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUV17897.1|3409851_3410820_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
AUV17898.1|3410911_3411484_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17899.1|3411571_3412021_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17900.1|3412127_3412529_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17901.1|3412559_3413831_-	MFS transporter	NA	NA	NA	NA	NA
AUV17902.1|3413818_3414331_-	hypothetical protein	NA	NA	NA	NA	NA
AUV17903.1|3414334_3414805_-	thiol-disulfide isomerase	NA	NA	NA	NA	NA
AUV19180.1|3414956_3415247_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
AUV17904.1|3415309_3415741_-	heme-binding protein	NA	NA	NA	NA	NA
AUV17905.1|3415814_3416825_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AUV17906.1|3417434_3418703_-|transposase	IS4 family transposase ISApu1	transposase	NA	NA	NA	NA
AUV17907.1|3419020_3419392_-	hypothetical protein	NA	NA	NA	NA	NA
AUV17908.1|3419548_3420823_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
AUV17909.1|3420803_3423731_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	99.4	0.0e+00
>prophage 13
CP026226	Aeromonas sp. ASNIH7 chromosome, complete genome	4817060	3469988	3592570	4817060	transposase,tRNA,protease	Escherichia_phage(11.11%)	83	NA	NA
AUV17949.1|3469988_3470528_-|protease	SprT family zinc-dependent metalloprotease	protease	A0A060AI19	Cronobacter_phage	29.5	1.4e-06
AUV17950.1|3470595_3471747_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.8	1.9e-130
AUV17951.1|3472087_3474079_+	transketolase	NA	NA	NA	NA	NA
AUV19184.1|3474258_3474774_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17952.1|3474760_3475402_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17953.1|3475465_3476731_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AUV19185.1|3478041_3478341_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17954.1|3478453_3479578_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
AUV17955.1|3479642_3480953_-	peptidase M23	NA	A0A1P8BKT8	Lactococcus_phage	48.7	5.0e-18
AUV17956.1|3481067_3482267_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
AUV17957.1|3482587_3483391_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUV17958.1|3483402_3483936_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AUV17959.1|3484113_3485370_-	adenylosuccinate synthetase	NA	G5CQQ4	Megavirus	31.8	5.9e-48
AUV17960.1|3485560_3486463_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUV17961.1|3486526_3487873_-	immunogenic protein	NA	NA	NA	NA	NA
AUV17962.1|3488021_3489161_-	aspartate aminotransferase	NA	NA	NA	NA	NA
AUV17963.1|3489325_3490498_+	MFS transporter	NA	NA	NA	NA	NA
AUV17964.1|3490569_3491454_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUV17965.1|3491543_3492299_-	YciK family oxidoreductase	NA	NA	NA	NA	NA
AUV17966.1|3492523_3493531_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	28.1	1.9e-17
AUV17967.1|3493761_3495099_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
AUV17968.1|3495458_3498080_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	34.5	1.6e-87
AUV17969.1|3498448_3498799_-	cysteine methyltransferase	NA	NA	NA	NA	NA
AUV17970.1|3498865_3500419_-	aerotaxis receptor Aer	NA	A0A1B0V854	Salmonella_phage	42.6	1.6e-34
AUV17971.1|3500611_3502468_-	beta-hexosaminidase	NA	A0A076G5S5	Staphylococcus_phage	23.2	1.4e-08
AUV17972.1|3502535_3503408_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AUV17973.1|3503512_3505240_-	chitobiase	NA	NA	NA	NA	NA
AUV17974.1|3505347_3506346_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.9	3.1e-07
AUV17975.1|3507375_3508281_-	ABC transporter permease	NA	NA	NA	NA	NA
AUV17976.1|3508282_3509266_-	ABC transporter permease	NA	NA	NA	NA	NA
AUV17977.1|3509383_3511066_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV19186.1|3511611_3512937_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AUV17978.1|3513338_3513548_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17979.1|3516074_3516989_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17980.1|3517090_3518122_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
AUV17981.1|3518347_3519046_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17982.1|3519554_3520682_+	DUF4172 domain-containing protein	NA	D7RWK9	Brochothrix_phage	25.7	1.7e-06
AUV17983.1|3520757_3521018_-	hypothetical protein	NA	NA	NA	NA	NA
AUV17984.1|3521079_3521490_-	transcriptional regulator	NA	NA	NA	NA	NA
AUV17985.1|3521841_3522141_-	hypothetical protein	NA	NA	NA	NA	NA
AUV17986.1|3522406_3523828_-|transposase	IS66 family transposase ISKpn15	transposase	NA	NA	NA	NA
AUV17987.1|3524267_3524591_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17988.1|3524782_3525469_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.5	2.3e-30
AUV17989.1|3525458_3526826_+|tRNA	tRNA(5-methylaminomethyl-2-thiouridylate) methyltransferase	tRNA	A0A1V0SGX0	Hokovirus	23.9	9.3e-07
AUV17990.1|3529096_3530710_-|transposase	IS1634-like element ISAs25 family transposase	transposase	NA	NA	NA	NA
AUV17991.1|3530897_3531431_-	hypothetical protein	NA	NA	NA	NA	NA
AUV17992.1|3531451_3532309_-	copper resistance protein B	NA	NA	NA	NA	NA
AUV19187.1|3532320_3534255_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
AUV17993.1|3534393_3534720_-	hypothetical protein	NA	NA	NA	NA	NA
AUV17994.1|3534964_3535858_+|transposase	IS5/IS1182 family transposase	transposase	Q38213	Escherichia_phage	86.2	7.4e-154
AUV17995.1|3536226_3537501_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
AUV17996.1|3537899_3538352_+	hypothetical protein	NA	NA	NA	NA	NA
AUV17997.1|3539046_3540537_+	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	81.6	2.0e-220
AUV17998.1|3540556_3541402_+	universal stress protein UspA	NA	A0A2H4J154	uncultured_Caudovirales_phage	46.3	1.9e-63
AUV19188.1|3541547_3542751_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.5	1.2e-114
AUV17999.1|3542952_3543708_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.5	3.4e-59
AUV18000.1|3543722_3545264_-|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	4.4e-130
AUV18001.1|3549557_3549740_-	hypothetical protein	NA	NA	NA	NA	NA
AUV18002.1|3552182_3552938_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.0	2.4e-52
AUV18003.1|3555909_3556941_-|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
AUV19189.1|3557633_3558155_-	hypothetical protein	NA	NA	NA	NA	NA
AUV18004.1|3558180_3561249_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
AUV18005.1|3561245_3562568_-	hypothetical protein	NA	NA	NA	NA	NA
AUV18006.1|3562642_3564049_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AUV18007.1|3564048_3566427_-	N-6 DNA methylase	NA	NA	NA	NA	NA
AUV18008.1|3566438_3568169_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AUV18009.1|3568183_3569092_-	WYL domain-containing protein	NA	NA	NA	NA	NA
AUV18010.1|3569793_3570810_-|transposase	IS5/IS1182 family transposase	transposase	Q38213	Escherichia_phage	97.9	7.8e-184
AUV18011.1|3571306_3571480_-	virulence-associated protein MvpT	NA	NA	NA	NA	NA
AUV18012.1|3571529_3572447_+|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	58.2	2.6e-98
AUV18013.1|3572726_3573149_+	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	55.9	1.5e-35
AUV18014.1|3573152_3574424_+	protein UmuC	NA	F1C5A5	Cronobacter_phage	54.9	1.5e-128
AUV19190.1|3575110_3576040_+	DNA-processing protein DprA	NA	NA	NA	NA	NA
AUV18015.1|3576036_3580713_+	RecQ family ATP-dependent DNA helicase	NA	K7YHB4	Megavirus	31.7	2.1e-34
AUV19191.1|3580709_3581195_+	hypothetical protein	NA	NA	NA	NA	NA
AUV18016.1|3582363_3582567_+	hypothetical protein	NA	NA	NA	NA	NA
AUV18017.1|3582683_3584315_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.0	3.9e-44
AUV18018.1|3584611_3585880_-|transposase	IS4-like element ISAeme4 family transposase	transposase	NA	NA	NA	NA
AUV18019.1|3586074_3586785_-	hypothetical protein	NA	NA	NA	NA	NA
AUV18020.1|3586807_3588157_-	hypothetical protein	NA	NA	NA	NA	NA
AUV18021.1|3589472_3590489_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	1.4e-185
AUV18022.1|3590526_3590745_-	hypothetical protein	NA	Q6QLL3	Human_immunodeficiency_virus	100.0	1.5e-07
AUV18023.1|3591482_3592570_-|transposase	IS3-like element ISAs22 family transposase	transposase	NA	NA	NA	NA
>prophage 14
CP026226	Aeromonas sp. ASNIH7 chromosome, complete genome	4817060	3669014	3695986	4817060	integrase,transposase	Escherichia_phage(25.0%)	20	3658283:3658298	3701700:3701715
3658283:3658298	attL	CCTCCTGGCCGAGCAC	NA	NA	NA	NA
AUV18096.1|3669014_3670046_-|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
AUV18097.1|3670300_3671317_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.9e-186
AUV18098.1|3672503_3672791_+	hypothetical protein	NA	NA	NA	NA	NA
AUV18099.1|3672787_3673006_-	hypothetical protein	NA	NA	NA	NA	NA
AUV18100.1|3673116_3674256_+	DUF4172 domain-containing protein	NA	D7RWK9	Brochothrix_phage	29.8	4.3e-05
AUV18101.1|3674557_3674908_+	NIPSNAP family protein	NA	NA	NA	NA	NA
AUV18102.1|3675013_3675274_-	hypothetical protein	NA	NA	NA	NA	NA
AUV18103.1|3675335_3675743_-	transcriptional regulator	NA	NA	NA	NA	NA
AUV18104.1|3676096_3676396_-	hypothetical protein	NA	NA	NA	NA	NA
AUV18105.1|3676508_3676700_-	hypothetical protein	NA	NA	NA	NA	NA
AUV19195.1|3677177_3677621_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
AUV18106.1|3678931_3680155_+	hypothetical protein	NA	NA	NA	NA	NA
AUV18107.1|3680173_3680986_+	macrocin-O-methyltransferase	NA	A0A285PWA5	Cedratvirus	42.8	3.3e-36
AUV19196.1|3680967_3682194_+	MFS transporter	NA	NA	NA	NA	NA
AUV18108.1|3682371_3683403_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
AUV18109.1|3683498_3684323_-	hypothetical protein	NA	NA	NA	NA	NA
AUV18110.1|3684828_3687690_+	helicase IV	NA	A0A2H4UW05	Bodo_saltans_virus	25.1	1.2e-11
AUV18111.1|3688538_3689570_-|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
AUV18112.1|3691546_3692968_+|transposase	IS66 family transposase ISKpn15	transposase	NA	NA	NA	NA
AUV18113.1|3694378_3695986_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3701700:3701715	attR	GTGCTCGGCCAGGAGG	NA	NA	NA	NA
>prophage 15
CP026226	Aeromonas sp. ASNIH7 chromosome, complete genome	4817060	3986304	4026561	4817060	transposase	Vibrio_phage(16.67%)	33	NA	NA
AUV18342.1|3986304_3987336_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
AUV18343.1|3987563_3988709_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	27.4	5.6e-13
AUV18344.1|3988937_3989594_-	class I SAM-dependent methyltransferase	NA	A0A2P0VPE2	Tetraselmis_virus	28.7	2.8e-09
AUV18345.1|3989721_3990855_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2K9L0G1	Tupanvirus	32.1	2.1e-28
AUV18346.1|3990851_3991856_-	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A1V0SAI8	Catovirus	35.2	5.7e-38
AUV18347.1|3992012_3992870_-	cobalamin-binding protein	NA	NA	NA	NA	NA
AUV19219.1|3992862_3993762_-	cobalamin biosynthesis protein CobD	NA	NA	NA	NA	NA
AUV18348.1|3993821_3994514_-	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
AUV18349.1|3994743_3995673_-	hypothetical protein	NA	NA	NA	NA	NA
AUV18350.1|3997047_3998274_+|transposase	transposase	transposase	O80301	Enterobacteria_phage	78.6	1.0e-153
AUV18351.1|3999469_3999877_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
AUV18352.1|4000609_4001368_-	electron transport complex subunit RsxE	NA	NA	NA	NA	NA
AUV18353.1|4001384_4002017_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
AUV18354.1|4002060_4003113_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
AUV18355.1|4005744_4006311_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
AUV18356.1|4006315_4006897_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
AUV18357.1|4007048_4007309_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	78.9	7.1e-25
AUV18358.1|4007290_4008349_-|transposase	ISAs1 family transposase ISSba1	transposase	NA	NA	NA	NA
AUV18359.1|4008311_4009328_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
AUV18360.1|4009797_4010514_-	hypothetical protein	NA	NA	NA	NA	NA
AUV18361.1|4010582_4010921_-	hypothetical protein	NA	NA	NA	NA	NA
AUV18362.1|4011226_4012525_+	hypothetical protein	NA	NA	NA	NA	NA
AUV18363.1|4012521_4012890_+	hypothetical protein	NA	B7SYE8	Stenotrophomonas_phage	32.4	4.7e-06
AUV18364.1|4015734_4015959_+	hypothetical protein	NA	NA	NA	NA	NA
AUV18365.1|4016161_4017355_+	enoyl-[acyl-carrier-protein] reductase FabV	NA	NA	NA	NA	NA
AUV18366.1|4017517_4018993_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUV18367.1|4019058_4020273_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AUV18368.1|4020629_4020839_+	DUF1653 domain-containing protein	NA	M5ABZ3	Bacillus_phage	50.8	1.2e-09
AUV18369.1|4020898_4021156_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	59.0	7.3e-22
AUV18370.1|4022892_4024653_-	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	41.7	4.9e-93
AUV18371.1|4024775_4025813_-	HlyD family secretion protein	NA	NA	NA	NA	NA
AUV18372.1|4025823_4026093_-	DUF3302 domain-containing protein	NA	NA	NA	NA	NA
AUV18373.1|4026156_4026561_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	6.7e-30
>prophage 1
CP026227	Aeromonas sp. ASNIH7 plasmid pKPC-1ac6, complete sequence	51597	0	13591	51597	integrase,transposase	Escherichia_phage(33.33%)	14	3229:3251	26444:26466
AUV19268.1|1871_2609_-	cell wall hydrolase	NA	NA	NA	NA	NA
AUV19269.1|2619_3114_-	conjugal transfer protein TraL	NA	NA	NA	NA	NA
3229:3251	attL	AATAGGCCAAAATGGCCTATTAT	NA	NA	NA	NA
AUV19270.1|3298_3688_+	hypothetical protein	NA	NA	NA	NA	NA
AUV19271.1|3707_3968_+	hypothetical protein	NA	NA	NA	NA	NA
AUV19272.1|3960_4356_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUV19273.1|4420_4990_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	51.6	1.4e-41
AUV19274.1|5278_6292_-|integrase	integrase/recombinase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.8	1.0e-71
AUV19311.1|6643_7198_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
AUV19275.1|7285_7900_+	lysine transporter LysE	NA	NA	NA	NA	NA
AUV19276.1|8021_8366_+	elongation factor Tu	NA	NA	NA	NA	NA
AUV19277.1|8952_10272_+|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AUV19278.1|10521_11403_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AUV19279.1|11789_12569_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AUV19280.1|12565_13591_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
26444:26466	attR	AATAGGCCAAAATGGCCTATTAT	NA	NA	NA	NA
>prophage 2
CP026227	Aeromonas sp. ASNIH7 plasmid pKPC-1ac6, complete sequence	51597	21296	30984	51597	transposase	Rhodobacter_phage(20.0%)	11	NA	NA
AUV19285.1|21296_23012_-|transposase	transposase	transposase	M4T586	Rhodobacter_phage	25.3	2.2e-05
AUV19286.1|23683_23980_+	addiction module antidote protein, HigA family	NA	NA	NA	NA	NA
AUV19287.1|24152_25532_+	replication protein	NA	D2XQ07	Bacillus_virus	23.0	3.5e-09
AUV19288.1|25591_25789_+	hypothetical protein	NA	NA	NA	NA	NA
AUV19289.1|26126_26405_+	hypothetical protein	NA	NA	NA	NA	NA
AUV19290.1|26515_26941_+	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	38.1	8.1e-18
AUV19291.1|27269_27566_+	transcriptional repressor protein KorC	NA	NA	NA	NA	NA
AUV19292.1|27570_28638_+	TraN	NA	A0A0R6PHM5	Moraxella_phage	35.7	1.4e-34
AUV19293.1|28767_29835_+	hypothetical protein	NA	NA	NA	NA	NA
AUV19294.1|29888_30227_+	transcriptional regulator	NA	NA	NA	NA	NA
AUV19295.1|30231_30984_+	ParA family protein	NA	Q8JL10	Natrialba_phage	30.6	1.3e-10
>prophage 3
CP026227	Aeromonas sp. ASNIH7 plasmid pKPC-1ac6, complete sequence	51597	37046	39995	51597		Idiomarinaceae_phage(100.0%)	1	NA	NA
AUV19299.1|37046_39995_-	hypothetical protein	NA	A0A088F8A2	Idiomarinaceae_phage	31.4	1.2e-19
