The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026238	Citrobacter freundii complex sp. CFNIH9 chromosome, complete genome	5016446	825816	872415	5016446	tRNA,protease,plate	Escherichia_phage(25.0%)	42	NA	NA
AUV42137.1|825816_826239_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AUV42138.1|826244_828077_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AUV45916.1|828043_829087_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AUV42139.1|829103_830390_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AUV42140.1|830386_830920_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AUV42141.1|830922_832266_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AUV42142.1|833090_835829_+	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	31.5	1.2e-85
AUV42143.1|835825_836572_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AUV45917.1|836582_837998_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AUV42144.1|838073_841535_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AUV42145.1|841549_842890_+	hypothetical protein	NA	NA	NA	NA	NA
AUV42146.1|842913_843393_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUV42147.1|843621_844404_-	hypothetical protein	NA	NA	NA	NA	NA
AUV42148.1|845218_845926_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
AUV42149.1|846394_848530_+	ornithine decarboxylase	NA	NA	NA	NA	NA
AUV42150.1|848582_849839_-	nucleoside permease	NA	NA	NA	NA	NA
AUV42151.1|850049_851132_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	4.5e-12
AUV42152.1|851221_851491_-	oxidative damage protection protein	NA	NA	NA	NA	NA
AUV45918.1|851518_852571_-	adenine DNA glycosylase	NA	NA	NA	NA	NA
AUV42153.1|852731_853451_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AUV42154.1|853450_853777_+	DUF469 domain-containing protein	NA	NA	NA	NA	NA
AUV42155.1|853826_854546_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
AUV42156.1|854735_855782_+	L-asparaginase 2	NA	NA	NA	NA	NA
AUV42157.1|855896_857033_-	YggW family oxidoreductase	NA	NA	NA	NA	NA
AUV42158.1|857025_857619_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
AUV42159.1|857626_857917_-	YggU family protein	NA	NA	NA	NA	NA
AUV42160.1|857913_858480_-	YggT family protein	NA	NA	NA	NA	NA
AUV42161.1|858498_859203_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AUV42162.1|859220_860201_+	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AUV42163.1|860197_860614_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AUV42164.1|860613_861177_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
AUV42165.1|861353_862301_-	glutathione synthase	NA	NA	NA	NA	NA
AUV42166.1|862320_863052_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AUV42167.1|863126_863834_-	deoxyribonuclease I	NA	NA	NA	NA	NA
AUV42168.1|863928_864426_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
AUV42169.1|864502_865897_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	25.5	8.3e-27
AUV42170.1|866295_867450_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	6.2e-129
AUV42171.1|868228_868375_+	virulence promoting factor	NA	NA	NA	NA	NA
AUV42172.1|868367_870344_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AUV42173.1|870350_870539_+	hypothetical protein	NA	NA	NA	NA	NA
AUV42174.1|870551_871472_+	agmatinase	NA	NA	NA	NA	NA
AUV42175.1|871656_872415_-|protease	metalloprotease	protease	NA	NA	NA	NA
>prophage 2
CP026238	Citrobacter freundii complex sp. CFNIH9 chromosome, complete genome	5016446	918369	974407	5016446	transposase,integrase	Bacillus_phage(30.77%)	57	916966:916990	980729:980753
916966:916990	attL	TTCGATTCCCTTCGCCCGCTCCAAA	NA	NA	NA	NA
AUV42212.1|918369_919490_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AUV42213.1|920027_920459_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AUV42214.1|920709_922185_-	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	29.7	1.8e-27
AUV42215.1|922177_922858_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.7	7.8e-31
AUV42216.1|922859_922985_+	outer-membrane efflux lipo domain protein	NA	NA	NA	NA	NA
AUV42217.1|923047_924433_+	hypothetical protein	NA	NA	NA	NA	NA
AUV42218.1|924461_924815_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV42219.1|924928_926221_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUV42220.1|926231_929378_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
AUV42221.1|929464_929905_+	hypothetical protein	NA	NA	NA	NA	NA
AUV42222.1|930031_932479_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.4	7.6e-84
AUV42223.1|932519_932717_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AUV42224.1|932750_933488_-	peptidase M23	NA	A8ATH6	Listeria_phage	41.0	3.6e-13
AUV42225.1|933976_934981_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AUV42226.1|935586_936555_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.7	2.1e-186
AUV42227.1|936993_938076_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.6	2.7e-190
AUV42228.1|938198_941270_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
AUV42229.1|941321_942575_+	MFS transporter	NA	NA	NA	NA	NA
AUV42230.1|942631_942802_+	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
AUV42231.1|944027_945032_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AUV42232.1|945390_945840_-	copper resistance protein	NA	NA	NA	NA	NA
AUV42233.1|946074_947892_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AUV42234.1|947891_948788_+	copper resistance protein B	NA	NA	NA	NA	NA
AUV42235.1|948827_949208_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AUV42236.1|949212_950142_+	copper resistance protein CopD	NA	NA	NA	NA	NA
AUV42237.1|950196_950877_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AUV42238.1|950873_952274_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.9	6.4e-19
AUV42239.1|952489_952924_+	copper-binding protein	NA	NA	NA	NA	NA
AUV42240.1|953382_953994_-	DUF3296 domain-containing protein	NA	NA	NA	NA	NA
AUV42241.1|954323_954707_-	hypothetical protein	NA	NA	NA	NA	NA
AUV42242.1|954717_955251_-	secretoglobin family protein	NA	NA	NA	NA	NA
AUV42243.1|955354_955567_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AUV42244.1|955660_956242_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AUV42245.1|956610_956802_+	hypothetical protein	NA	NA	NA	NA	NA
AUV42246.1|957385_958519_+	hypothetical protein	NA	NA	NA	NA	NA
AUV42247.1|958687_959560_+	hypothetical protein	NA	NA	NA	NA	NA
AUV42248.1|959660_960485_+	DUF932 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.0	6.8e-45
AUV42249.1|960693_961404_+	transcriptional regulator	NA	NA	NA	NA	NA
AUV42250.1|961429_961966_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
AUV42251.1|962017_962584_+	hypothetical protein	NA	NA	NA	NA	NA
AUV42252.1|962673_963084_+	hypothetical protein	NA	A0A1B2IBY1	Erwinia_phage	53.0	3.1e-30
AUV42253.1|963161_963401_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AUV42254.1|963503_963962_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	35.5	1.3e-13
AUV42255.1|963977_964454_+	hypothetical protein	NA	NA	NA	NA	NA
AUV42256.1|964462_964684_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
AUV42257.1|964702_965020_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AUV42258.1|965040_965364_+	toxin	NA	NA	NA	NA	NA
AUV42259.1|966327_966627_-	hypothetical protein	NA	NA	NA	NA	NA
AUV42260.1|966991_967198_-	hypothetical protein	NA	NA	NA	NA	NA
AUV45925.1|967203_967764_-|integrase	integrase	integrase	NA	NA	NA	NA
AUV42261.1|970112_970877_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUV42262.1|971276_971666_+	hypothetical protein	NA	NA	NA	NA	NA
AUV42263.1|971658_971997_+	hypothetical protein	NA	NA	NA	NA	NA
AUV42264.1|972602_972893_+	hypothetical protein	NA	NA	NA	NA	NA
AUV42265.1|972896_973274_+	hypothetical protein	NA	NA	NA	NA	NA
AUV45926.1|973301_973388_+	ABC transporter	NA	NA	NA	NA	NA
AUV42266.1|973426_974407_-|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
980729:980753	attR	TTCGATTCCCTTCGCCCGCTCCAAA	NA	NA	NA	NA
>prophage 3
CP026238	Citrobacter freundii complex sp. CFNIH9 chromosome, complete genome	5016446	1310584	1368832	5016446	holin,transposase	Enterobacteria_phage(14.29%)	60	NA	NA
AUV42550.1|1310584_1311565_-|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
AUV42551.1|1312018_1313026_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AUV42552.1|1313018_1313555_+	fimbriae assembly protein	NA	NA	NA	NA	NA
AUV42553.1|1313604_1314237_-	fimbriae biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
AUV42554.1|1314823_1315546_-	fimbriae Y protein	NA	NA	NA	NA	NA
AUV42555.1|1315932_1316526_-	fimbriae biosynthesis transcriptional regulator FimW	NA	NA	NA	NA	NA
AUV42556.1|1316560_1316740_+	hypothetical protein	NA	NA	NA	NA	NA
AUV42557.1|1317020_1318235_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	54.1	2.7e-127
AUV42558.1|1318302_1318527_-	hypothetical protein	NA	NA	NA	NA	NA
AUV42559.1|1318525_1319506_+|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
AUV45938.1|1319544_1319631_-	ABC transporter	NA	NA	NA	NA	NA
AUV42560.1|1319619_1320174_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	61.3	1.5e-48
AUV42561.1|1320745_1320952_+	hypothetical protein	NA	NA	NA	NA	NA
AUV42562.1|1320948_1321212_+|holin	nicotinic acetylcholine receptor subunit beta	holin	NA	NA	NA	NA
AUV42563.1|1321208_1321430_+	hypothetical protein	NA	NA	NA	NA	NA
AUV45939.1|1321519_1322041_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	51.4	1.5e-45
AUV42564.1|1322051_1322444_+	hypothetical protein	NA	NA	NA	NA	NA
AUV42565.1|1322430_1325187_+	propanediol utilization protein	NA	A0A1W6JPG0	Morganella_phage	42.5	2.9e-201
AUV42566.1|1325377_1325830_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AUV42567.1|1326030_1326495_+	hypothetical protein	NA	NA	NA	NA	NA
AUV42568.1|1326491_1326959_+	proQ/FINO family protein	NA	NA	NA	NA	NA
AUV42569.1|1326942_1327932_+	helix-turn-helix domain containing protein	NA	F1C596	Cronobacter_phage	50.5	1.1e-70
AUV42570.1|1328371_1328833_+	hypothetical protein	NA	Q2A0B3	Sodalis_phage	71.1	6.0e-59
AUV42571.1|1328826_1329507_+	DNA transfer protein	NA	Q2A0B2	Sodalis_phage	68.3	3.6e-52
AUV42572.1|1329506_1330826_+	DNA transfer protein p33	NA	B6SCW4	Bacteriophage	44.2	2.7e-35
AUV42573.1|1330822_1333522_+	DNA transfer protein	NA	B9UDL1	Salmonella_phage	54.0	6.7e-166
AUV42574.1|1333567_1333792_-	hypothetical protein	NA	A0A0P0ZD06	Stx2-converting_phage	52.9	1.2e-17
AUV42575.1|1333792_1334128_-	hypothetical protein	NA	NA	NA	NA	NA
AUV42576.1|1335059_1335629_+	hypothetical protein	NA	NA	NA	NA	NA
AUV42577.1|1335727_1335913_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AUV42578.1|1336023_1336269_+	excisionase	NA	S4TND0	Salmonella_phage	64.5	2.2e-23
AUV42579.1|1336521_1337007_-	DUF3368 domain-containing protein	NA	NA	NA	NA	NA
AUV42580.1|1336990_1338055_-	transcriptional regulator	NA	A0A0A7RTT7	Clostridium_phage	28.8	2.0e-25
AUV42581.1|1338482_1339463_-|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
AUV42582.1|1339843_1340422_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUV42583.1|1341039_1342215_-	DNA repair protein	NA	NA	NA	NA	NA
AUV42584.1|1342514_1343600_+	hypothetical protein	NA	NA	NA	NA	NA
AUV45940.1|1343746_1345141_+	phenylalanine transporter	NA	NA	NA	NA	NA
AUV42585.1|1345321_1346563_+	MFS transporter	NA	NA	NA	NA	NA
AUV42586.1|1346578_1347607_+	AP endonuclease	NA	NA	NA	NA	NA
AUV42587.1|1347603_1348755_+	dehydrogenase	NA	NA	NA	NA	NA
AUV42588.1|1348832_1349813_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.2	2.4e-25
AUV42589.1|1349816_1351061_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AUV42590.1|1351126_1351780_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
AUV42591.1|1351899_1352268_-	hypothetical protein	NA	NA	NA	NA	NA
AUV42592.1|1352267_1352849_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUV42593.1|1353039_1354152_+	RomA family MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AUV45941.1|1354169_1354511_+	RamA family antibiotic efflux transcriptional regulator	NA	NA	NA	NA	NA
AUV42594.1|1354532_1354781_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
AUV42595.1|1354848_1355967_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AUV42596.1|1357796_1358450_-	enterobactin synthase subunit EntD	NA	NA	NA	NA	NA
AUV42597.1|1358498_1360772_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUV42598.1|1360791_1360980_-	hypothetical protein	NA	NA	NA	NA	NA
AUV42599.1|1361025_1362243_+	enterochelin esterase	NA	NA	NA	NA	NA
AUV42600.1|1362273_1362492_+	MbtH family protein	NA	NA	NA	NA	NA
AUV42601.1|1362488_1366379_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.6	3.1e-63
AUV42602.1|1366325_1366637_-	hypothetical protein	NA	NA	NA	NA	NA
AUV42603.1|1366649_1367681_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
AUV45942.1|1367726_1367813_+	ABC transporter	NA	NA	NA	NA	NA
AUV42604.1|1367851_1368832_-|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
>prophage 4
CP026238	Citrobacter freundii complex sp. CFNIH9 chromosome, complete genome	5016446	1394577	1402706	5016446		Escherichia_phage(50.0%)	8	NA	NA
AUV42623.1|1394577_1396143_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	1.1e-43
AUV42624.1|1396365_1396920_+	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	29.0	7.6e-08
AUV42625.1|1396916_1399187_+	DMSO reductase	NA	A0A077SK27	Escherichia_phage	25.2	1.5e-46
AUV42626.1|1399183_1399741_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.7	6.2e-26
AUV42627.1|1399740_1400508_+	hydrogenase	NA	NA	NA	NA	NA
AUV42628.1|1400577_1401006_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	1.1e-17
AUV42629.1|1401189_1401600_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
AUV42630.1|1401875_1402706_+	alpha/beta hydrolase	NA	W8EHU1	Mycobacterium_phage	31.2	4.6e-17
>prophage 5
CP026238	Citrobacter freundii complex sp. CFNIH9 chromosome, complete genome	5016446	1721797	1817265	5016446	tRNA,protease,tail,terminase,transposase,capsid,portal,head,holin	Klebsiella_phage(34.62%)	92	NA	NA
AUV42917.1|1721797_1722601_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AUV42918.1|1722593_1723916_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
AUV42919.1|1723896_1724601_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
AUV42920.1|1724600_1729061_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
AUV42921.1|1730040_1731792_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AUV42922.1|1731969_1732518_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	32.6	3.5e-05
AUV42923.1|1732546_1733194_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AUV42924.1|1733247_1734438_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AUV42925.1|1736298_1737699_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.9	5.0e-80
AUV42926.1|1737865_1739068_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AUV42927.1|1739265_1740555_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	96.0	1.0e-244
AUV42928.1|1740599_1740857_-	excisionase	NA	S4TND0	Salmonella_phage	81.0	2.9e-34
AUV42929.1|1740840_1741212_-	hypothetical protein	NA	NA	NA	NA	NA
AUV42930.1|1741312_1741537_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	68.1	1.5e-18
AUV42931.1|1741533_1741959_-	hypothetical protein	NA	NA	NA	NA	NA
AUV42932.1|1741955_1742714_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	41.3	4.3e-38
AUV42933.1|1742706_1742985_-	hypothetical protein	NA	NA	NA	NA	NA
AUV42934.1|1742996_1743503_-	hypothetical protein	NA	F1C5A2	Cronobacter_phage	53.6	1.2e-49
AUV42935.1|1743492_1743732_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	81.7	1.8e-27
AUV42936.1|1743721_1744069_-	hypothetical protein	NA	NA	NA	NA	NA
AUV42937.1|1744510_1744732_-	hypothetical protein	NA	NA	NA	NA	NA
AUV42938.1|1744923_1745625_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	48.5	4.1e-51
AUV42939.1|1745749_1745977_+	transcriptional regulator	NA	A0A0N7C1T6	Escherichia_phage	54.3	7.9e-12
AUV42940.1|1745978_1746272_+	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	82.5	1.1e-29
AUV42941.1|1746699_1748319_+	helicase	NA	F1C598	Cronobacter_phage	86.8	7.8e-279
AUV42942.1|1748315_1749287_+	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	78.3	1.7e-148
AUV42943.1|1749283_1750120_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	77.5	2.2e-123
AUV42944.1|1750430_1750643_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
AUV42945.1|1751196_1751409_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	80.9	3.2e-23
AUV42946.1|1752843_1753032_+	hypothetical protein	NA	NA	NA	NA	NA
AUV42947.1|1753185_1753464_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	98.9	1.5e-44
AUV42948.1|1753435_1753984_+	lysozyme	NA	K7PM52	Enterobacteria_phage	94.0	6.0e-98
AUV42949.1|1753962_1754496_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AUV42950.1|1754492_1754723_+	hypothetical protein	NA	NA	NA	NA	NA
AUV45958.1|1755113_1755311_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	89.2	5.4e-25
AUV42951.1|1755348_1755504_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AUV42952.1|1755882_1756095_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	4.6e-22
AUV45959.1|1756105_1756294_+	cold-shock protein	NA	NA	NA	NA	NA
AUV42953.1|1756367_1756598_+	hypothetical protein	NA	NA	NA	NA	NA
AUV42954.1|1756802_1756976_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
AUV42955.1|1757348_1757888_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	78.1	3.2e-43
AUV42956.1|1758163_1758526_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	87.5	2.2e-56
AUV42957.1|1758661_1759177_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	48.8	2.2e-33
AUV42958.1|1759409_1759844_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.1	1.2e-29
AUV42959.1|1759843_1761565_+|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	58.6	9.1e-193
AUV42960.1|1761558_1761738_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	70.0	6.2e-12
AUV42961.1|1761737_1762997_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.0	8.3e-220
AUV42962.1|1763033_1763954_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	80.1	2.7e-135
AUV42963.1|1764026_1765313_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	2.7e-213
AUV42964.1|1765410_1765788_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	59.5	3.2e-18
AUV45960.1|1765768_1766086_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	79.6	2.8e-39
AUV42965.1|1766082_1766433_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	74.8	5.4e-44
AUV42966.1|1766401_1766791_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	65.3	6.7e-43
AUV42967.1|1766787_1767189_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	88.0	1.2e-58
AUV42968.1|1767222_1767705_+|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	80.6	6.1e-62
AUV42969.1|1767766_1768129_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	56.8	4.8e-27
AUV45961.1|1768149_1768380_+	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	61.8	2.5e-21
AUV42970.1|1768379_1771721_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	65.2	0.0e+00
AUV42971.1|1771721_1772054_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	67.9	1.8e-41
AUV42972.1|1772062_1772758_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	70.1	1.5e-93
AUV42973.1|1772769_1773504_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	77.5	4.2e-115
AUV42974.1|1773401_1774079_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	66.7	1.2e-79
AUV42975.1|1774150_1777537_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	70.3	0.0e+00
AUV42976.1|1779509_1780094_+	DUF4376 domain-containing protein	NA	Q7BQC6	Enterobacteria_phage	49.5	3.6e-48
AUV42977.1|1780093_1780459_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.2	7.2e-15
AUV42978.1|1780507_1780849_+	hypothetical protein	NA	NA	NA	NA	NA
AUV42979.1|1781033_1781285_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	4.6e-29
AUV45962.1|1781488_1782121_+	hypothetical protein	NA	NA	NA	NA	NA
AUV42980.1|1782149_1783553_-|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
AUV42981.1|1783637_1784036_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	70.9	4.1e-48
AUV42982.1|1784953_1785181_-	hypothetical protein	NA	NA	NA	NA	NA
AUV42983.1|1785481_1785700_-	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	66.2	2.6e-20
AUV42984.1|1786386_1794969_+	cyclic beta 1-2 glucan synthetase	NA	NA	NA	NA	NA
AUV45963.1|1794988_1795222_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	56.6	6.4e-17
AUV42985.1|1796085_1796334_-	virulence protein MsgA	NA	K7PKM2	Enterobacterial_phage	92.1	8.8e-33
AUV42986.1|1796760_1799373_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	1.8e-19
AUV42987.1|1799469_1800237_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	2.0e-30
AUV42988.1|1800233_1801025_-	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
AUV42989.1|1801035_1802181_-	alkanesulfonate monooxygenase, FMNH(2)-dependent	NA	NA	NA	NA	NA
AUV42990.1|1802177_1803152_-	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV42991.1|1803144_1803720_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
AUV42992.1|1803963_1804974_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AUV42993.1|1805139_1805682_+	cell division protein ZapC	NA	NA	NA	NA	NA
AUV42994.1|1805678_1806785_-	hypothetical protein	NA	NA	NA	NA	NA
AUV42995.1|1806883_1808992_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
AUV42996.1|1809004_1810912_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	1.3e-51
AUV42997.1|1810927_1812181_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AUV42998.1|1812185_1813826_+	MCE family protein	NA	NA	NA	NA	NA
AUV42999.1|1813822_1814386_+	hypothetical protein	NA	NA	NA	NA	NA
AUV43000.1|1814642_1814810_+	ribosome modulation factor	NA	NA	NA	NA	NA
AUV45964.1|1814917_1815436_-	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AUV43001.1|1815504_1817265_-|protease	Lon protease	protease	NA	NA	NA	NA
>prophage 6
CP026238	Citrobacter freundii complex sp. CFNIH9 chromosome, complete genome	5016446	2402489	2430142	5016446	tail,terminase,transposase,head,plate	Salmonella_phage(21.43%)	35	NA	NA
AUV43544.1|2402489_2403893_-|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
AUV43545.1|2404215_2404749_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AUV45995.1|2404745_2405276_-	lysozyme	NA	Q7Y3V3	Yersinia_phage	79.8	1.2e-79
AUV43546.1|2405265_2405541_-	diacylglyceryl transferase	NA	I6R0S9	Salmonella_phage	50.0	6.4e-08
AUV43547.1|2405541_2405880_-	hypothetical protein	NA	NA	NA	NA	NA
AUV43548.1|2405880_2406495_-	hypothetical protein	NA	NA	NA	NA	NA
AUV43549.1|2406577_2406844_-	hypothetical protein	NA	A0A077KGV8	Edwardsiella_phage	45.5	2.0e-06
AUV43550.1|2406854_2408912_-|tail	tail tape measure protein	tail	NA	NA	NA	NA
AUV43551.1|2409039_2409525_-	hypothetical protein	NA	NA	NA	NA	NA
AUV43552.1|2409517_2409946_-	hypothetical protein	NA	NA	NA	NA	NA
AUV43553.1|2409948_2411307_-	hypothetical protein	NA	E5AGB4	Erwinia_phage	27.5	8.6e-37
AUV43554.1|2411307_2412090_-	hypothetical protein	NA	NA	NA	NA	NA
AUV43555.1|2412089_2412443_-	hypothetical protein	NA	NA	NA	NA	NA
AUV43556.1|2412439_2412913_-	hypothetical protein	NA	NA	NA	NA	NA
AUV43557.1|2413034_2413394_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
AUV43558.1|2413403_2413658_-	hypothetical protein	NA	NA	NA	NA	NA
AUV43559.1|2413661_2414600_-	DUF2184 domain-containing protein	NA	E5AGA8	Erwinia_phage	31.1	1.7e-28
AUV43560.1|2414617_2415409_-	hypothetical protein	NA	A0A286KIG6	Salmonella_phage	55.3	7.3e-12
AUV43561.1|2415408_2416422_-	DUF2213 domain-containing protein	NA	A0A291LCH5	Klebsiella_phage	28.0	1.3e-13
AUV43562.1|2416399_2417755_-|head	phage head morphogenesis protein	head	A9DEG6	Yersinia_phage	23.8	3.5e-06
AUV43563.1|2417741_2419094_-	DUF1073 domain-containing protein	NA	NA	NA	NA	NA
AUV43564.1|2419090_2420500_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	33.8	2.2e-59
AUV43565.1|2420486_2421035_-	hypothetical protein	NA	NA	NA	NA	NA
AUV45996.1|2421357_2421513_-	protein hokG	NA	NA	NA	NA	NA
AUV43566.1|2421757_2422285_-	hypothetical protein	NA	NA	NA	NA	NA
AUV43567.1|2422590_2424123_+	hypothetical protein	NA	NA	NA	NA	NA
AUV43568.1|2424140_2424656_+	recombinase	NA	Q5QBN4	Enterobacteria_phage	47.5	6.8e-35
AUV43569.1|2424769_2425939_+	hypothetical protein	NA	X2KTY7	Enterobacteria_phage	57.1	1.0e-33
AUV43570.1|2425938_2426517_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	56.5	3.1e-60
AUV43571.1|2426532_2426802_-	hypothetical protein	NA	H6WRY4	Salmonella_phage	63.6	2.7e-27
AUV43572.1|2426886_2427519_-	hypothetical protein	NA	NA	NA	NA	NA
AUV43573.1|2427518_2427755_-	hypothetical protein	NA	NA	NA	NA	NA
AUV43574.1|2427754_2427985_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AUV43575.1|2427977_2428733_-	hypothetical protein	NA	NA	NA	NA	NA
AUV43576.1|2428732_2430142_-|plate	baseplate protein	plate	A0A2D0YGH8	Vibrio_phage	23.4	7.1e-18
>prophage 7
CP026238	Citrobacter freundii complex sp. CFNIH9 chromosome, complete genome	5016446	2603770	2611940	5016446	tRNA,integrase	Escherichia_phage(28.57%)	10	2602386:2602398	2608745:2608757
2602386:2602398	attL	CGACCGCATGCTG	NA	NA	NA	NA
AUV43734.1|2603770_2604895_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	61.2	2.7e-121
AUV43735.1|2605042_2605255_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
AUV43736.1|2605336_2605771_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	1.2e-29
AUV43737.1|2605956_2606199_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	3.4e-29
AUV43738.1|2606541_2606784_+|integrase	integrase	integrase	A0A0U2JGI6	Escherichia_phage	78.2	1.5e-32
AUV43739.1|2606833_2607769_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.5	9.8e-141
AUV43740.1|2607847_2609221_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.3e-52
2608745:2608757	attR	CAGCATGCGGTCG	NA	NA	NA	NA
AUV43741.1|2609249_2609417_-	hypothetical protein	NA	NA	NA	NA	NA
AUV43742.1|2609692_2610676_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AUV43743.1|2610830_2611940_-	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.9	1.2e-09
>prophage 8
CP026238	Citrobacter freundii complex sp. CFNIH9 chromosome, complete genome	5016446	2848496	2928889	5016446	tail,terminase,transposase,head,plate,integrase	Vibrio_phage(37.04%)	115	2849287:2849317	2926642:2926672
AUV43958.1|2848496_2849138_-	protein-serine/threonine phosphatase	NA	Q71TJ1	Escherichia_phage	50.2	3.9e-56
2849287:2849317	attL	CACATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
AUV43959.1|2849488_2849878_-	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	70.5	9.6e-50
AUV43960.1|2849956_2850199_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	80.5	2.4e-30
AUV43961.1|2850268_2850685_-|tail	tail assembly chaperone	tail	NA	NA	NA	NA
AUV43962.1|2851750_2852473_-	hypothetical protein	NA	A0A2P9HXZ0	Yersinia_phage	52.7	1.3e-68
AUV43963.1|2852469_2853651_-	hypothetical protein	NA	A0A2I7QS90	Vibrio_phage	47.4	2.5e-101
AUV43964.1|2853634_2854015_-	hypothetical protein	NA	A0A2H5BFY4	Vibrio_phage	59.3	1.6e-25
AUV43965.1|2854011_2854629_-	hypothetical protein	NA	A0A2I7QS79	Vibrio_phage	49.3	5.1e-53
AUV43966.1|2854743_2855424_-	hypothetical protein	NA	NA	NA	NA	NA
AUV43967.1|2855504_2856455_-	hypothetical protein	NA	A0A2P9HXK2	Yersinia_phage	45.8	2.0e-69
AUV43968.1|2856454_2856790_-	hypothetical protein	NA	A0A2I7RBP0	Vibrio_phage	52.1	4.7e-29
AUV43969.1|2856793_2857597_-	hypothetical protein	NA	A0A2P9HXI6	Yersinia_phage	42.2	1.6e-46
AUV43970.1|2857596_2859393_-	hypothetical protein	NA	A0A2I7QS75	Vibrio_phage	45.5	9.5e-84
AUV43971.1|2859546_2859960_-	hypothetical protein	NA	A0A2P9HXM8	Yersinia_phage	45.9	5.1e-25
AUV43972.1|2859968_2860400_-	hypothetical protein	NA	A0A2P9HXY3	Yersinia_phage	53.1	1.1e-33
AUV43973.1|2860410_2861913_-	hypothetical protein	NA	A0A2I7QS67	Vibrio_phage	59.4	4.0e-160
AUV43974.1|2861913_2862402_-	hypothetical protein	NA	A0A2I7QS82	Vibrio_phage	58.6	2.1e-41
AUV43975.1|2862398_2862755_-	hypothetical protein	NA	NA	NA	NA	NA
AUV43976.1|2862751_2863324_-	hypothetical protein	NA	A0A2P9HXJ3	Yersinia_phage	40.4	8.3e-26
AUV43977.1|2863711_2864203_-	hypothetical protein	NA	NA	NA	NA	NA
AUV43978.1|2864434_2864671_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	57.6	3.0e-14
AUV43979.1|2864670_2866653_+|transposase	transposase	transposase	A0A0C4UR24	Shigella_phage	51.6	2.2e-190
AUV43980.1|2866748_2867687_+	hypothetical protein	NA	A0A0C4UQR3	Shigella_phage	47.8	5.0e-76
AUV43981.1|2867691_2867931_+	hypothetical protein	NA	NA	NA	NA	NA
AUV43982.1|2867933_2868224_+	hypothetical protein	NA	C9DGL7	Escherichia_phage	44.9	7.0e-13
AUV43983.1|2868236_2868488_+	hypothetical protein	NA	NA	NA	NA	NA
AUV43984.1|2868495_2869023_+	host-nuclease inhibitor protein Gam	NA	A0A125RNF6	Pseudomonas_phage	57.9	6.7e-46
AUV43985.1|2869106_2869409_+	hypothetical protein	NA	NA	NA	NA	NA
AUV43986.1|2869364_2869634_-	hypothetical protein	NA	NA	NA	NA	NA
AUV43987.1|2869701_2870229_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	50.6	2.6e-42
AUV43988.1|2870225_2870633_+	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	63.5	2.3e-38
AUV43989.1|2870645_2871164_+	hypothetical protein	NA	NA	NA	NA	NA
AUV43990.1|2871249_2871840_+	peptidoglycan-binding protein	NA	A0A2I7S9B9	Vibrio_phage	46.2	1.8e-36
AUV43991.1|2871841_2872060_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	69.4	1.0e-24
AUV43992.1|2872052_2872460_+	hypothetical protein	NA	NA	NA	NA	NA
AUV43993.1|2872447_2873056_+	hypothetical protein	NA	NA	NA	NA	NA
AUV43994.1|2873052_2873259_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AUV43995.1|2873259_2873565_+	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	38.3	5.6e-13
AUV46012.1|2873577_2873865_+	hypothetical protein	NA	M1PPT9	Vibrio_phage	64.5	4.6e-25
AUV43996.1|2873867_2874242_+	hypothetical protein	NA	NA	NA	NA	NA
AUV43997.1|2874234_2874513_+	hypothetical protein	NA	NA	NA	NA	NA
AUV43998.1|2874502_2875081_+	DUF3486 domain-containing protein	NA	M4MCR3	Vibrio_phage	54.5	4.8e-45
AUV43999.1|2875077_2876661_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	68.7	3.0e-198
AUV44000.1|2876660_2878229_+	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.0	1.9e-157
AUV44001.1|2878221_2879016_+	hypothetical protein	NA	M4M9M5	Vibrio_phage	57.9	4.6e-91
AUV44002.1|2879219_2880176_+	peptidase	NA	M1Q578	Vibrio_phage	51.0	1.2e-80
AUV44003.1|2880179_2881073_+|head	phage head protein	head	M4MB71	Vibrio_phage	56.4	1.3e-94
AUV44004.1|2881156_2881750_+	hypothetical protein	NA	NA	NA	NA	NA
AUV44005.1|2881749_2882190_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.9	2.4e-33
AUV44006.1|2882189_2882732_+	phage morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	59.8	1.1e-54
AUV44007.1|2882728_2883352_+	hypothetical protein	NA	M4MHF0	Vibrio_phage	43.5	2.4e-34
AUV44008.1|2883332_2883521_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AUV44009.1|2883520_2884999_+|tail	phage tail protein	tail	M1Q565	Vibrio_phage	54.0	5.1e-152
AUV44010.1|2885008_2885365_+|tail	phage tail protein	tail	A0A2I7S9D5	Vibrio_phage	44.6	1.6e-22
AUV44011.1|2885368_2885764_+	hypothetical protein	NA	M1NVT1	Vibrio_phage	43.7	3.1e-19
AUV44012.1|2885850_2887773_+|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	35.2	9.6e-58
AUV44013.1|2887772_2889104_+	multidrug DMT transporter	NA	A0A2I7S9E8	Vibrio_phage	36.8	1.0e-74
AUV44014.1|2889103_2890195_+|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	46.0	1.4e-90
AUV44015.1|2890185_2890728_+|plate	phage baseplate assembly protein V	plate	M1Q572	Vibrio_phage	40.9	8.4e-28
AUV44016.1|2890724_2891177_+	hypothetical protein	NA	M1PPW1	Vibrio_phage	42.8	4.0e-23
AUV44017.1|2891166_2892243_+|plate	phage baseplate protein	plate	A0A2I7S9E5	Vibrio_phage	53.4	2.1e-102
AUV44018.1|2892227_2892818_+	DUF2313 domain-containing protein	NA	M4M9M8	Vibrio_phage	49.7	2.8e-53
AUV44019.1|2892817_2893600_+|integrase	integrase	integrase	K7P7Q7	Enterobacteria_phage	54.7	2.1e-40
AUV44020.1|2893599_2894199_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	55.3	1.5e-54
AUV44021.1|2894170_2894623_-|tail	phage tail protein	tail	M1SNQ2	Escherichia_phage	56.0	5.7e-38
AUV44022.1|2895106_2895661_+	recombinase family protein	NA	A0A1B0VBM1	Salmonella_phage	81.8	2.2e-76
AUV44023.1|2895687_2896011_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
AUV44024.1|2896025_2896994_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44025.1|2896997_2897480_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44026.1|2897482_2898625_-	hypothetical protein	NA	A0A2H4J159	uncultured_Caudovirales_phage	33.5	1.7e-14
AUV44027.1|2898628_2899480_-	hypothetical protein	NA	Q7Y5U5	Haemophilus_phage	32.5	2.4e-29
AUV44028.1|2899457_2900780_-	hypothetical protein	NA	L7TRA1	Rhizobium_phage	24.6	3.8e-21
AUV44029.1|2900779_2902198_-|terminase	terminase	terminase	A0A2K9V3I6	Faecalibacterium_phage	40.9	1.4e-85
AUV44030.1|2902163_2903162_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	46.6	4.1e-44
AUV44031.1|2903165_2903354_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44032.1|2903729_2903933_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	68.3	5.2e-15
AUV44033.1|2903889_2904162_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	69.0	4.2e-20
AUV44034.1|2904158_2904638_-	lysozyme	NA	U5P0A9	Shigella_phage	75.6	4.9e-64
AUV44035.1|2904641_2904911_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44036.1|2904907_2905285_-	hypothetical protein	NA	A0A248XD00	Klebsiella_phage	31.7	4.4e-07
AUV46013.1|2905503_2905914_+	hypothetical protein	NA	K7P7K4	Enterobacteria_phage	96.3	3.3e-69
AUV44037.1|2906110_2906920_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	70.6	5.3e-111
AUV44038.1|2906916_2907057_-	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	95.5	1.0e-17
AUV44039.1|2907053_2907662_-	protein NinG	NA	A0A0M4RU10	Salmonella_phage	64.0	2.2e-48
AUV44040.1|2907664_2907871_-	hypothetical protein	NA	K7PJT9	Enterobacteria_phage	77.3	1.1e-25
AUV44041.1|2907870_2908470_-	hypothetical protein	NA	K7PKS6	Enterobacteria_phage	98.0	2.7e-107
AUV44042.1|2908563_2908851_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44043.1|2909141_2910011_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46014.1|2910025_2910142_+	ABC transporter	NA	NA	NA	NA	NA
AUV44044.1|2910180_2911161_-|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
AUV44045.1|2911229_2911844_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44046.1|2911853_2912621_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44047.1|2912743_2913091_-	hypothetical protein	NA	Q5G8U8	Enterobacteria_phage	75.0	1.0e-10
AUV44048.1|2913087_2913333_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44049.1|2913918_2914230_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44050.1|2914248_2914998_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	88.0	6.2e-122
AUV46015.1|2915000_2915843_-	hypothetical protein	NA	Q6V7R6	Burkholderia_virus	68.8	6.1e-25
AUV44051.1|2915907_2916099_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44052.1|2916184_2916724_-	regulator	NA	K7PJT7	Enterobacteria_phage	84.4	2.1e-79
AUV44053.1|2916763_2916973_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	81.2	8.8e-26
AUV46016.1|2917115_2917784_+	phage repressor protein C	NA	A0A2D1GM27	Escherichia_phage	67.8	8.7e-91
AUV44054.1|2917805_2918960_+	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	27.8	1.9e-32
AUV44055.1|2919216_2919651_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	77.8	5.6e-06
AUV46017.1|2919968_2920175_+	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	98.5	1.6e-32
AUV44056.1|2920488_2923251_+	exodeoxyribonuclease VIII	NA	K7P6V4	Enterobacteria_phage	66.2	0.0e+00
AUV44057.1|2923262_2924375_+	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	93.0	9.1e-194
AUV44058.1|2924409_2924754_+	hypothetical protein	NA	NA	NA	NA	NA
AUV44059.1|2924746_2924950_+	hypothetical protein	NA	A0A1B0VN94	Pseudomonas_phage	66.7	1.7e-10
AUV44060.1|2924936_2925179_+	DUF4060 domain-containing protein	NA	K7PHF4	Enterobacteria_phage	91.1	1.0e-33
AUV44061.1|2925242_2925515_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	64.4	1.9e-28
AUV44062.1|2925483_2926569_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	69.0	2.5e-148
AUV44063.1|2926905_2927244_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
2926642:2926672	attR	CACATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
AUV44064.1|2927264_2928137_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44065.1|2928140_2928515_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AUV44066.1|2928658_2928889_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
>prophage 9
CP026238	Citrobacter freundii complex sp. CFNIH9 chromosome, complete genome	5016446	2949555	2980913	5016446	tRNA,transposase,tail	Bacillus_virus(20.0%)	35	NA	NA
AUV44086.1|2949555_2950536_-|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
AUV46019.1|2951372_2952269_+	cytoplasmic protein	NA	NA	NA	NA	NA
AUV44087.1|2952523_2953135_+	hypothetical protein	NA	NA	NA	NA	NA
AUV44088.1|2953126_2953648_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
AUV44089.1|2953682_2954426_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUV44090.1|2954454_2954898_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AUV44091.1|2954899_2956672_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AUV44092.1|2956959_2957526_+	hydrolase	NA	NA	NA	NA	NA
AUV44093.1|2957522_2958017_+	hypothetical protein	NA	Q859D1	Escherichia_coli_phage	81.1	2.5e-58
AUV44094.1|2958069_2959593_+	recombinase family protein	NA	NA	NA	NA	NA
AUV44095.1|2959589_2960369_-	hypothetical protein	NA	A0A0A0RP36	Citrobacter_phage	70.5	5.5e-89
AUV46020.1|2960461_2962288_-|tail	phage tail tape measure protein	tail	A0A0H3UDV5	Escherichia_phage	40.7	1.5e-52
AUV44096.1|2962393_2963425_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
AUV44097.1|2963873_2964089_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44098.1|2964112_2964529_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44099.1|2964537_2965257_-|transposase	transposase	transposase	NA	NA	NA	NA
AUV44100.1|2965640_2966672_-|transposase	IS630 family transposase ISEc33	transposase	NA	NA	NA	NA
AUV44101.1|2966958_2967183_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44102.1|2967182_2967509_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44103.1|2967655_2967871_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44104.1|2967870_2968092_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44105.1|2968091_2968382_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44106.1|2968514_2968700_+	hypothetical protein	NA	NA	NA	NA	NA
AUV44107.1|2968725_2969016_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44108.1|2969012_2969984_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44109.1|2971212_2972616_+|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
AUV46021.1|2972644_2973277_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46022.1|2973797_2974517_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44110.1|2974721_2975072_+	hypothetical protein	NA	NA	NA	NA	NA
AUV44111.1|2975246_2975642_+	hypothetical protein	NA	NA	NA	NA	NA
AUV44112.1|2975682_2976426_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
AUV44113.1|2976422_2977391_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AUV44114.1|2977625_2978372_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AUV44115.1|2978374_2978941_-	VOC family protein	NA	NA	NA	NA	NA
AUV44116.1|2979179_2980913_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	1.3e-85
>prophage 10
CP026238	Citrobacter freundii complex sp. CFNIH9 chromosome, complete genome	5016446	3061140	3107538	5016446	tail,terminase,transposase,portal,plate,holin,integrase	Escherichia_phage(21.62%)	54	3071229:3071243	3107814:3107828
AUV44200.1|3061140_3062121_-|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
AUV46026.1|3062248_3062362_+	virulence protein	NA	S4TND2	Salmonella_phage	81.1	4.7e-10
AUV44201.1|3062490_3063042_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	87.3	1.1e-86
AUV44202.1|3063071_3064346_+	hypothetical protein	NA	A0A1S6KZZ0	Salmonella_phage	44.6	1.0e-60
AUV44203.1|3064358_3064889_+|tail	phage tail protein	tail	F1BUK2	Cronobacter_phage	35.3	2.4e-19
AUV44204.1|3064860_3065400_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	38.1	1.9e-24
AUV44205.1|3065568_3066600_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
AUV44206.1|3068599_3069163_-|tail	phage tail protein I	tail	Q7Y4D5	Escherichia_virus	37.3	8.2e-26
AUV44207.1|3069152_3070073_-|plate	baseplate assembly protein	plate	A0A088FQL4	Escherichia_phage	48.8	5.0e-65
AUV44208.1|3070056_3070410_-|plate	baseplate assembly protein	plate	R9TRM1	Vibrio_phage	54.1	5.0e-21
AUV44209.1|3070449_3071568_-	late control protein D	NA	R9TNM7	Vibrio_phage	33.1	9.6e-34
3071229:3071243	attL	CTCCGGGTTGTTTCT	NA	NA	NA	NA
AUV44210.1|3071569_3071785_-|tail	phage tail protein	tail	R9TR63	Vibrio_phage	52.9	3.3e-12
AUV44211.1|3071759_3072230_-|tail	phage tail protein	tail	V5YTC2	Pseudomonas_phage	40.6	1.6e-19
AUV44212.1|3072226_3074149_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	31.4	1.3e-25
AUV44213.1|3074251_3074551_-|tail	phage tail assembly protein	tail	Q75QK8	Wolbachia_phage	31.6	5.5e-05
AUV44214.1|3074609_3075116_-|tail	phage tail protein	tail	NA	NA	NA	NA
AUV44215.1|3075112_3076582_-|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	37.3	1.9e-74
AUV44216.1|3076620_3077238_-|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	35.4	1.1e-12
AUV44217.1|3077230_3077785_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44218.1|3077796_3078453_-	hypothetical protein	NA	D5LGZ7	Escherichia_phage	35.3	9.0e-16
AUV44219.1|3078454_3078811_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44220.1|3078810_3079146_-	hypothetical protein	NA	A0A2K9V343	Faecalibacterium_phage	32.1	5.6e-06
AUV44221.1|3081276_3082788_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	54.6	3.8e-150
AUV44222.1|3082796_3083012_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44223.1|3083008_3085126_-	DNA packaging protein	NA	A0A291AWY5	Escherichia_phage	70.1	1.8e-304
AUV46027.1|3085129_3085636_-|terminase	terminase	terminase	K7PJY2	Enterobacterial_phage	63.7	3.1e-48
AUV44224.1|3086733_3086982_+	CsbD family protein	NA	NA	NA	NA	NA
AUV46028.1|3087643_3088141_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	77.3	3.2e-58
AUV44225.1|3088164_3088713_-	lysozyme	NA	K7PM52	Enterobacteria_phage	95.6	6.4e-100
AUV44226.1|3088684_3088963_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	100.0	3.9e-45
AUV44227.1|3089121_3089346_+	DUF2116 family Zn-ribbon domain-containing protein	NA	NA	NA	NA	NA
AUV46029.1|3090259_3090859_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	75.4	1.7e-85
AUV44228.1|3090872_3091913_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	49.7	5.7e-97
AUV44229.1|3091909_3092269_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	63.6	1.7e-40
AUV44230.1|3092271_3092472_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	61.5	1.9e-17
AUV44231.1|3092601_3092847_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	62.2	1.3e-20
AUV44232.1|3092892_3093126_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	83.1	2.7e-31
AUV44233.1|3093467_3094448_+|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
AUV46030.1|3094486_3094645_-	ABC transporter	NA	NA	NA	NA	NA
AUV44234.1|3095104_3095401_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUV44235.1|3095467_3095893_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	2.1e-50
AUV44236.1|3095905_3097195_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.2	5.1e-172
AUV44237.1|3097242_3098994_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AUV44238.1|3099011_3099374_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AUV44239.1|3099421_3099775_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	4.8e-24
AUV44240.1|3099898_3100489_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	77.5	3.5e-67
AUV44241.1|3101519_3102074_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44242.1|3102077_3102290_-	XRE family transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	59.7	3.8e-16
AUV44243.1|3102395_3102776_+	transcriptional regulator	NA	K7PH71	Enterobacterial_phage	66.7	6.5e-19
AUV44244.1|3102994_3103210_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46031.1|3103267_3103594_+	transcriptional regulator	NA	NA	NA	NA	NA
AUV44245.1|3103735_3106207_+	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	57.4	6.9e-109
AUV44246.1|3106277_3106520_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AUV44247.1|3106494_3107538_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	55.2	3.9e-98
3107814:3107828	attR	AGAAACAACCCGGAG	NA	NA	NA	NA
>prophage 11
CP026238	Citrobacter freundii complex sp. CFNIH9 chromosome, complete genome	5016446	3270378	3279955	5016446	protease	Bacillus_phage(28.57%)	8	NA	NA
AUV44389.1|3270378_3271782_+	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	29.2	2.3e-32
AUV44390.1|3271778_3272501_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
AUV44391.1|3272636_3272969_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AUV44392.1|3273128_3274490_+	U32 family peptidase	NA	Q6DW11	Phage_TP	92.9	6.3e-205
AUV44393.1|3274758_3277035_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
AUV44394.1|3277065_3277386_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
AUV44395.1|3277709_3277934_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
AUV44396.1|3278008_3279955_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.8	2.4e-40
>prophage 12
CP026238	Citrobacter freundii complex sp. CFNIH9 chromosome, complete genome	5016446	3320526	3329153	5016446	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
AUV44432.1|3320526_3322560_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	5.2e-54
AUV44433.1|3322765_3323224_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	69.3	1.2e-51
AUV46041.1|3323267_3323738_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	76.8	7.0e-63
AUV44434.1|3323784_3324504_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AUV44435.1|3324500_3326186_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
AUV44436.1|3326411_3327143_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.0e-105
AUV44437.1|3327402_3327510_+	hypothetical protein	NA	NA	NA	NA	NA
AUV44438.1|3327490_3328222_-	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AUV44439.1|3328205_3329153_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	1.6e-21
>prophage 13
CP026238	Citrobacter freundii complex sp. CFNIH9 chromosome, complete genome	5016446	3678633	3696912	5016446	holin	Morganella_phage(30.0%)	18	NA	NA
AUV44744.1|3678633_3680175_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.6	1.1e-160
AUV44745.1|3680889_3681081_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44746.1|3681724_3681913_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46060.1|3682309_3683008_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44747.1|3683175_3685893_-	DNA transfer protein	NA	A5VW64	Enterobacteria_phage	53.6	4.2e-160
AUV44748.1|3685892_3687197_-	DNA transfer protein p33	NA	B6SCW4	Bacteriophage	47.6	1.4e-36
AUV44749.1|3687196_3687853_-	DNA transfer protein	NA	Q2A0B2	Sodalis_phage	65.2	4.3e-50
AUV44750.1|3687846_3688308_-	DUF2824 domain-containing protein	NA	Q2A0B3	Sodalis_phage	73.8	1.9e-60
AUV44751.1|3688747_3689737_-	helix-turn-helix domain containing protein	NA	F1C596	Cronobacter_phage	52.0	4.6e-72
AUV44752.1|3689720_3690206_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44753.1|3690847_3693607_-	DNA primase	NA	A0A1W6JPG0	Morganella_phage	55.5	1.4e-283
AUV44754.1|3693593_3693986_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46061.1|3693996_3694518_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	51.4	1.5e-45
AUV44755.1|3694607_3694829_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44756.1|3694825_3695089_-|holin	nicotinic acetylcholine receptor subunit beta	holin	NA	NA	NA	NA
AUV46062.1|3695284_3695482_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AUV46063.1|3695839_3696442_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	56.7	1.3e-48
AUV44757.1|3696465_3696912_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	54.0	7.7e-27
>prophage 14
CP026238	Citrobacter freundii complex sp. CFNIH9 chromosome, complete genome	5016446	3813943	3888630	5016446	tRNA,transposase,integrase	Escherichia_phage(33.33%)	57	3852907:3852966	3888639:3889834
AUV44854.1|3813943_3814711_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AUV44855.1|3814755_3815304_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUV44856.1|3815322_3815571_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUV44857.1|3815820_3817182_-	signal recognition particle protein	NA	NA	NA	NA	NA
AUV44858.1|3817347_3818139_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AUV44859.1|3818157_3819447_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AUV44860.1|3819496_3820090_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUV44861.1|3820086_3820281_-	molecular chaperone GrpE	NA	NA	NA	NA	NA
AUV44862.1|3820212_3821091_+	NAD(+) kinase	NA	NA	NA	NA	NA
AUV44863.1|3821176_3822838_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AUV44864.1|3822987_3823332_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AUV44865.1|3823382_3823679_-	RnfH family protein	NA	NA	NA	NA	NA
AUV44866.1|3823662_3824118_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AUV46069.1|3824260_3824743_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.2e-28
AUV44867.1|3825326_3836534_+	large repetitive protein	NA	NA	NA	NA	NA
AUV44868.1|3836634_3838044_+	type I secretion protein TolC	NA	NA	NA	NA	NA
AUV44869.1|3838040_3840227_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	29.8	5.5e-17
AUV46070.1|3840234_3841398_+	secretion protein HlyD	NA	NA	NA	NA	NA
AUV46071.1|3841999_3843229_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	87.8	2.5e-208
AUV44870.1|3843385_3844993_-	sporadically distributed, TIGR04141 family protein	NA	NA	NA	NA	NA
AUV44871.1|3845011_3845647_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
AUV44872.1|3845643_3846756_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	NA	NA	NA	NA
AUV44873.1|3846748_3848137_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	28.3	2.5e-47
AUV44874.1|3848136_3848409_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
AUV44875.1|3849148_3850303_+	hypothetical protein	NA	NA	NA	NA	NA
AUV44876.1|3850295_3852170_+	hypothetical protein	NA	NA	NA	NA	NA
AUV44877.1|3852162_3852651_+	hypothetical protein	NA	NA	NA	NA	NA
3852907:3852966	attL	GGAAGGTGCGAACAAGTTCCTGATATGAGATCATCATATTCATCCGGAGCGCATCCCAGA	NA	NA	NA	NA
AUV44878.1|3852974_3853955_+|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
AUV44879.1|3854984_3856295_-|integrase	integrase	integrase	NA	NA	NA	NA
AUV44880.1|3856287_3857490_-|integrase	integrase	integrase	NA	NA	NA	NA
AUV44881.1|3857772_3858087_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44882.1|3858108_3858315_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	44.0	7.6e-06
AUV44883.1|3858597_3859443_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44884.1|3859942_3861184_+	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	47.3	7.7e-101
AUV44885.1|3861631_3863626_-	DUF3732 domain-containing protein	NA	NA	NA	NA	NA
AUV44886.1|3863622_3864090_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46072.1|3864080_3865250_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44887.1|3866003_3867077_+	hypothetical protein	NA	NA	NA	NA	NA
AUV44888.1|3867335_3868352_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
AUV44889.1|3868689_3870150_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
AUV44890.1|3870273_3871446_+	putative C-S lyase	NA	NA	NA	NA	NA
AUV44891.1|3871600_3872236_+	carbonic anhydrase	NA	NA	NA	NA	NA
AUV44892.1|3872444_3873383_+	hypothetical protein	NA	NA	NA	NA	NA
AUV44893.1|3873435_3874452_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.5	4.7e-80
AUV44894.1|3874498_3875890_-	DUF4832 domain-containing protein	NA	NA	NA	NA	NA
AUV44895.1|3875921_3876329_-	hypothetical protein	NA	NA	NA	NA	NA
AUV44896.1|3876331_3877444_-	DUF1972 domain-containing protein	NA	NA	NA	NA	NA
AUV44897.1|3877445_3878657_-	glycosyltransferase family 1 protein	NA	A0A2P0VNG4	Tetraselmis_virus	30.6	3.2e-11
AUV44898.1|3878671_3879661_-	glycosyl transferase	NA	NA	NA	NA	NA
AUV44899.1|3879665_3881036_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
AUV44900.1|3881032_3882244_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
AUV44901.1|3882240_3884370_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
AUV44902.1|3884372_3884930_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
AUV44903.1|3884931_3886218_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
AUV44904.1|3886207_3887536_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
AUV46073.1|3887524_3887611_+	ABC transporter	NA	NA	NA	NA	NA
AUV44905.1|3887649_3888630_-|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
3888639:3889834	attR	TCTGGGATGCGCTCCGGATGAATATGATGATCTCATATCAGGAACTTGTTCGCACCTTCCTTAAAGGGCACCAAACCCAGCAGATGGGCGCTAAAAATTAACGTCACATTGATAACAATGAAATCGACCAGTTTTAAAAAGACTGGATATCCTTGGCTGCTAATCTTTAGCGATTTTTTAAGCATATCTCAGCCCATTATTTATTGATCTTTAATTGTTTTTTTCTCATTTCATGTTGCTAATTATATCACAAGTCTAAAAAACGCAATGGTACATTGTCAGTAAATGTAAAAAATAATACTCATTACTGTGACAACACTCCCCAGTGAAATCGTATCTATATGATTTTAATGCAGATGACATCAATAGAAGTTTTATCTACCTCAGCAAAAAAGATAACCTTTAACAACATTTTCGCTATTGACAGATAACATCTCATGGTCTATGAAAAAATGTTTTATGTATGATAAATTGCACAAAAGTATTGTTTCAGTGACGTTGAATCACCTTAGAGTTGCTGTTTAATACCGTAATTAAAATAAAAAACAGCTGCCTTACGACAACATTTCAAATGATATTAATAATACAATTAATTACTTTTTATTATAATTAAACAACAAATATCATCGCCATGAATACCTCATACGGTAACGCTTAAAAAGCGTACCCGAACCCTCAGCCCACCTAATGTCTCACTACGCGTTAGCTGAGGATGCGTGCGATGCAGACGAGCAATATCATTGACCAGCGCCAGGCCGATTCCGGCGCCTGGGACATTGCCAACGTTATCAAGACGATGAAACGGTAGCAGAGCCTGATGAACCATCTGCTCATCTATGCCCGGCCCGCTATCTTCGACTACCAGCACCACGGCCTCTCCTTCTCGTTGCAGCCGGGCGGTCACCATCCCCTGCGACGGCGTGTATTTCAGTGCGTTATCCAGCAGATTCCCACACAGTTCACCGAGCAGCACTTCATCTCCCTCGACCCACACCGCGTCCTGTTCCCCCTCATAGCCCAGATCGATCCCTTTACTACGCGACTGCGCCAGTCGGGTAAAACAGCTGGTTTGCACCACCTCATACAGATTAACCGGCGAGAAATGCCTTTCCCCCTGCTCCTTGCGCTTCACCGCAGACAGCTGCAACAGCCTCTCCGTCAGTTGAATGGTATTATCGAGCGTGCTACTCATGGCT	NA	NA	NA	NA
>prophage 15
CP026238	Citrobacter freundii complex sp. CFNIH9 chromosome, complete genome	5016446	4007901	4074859	5016446	protease,capsid,transposase,integrase	Escherichia_phage(25.0%)	60	4063143:4063168	4077543:4077568
AUV45022.1|4007901_4008882_+|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
AUV45023.1|4008863_4009067_+	hypothetical protein	NA	NA	NA	NA	NA
AUV45024.1|4009441_4011328_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.6	7.0e-53
AUV45025.1|4011368_4012820_-	bifunctional 2-methylcitrate dehydratase/aconitate hydratase	NA	NA	NA	NA	NA
AUV45026.1|4012860_4014030_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
AUV45027.1|4014110_4014992_-	methylisocitrate lyase	NA	NA	NA	NA	NA
AUV45028.1|4015245_4016856_+	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
AUV45029.1|4016888_4017164_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AUV45030.1|4017489_4018122_+	hypothetical protein	NA	NA	NA	NA	NA
AUV45031.1|4018201_4019590_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUV45032.1|4019810_4020905_+	electron transporter YccM	NA	NA	NA	NA	NA
AUV45033.1|4021049_4021598_+	hypothetical protein	NA	NA	NA	NA	NA
AUV45034.1|4022041_4024150_-	ferrioxamine B receptor FoxA	NA	NA	NA	NA	NA
AUV45035.1|4024271_4025255_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUV45036.1|4025379_4026285_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.4	4.7e-15
AUV45037.1|4026394_4027024_+	LysE family translocator	NA	NA	NA	NA	NA
AUV45038.1|4027125_4027362_-	hypothetical protein	NA	NA	NA	NA	NA
AUV45039.1|4027460_4028090_-	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
AUV45040.1|4028412_4029774_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUV45041.1|4029770_4031027_-	peptidase T	NA	NA	NA	NA	NA
AUV45042.1|4032347_4032605_+	hypothetical protein	NA	NA	NA	NA	NA
AUV45043.1|4032615_4033362_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUV45044.1|4033418_4033982_-|protease	protease	protease	NA	NA	NA	NA
AUV45045.1|4034385_4035498_+	agmatine deiminase	NA	M1H3B1	Paramecium_bursaria_Chlorella_virus	35.4	5.7e-55
AUV45046.1|4036284_4037289_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AUV46078.1|4037302_4039552_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AUV45047.1|4039738_4041127_-	Putrescine importer PuuP	NA	NA	NA	NA	NA
AUV45048.1|4041470_4042889_-	glutamine synthetase	NA	NA	NA	NA	NA
AUV45049.1|4043101_4043866_+	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	NA	NA	NA	NA
AUV45050.1|4043891_4044449_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AUV45051.1|4044587_4046075_+	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
AUV45052.1|4046077_4047358_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AUV46079.1|4047566_4048694_+	[Ni/Fe] hydrogenase small subunit	NA	NA	NA	NA	NA
AUV45053.1|4048690_4050484_+	hydrogenase 2 large subunit	NA	NA	NA	NA	NA
AUV45054.1|4050502_4051237_+	Ni/Fe-hydrogenase, b-type cytochrome subunit	NA	NA	NA	NA	NA
AUV45055.1|4051233_4051815_+	HyaD/HybD family hydrogenase maturation endopeptidase	NA	NA	NA	NA	NA
AUV45056.1|4051820_4052222_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
AUV46080.1|4052221_4053079_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
AUV45057.1|4053166_4054711_+	cytochrome d terminal oxidase subunit 1	NA	NA	NA	NA	NA
AUV45058.1|4054722_4055859_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AUV45059.1|4055872_4055962_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
AUV45060.1|4056014_4056728_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUV45061.1|4056920_4058390_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AUV45062.1|4058514_4058964_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUV45063.1|4059131_4060136_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.1e-23
AUV45064.1|4060289_4061741_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
AUV45065.1|4061753_4062935_+	aminotransferase	NA	NA	NA	NA	NA
4063143:4063168	attL	AATGGTGCCGATAATAGGAGTCGAAC	NA	NA	NA	NA
AUV45066.1|4063301_4064585_+|integrase	integrase	integrase	A0A0E3Y5J2	Fusobacterium_phage	30.1	1.6e-08
AUV45067.1|4064604_4065279_-	hypothetical protein	NA	A0A291LAA9	Escherichia_phage	71.8	1.8e-72
AUV45068.1|4065308_4067165_-	hypothetical protein	NA	A0A291LB80	Escherichia_phage	29.4	3.9e-32
AUV45069.1|4067157_4067358_-	hypothetical protein	NA	NA	NA	NA	NA
AUV45070.1|4067493_4068531_-|capsid	major capsid protein E	capsid	NA	NA	NA	NA
AUV45071.1|4068549_4068927_-	hypothetical protein	NA	NA	NA	NA	NA
AUV45072.1|4068930_4069155_-	hypothetical protein	NA	NA	NA	NA	NA
AUV45073.1|4069798_4070131_-	hypothetical protein	NA	NA	NA	NA	NA
AUV45074.1|4070120_4070330_-	hypothetical protein	NA	NA	NA	NA	NA
AUV45075.1|4070322_4070703_-	hypothetical protein	NA	NA	NA	NA	NA
AUV45076.1|4070714_4070999_-	hypothetical protein	NA	NA	NA	NA	NA
AUV45077.1|4071009_4072332_-	hypothetical protein	NA	A0A1W5PTH8	Pseudoalteromonas_phage	27.0	3.8e-05
AUV45078.1|4074277_4074859_+|integrase	integrase	integrase	NA	NA	NA	NA
4077543:4077568	attR	AATGGTGCCGATAATAGGAGTCGAAC	NA	NA	NA	NA
>prophage 1
CP026240	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-1cb6, complete sequence	61837	3911	45918	61837	coat,integrase,tRNA,transposase	Escherichia_phage(30.0%)	55	7357:7371	36603:36617
AUV46171.1|3911_5072_-|coat	spore coat protein CotH	coat	NA	NA	NA	NA
AUV46239.1|5074_5623_-	DNA distortion polypeptide 1	NA	NA	NA	NA	NA
AUV46172.1|5950_6208_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46173.1|6450_6792_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46174.1|6888_7128_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46175.1|7120_7387_-	hypothetical protein	NA	NA	NA	NA	NA
7357:7371	attL	TGTTTTTTCTGTCAC	NA	NA	NA	NA
AUV46176.1|7398_7941_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46177.1|7984_8500_-	molecular chaperone DnaJ	NA	NA	NA	NA	NA
AUV46178.1|8691_8910_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46179.1|10033_10936_+	replication initiation protein	NA	NA	NA	NA	NA
AUV46180.1|10944_11388_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46181.1|11561_11918_+	DNA distortion polypeptide 3	NA	NA	NA	NA	NA
AUV46182.1|11914_12892_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46183.1|12916_13198_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AUV46184.1|13294_13957_-	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.1	6.5e-06
AUV46240.1|14293_14941_+	resolvase	NA	M9Q1K0	Clostridium_phage	29.1	6.1e-09
AUV46185.1|15083_15788_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
AUV46186.1|15764_15992_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUV46187.1|16021_16540_-	DUF417 domain-containing protein	NA	NA	NA	NA	NA
AUV46188.1|17270_17645_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
AUV46189.1|18180_18426_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46190.1|18505_18772_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46191.1|18941_19223_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
AUV46192.1|19290_19563_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	41.9	7.5e-09
AUV46193.1|20016_20763_-	oxidoreductase	NA	NA	NA	NA	NA
AUV46194.1|20755_21358_-	sulfite oxidase-like oxidoreductase	NA	NA	NA	NA	NA
AUV46195.1|21825_22296_+	thiol-disulfide isomerase	NA	NA	NA	NA	NA
AUV46196.1|22427_22625_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46197.1|22621_22915_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
AUV46198.1|22973_23405_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46199.1|23477_24419_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AUV46200.1|24866_25835_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
AUV46201.1|25831_26536_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUV46202.1|26676_27216_-	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AUV46203.1|27217_27661_-	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AUV46204.1|27943_29065_-|transposase	ISAs1-like element ISPa60 family transposase	transposase	NA	NA	NA	NA
AUV46205.1|29419_30223_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	36.2	5.2e-34
AUV46241.1|30215_31715_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	26.7	1.8e-11
AUV46206.1|32181_32559_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46207.1|32636_32828_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46208.1|32860_33157_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46209.1|33171_34131_-|integrase	integrase	integrase	A0A1P8DJ76	Virus_Rctr85	29.0	1.4e-12
AUV46210.1|34127_34679_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUV46211.1|35007_36012_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AUV46242.1|36524_37106_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	48.9	2.5e-41
36603:36617	attR	TGTTTTTTCTGTCAC	NA	NA	NA	NA
AUV46212.1|37696_38392_-|transposase	IS6 family transposase ISEas1	transposase	A0A0N9RU54	Staphylococcus_phage	37.0	4.9e-36
AUV46213.1|38988_39609_+	chromosome partitioning protein ParA	NA	A2I303	Vibrio_virus	35.0	1.8e-21
AUV46214.1|39647_39875_+	DNA partition complex ParG	NA	NA	NA	NA	NA
AUV46215.1|40006_40291_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUV46216.1|40283_40526_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AUV46217.1|41532_42555_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV46218.1|44012_44273_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46219.1|44383_45202_-	sprT domain-containing protein	NA	NA	NA	NA	NA
AUV46220.1|45204_45438_-	antirestriction protein ArdR	NA	NA	NA	NA	NA
AUV46221.1|45648_45918_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
>prophage 1
CP026241	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-e790, complete sequence	200651	51485	70852	200651	transposase,integrase	Stx2-converting_phage(30.0%)	13	49686:49701	72184:72199
49686:49701	attL	CTGGCAGGAGCAGGTA	NA	NA	NA	NA
AUV46303.1|51485_53612_+|integrase	integrase	integrase	NA	NA	NA	NA
AUV46304.1|53766_54975_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.9	9.3e-35
AUV46305.1|55008_56442_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AUV46306.1|56745_58884_-	AAA family ATPase	NA	NA	NA	NA	NA
AUV46307.1|60912_61878_-	plasmid-partitioning protein	NA	I3WF22	Macacine_betaherpesvirus	77.5	8.8e-137
AUV46308.1|61877_63044_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	94.3	1.1e-218
AUV46309.1|63869_65228_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	47.5	1.3e-117
AUV46310.1|65284_66820_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
AUV46311.1|66869_67217_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
AUV46312.1|67213_67597_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
AUV46313.1|67705_68857_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	9.8e-42
AUV46314.1|68813_69020_-|transposase	transposase	transposase	NA	NA	NA	NA
AUV46315.1|69958_70852_-|transposase	IS5/IS1182 family transposase	transposase	Q38213	Escherichia_phage	86.8	4.3e-154
72184:72199	attR	CTGGCAGGAGCAGGTA	NA	NA	NA	NA
>prophage 2
CP026241	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-e790, complete sequence	200651	73957	92923	200651	transposase,integrase	uncultured_Caudovirales_phage(25.0%)	20	70430:70446	76151:76167
70430:70446	attL	CAGCCAGCGATTGATGG	NA	NA	NA	NA
AUV46318.1|73957_74698_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AUV46319.1|74872_75016_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AUV46320.1|75773_76796_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
76151:76167	attR	CCATCAATCGCTGGCTG	NA	NA	NA	NA
AUV46321.1|77302_78781_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	73.2	1.9e-194
AUV46322.1|78798_79626_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	40.3	4.9e-51
AUV46323.1|79707_79911_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46324.1|80188_80419_-	thioredoxin family protein	NA	NA	NA	NA	NA
AUV46325.1|81590_82100_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AUV46448.1|82250_82436_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46326.1|82690_83644_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV46327.1|84264_84975_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	3.7e-31
AUV46328.1|84976_86182_-	ABC transporter permease	NA	NA	NA	NA	NA
AUV46329.1|86178_87330_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUV46330.1|87326_87935_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUV46331.1|88122_89076_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV46332.1|89494_89824_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
AUV46333.1|89804_90086_+	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
AUV46334.1|90363_91344_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
AUV46335.1|91382_91508_-	ABC transporter	NA	NA	NA	NA	NA
AUV46336.1|91649_92923_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	2.8e-146
>prophage 3
CP026241	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-e790, complete sequence	200651	123112	174357	200651	transposase,integrase	Escherichia_phage(38.89%)	53	151742:151801	172131:172952
AUV46455.1|123112_124459_-|transposase	ISNCY family transposase ISLad2	transposase	NA	NA	NA	NA
AUV46456.1|124686_125319_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46373.1|125347_126751_-|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
AUV46374.1|126965_127280_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46457.1|127566_127842_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46375.1|127855_128281_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46376.1|128990_130514_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AUV46377.1|130807_131218_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46378.1|131609_132761_-|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AUV46379.1|132717_133074_-|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	91.2	1.7e-32
AUV46380.1|133542_134049_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46381.1|134206_134608_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46458.1|135030_136237_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.7e-101
AUV46382.1|137298_137487_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46383.1|137638_139096_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AUV46384.1|141202_141586_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
AUV46385.1|141582_141930_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
AUV46386.1|141979_143515_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
AUV46387.1|144200_144878_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46388.1|144877_145315_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46389.1|145311_146817_+	hypothetical protein	NA	A0A0K2FLP8	Brevibacillus_phage	25.3	4.7e-20
AUV46390.1|146828_147533_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV46391.1|147690_148455_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AUV46392.1|148645_149002_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46393.1|148947_149532_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUV46394.1|149531_150770_-	MFS transporter	NA	NA	NA	NA	NA
AUV46395.1|150766_151672_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
151742:151801	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
AUV46396.1|151793_152498_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV46397.1|152730_153591_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AUV46398.1|153603_154146_+	tunicamycin resistance protein	NA	NA	NA	NA	NA
AUV46399.1|154627_154819_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46400.1|154824_155070_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46401.1|155120_156257_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
AUV46402.1|156371_157742_+|transposase	IS1182 family transposase ISCfr1	transposase	NA	NA	NA	NA
AUV46403.1|158562_159423_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AUV46404.1|159948_160953_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AUV46405.1|161031_161466_-	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AUV46406.1|161537_161888_+	mercuric transporter	NA	NA	NA	NA	NA
AUV46407.1|161901_162177_+	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AUV46459.1|162212_162635_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AUV46408.1|162686_164381_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AUV46409.1|164398_164761_+	transcriptional regulator	NA	NA	NA	NA	NA
AUV46410.1|164757_164994_+	mercury resistance protein	NA	NA	NA	NA	NA
AUV46411.1|164990_165698_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AUV46412.1|165736_167041_+|integrase	integrase	integrase	NA	NA	NA	NA
AUV46413.1|167087_167792_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV46414.1|168281_169391_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
AUV46415.1|169485_170670_-	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
AUV46416.1|170765_171422_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUV46417.1|171433_172138_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV46418.1|172281_172923_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
AUV46419.1|173072_173573_-	hypothetical protein	NA	NA	NA	NA	NA
172131:172952	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCTTCTGAAACGAAATTACAGATTACGGTTAAAATATAAAAAAAAGCCACCAATCCTGCCGGATACGGTGGCTTAAATACAGAATTAATTAATTTATTTCAGTATGTTATCACACATCAGCTGAAGTGTATTGATAAACCTTGCTGCATGAAAACCATCACAGACTGCATGATGAACCTGTACAGAAACAGGTAATAGTACGCGGTCACCTTCCTGCTGAAACTTTGCCATTGTAAAAACCGGGGAAAAATAATCATCATTTCCGGTGATATTCAGATTAAATCCGTCAAAACTCACCCAGGGTAACGATGATATATTCAGGTGATTCTCCGGTAAATTTCCCTGCGGAAACAACCTGGTATCATGCTGATATTCTGCTGTTACCGCGTTATAACCCGCCATAAACTCACTGAGATCCGGAAAATAACGGCAGGACAGTGCGGAGAATGTTTCGGTTTCTTTATGAAAGACAGTAAAGACCGGGTCTGACTGTTCCCAGTAAATCAGTTCATTATCTTTCATTGCCATCCGGAACTCCGGAAACTGATTAACAGCCCGGGAGATCAGGTAAATCATCAGCGGATAAAACTTATAACCGGTTTTCGCCAGTGCAGTACGCAAAGCGGTAATATCGAGTTTGGTGGTCAGGCTGAATCCGCATTTAATCTGCTGACGATAAAGGGCAAAATGTTCCCTGCGATTCCAGGTATTCAGGTCAATCCGGGTAAAATTCATGGTTATTCCTTCTGATTAATAGTGAAAAA	NA	NA	NA	NA
AUV46420.1|173652_174357_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
CP026242	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence	355789	0	1570	355789		Mycobacterium_phage(100.0%)	1	NA	NA
AUV46460.1|1054_1570_+	nuclease	NA	V5UN65	Mycobacterium_phage	28.9	3.2e-08
>prophage 2
CP026242	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence	355789	20657	22969	355789		Caulobacter_phage(33.33%)	3	NA	NA
AUV46477.1|20657_21233_-	tellurium resistance protein TerE	NA	K4JRX3	Caulobacter_phage	39.6	5.6e-30
AUV46478.1|21301_21880_-	tellurium resistance protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
AUV46479.1|21928_22969_-	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
>prophage 3
CP026242	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence	355789	26000	30962	355789		Acinetobacter_phage(66.67%)	5	NA	NA
AUV46483.1|26000_26582_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	2.2e-13
AUV46484.1|26904_27963_+	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
AUV46485.1|27972_29115_+	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	1.5e-29
AUV46486.1|29107_29881_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46487.1|29882_30962_+	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	34.7	2.5e-39
>prophage 4
CP026242	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence	355789	62763	64675	355789		Salinibacter_virus(50.0%)	2	NA	NA
AUV46514.1|62763_63945_+	S49 family peptidase	NA	A0A2I6UG67	Salinibacter_virus	29.5	7.8e-10
AUV46797.1|63961_64675_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	37.7	3.4e-08
>prophage 5
CP026242	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence	355789	68830	72674	355789		Yersinia_phage(25.0%)	6	NA	NA
AUV46522.1|68830_70036_-	DNA-binding protein	NA	A0A2P9HXK7	Yersinia_phage	29.7	9.1e-14
AUV46523.1|70533_70728_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46524.1|71210_71594_+	hypothetical protein	NA	A0A0K1YAK5	Cronobacter_phage	45.2	4.4e-07
AUV46525.1|71604_71859_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46526.1|71858_72275_+	hypothetical protein	NA	A0A2D2W6B4	Pectobacterium_phage	41.8	2.2e-12
AUV46799.1|72392_72674_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	37.8	3.2e-07
>prophage 6
CP026242	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence	355789	75874	122313	355789	transposase	Bacillus_phage(20.0%)	47	NA	NA
AUV46534.1|75874_76162_-	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AUV46535.1|76161_76401_-	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AUV46536.1|76425_76620_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46537.1|76663_77587_-	cation transporter	NA	NA	NA	NA	NA
AUV46800.1|77786_78359_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
AUV46538.1|78462_78675_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46539.1|78834_80073_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	22.4	2.4e-09
AUV46540.1|80357_81518_+|transposase	IS30 family transposase ISCfr4	transposase	W5R8L2	Staphylococcus_phage	36.7	4.6e-39
AUV46541.1|81716_83057_-|transposase	transposase	transposase	NA	NA	NA	NA
AUV46542.1|84332_84614_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46543.1|84921_85275_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46544.1|85504_85711_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46545.1|85745_85970_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46546.1|86415_86709_-	hypothetical protein	NA	I7B2L9	Escherichia_phage	35.6	2.4e-05
AUV46547.1|86792_87284_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
AUV46548.1|87412_88444_+|transposase	IS630 family transposase ISEc33	transposase	NA	NA	NA	NA
AUV46549.1|88449_88755_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46550.1|88954_89335_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46551.1|89419_89668_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46552.1|89701_89938_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	1.1e-05
AUV46553.1|90870_91479_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46801.1|91509_92034_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	62.7	2.1e-44
AUV46554.1|92067_92376_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46555.1|92372_93104_-	hypothetical protein	NA	Q71T76	Escherichia_phage	56.0	1.6e-66
AUV46556.1|93209_93434_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46557.1|93491_93986_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46558.1|95726_96056_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46559.1|96260_99032_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46560.1|99099_100250_-	DDE domain-containing protein	NA	U5P429	Shigella_phage	41.5	5.4e-48
AUV46561.1|100294_100783_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46562.1|101641_101938_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUV46563.1|102361_103018_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUV46802.1|103080_104064_-	oxidoreductase	NA	NA	NA	NA	NA
AUV46564.1|105275_105551_+	regulator protein FrmR	NA	NA	NA	NA	NA
AUV46565.1|105585_106695_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.3	4.9e-30
AUV46566.1|106738_107137_+	VOC family protein	NA	NA	NA	NA	NA
AUV46567.1|107201_108038_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AUV46568.1|108530_109607_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV46569.1|110148_111672_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AUV46570.1|111965_112337_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46571.1|112904_113213_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46572.1|113631_116283_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.1	5.4e-152
AUV46573.1|116961_118200_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	22.4	2.4e-09
AUV46574.1|118715_119849_-	aldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.8	9.7e-10
AUV46575.1|120280_120607_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
AUV46576.1|120755_120989_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46577.1|121074_122313_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	22.4	2.4e-09
>prophage 7
CP026242	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence	355789	144561	149131	355789		Caulobacter_phage(66.67%)	7	NA	NA
AUV46597.1|144561_145173_-	hypothetical protein	NA	K4JV11	Caulobacter_phage	40.3	5.2e-26
AUV46598.1|145234_145870_-	hypothetical protein	NA	K4JV11	Caulobacter_phage	40.4	1.4e-26
AUV46599.1|145985_146306_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46600.1|146306_146741_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46601.1|146876_147254_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46602.1|147644_148826_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46603.1|148834_149131_-	toxin-plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	36.2	8.4e-06
>prophage 8
CP026242	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence	355789	152988	154769	355789		Citrobacter_phage(33.33%)	4	NA	NA
AUV46609.1|152988_153345_+	hypothetical protein	NA	A0A076YMQ7	Citrobacter_phage	42.3	2.4e-07
AUV46610.1|153396_153651_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46611.1|153686_153986_+	hypothetical protein	NA	A0A2P1JU39	Erwinia_phage	60.0	9.4e-05
AUV46612.1|154064_154769_+	hypothetical protein	NA	M1EZB9	Cronobacter_phage	27.9	1.8e-17
>prophage 9
CP026242	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence	355789	159257	162728	355789		Salmonella_phage(50.0%)	4	NA	NA
AUV46615.1|159257_160139_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	41.3	5.0e-54
AUV46805.1|160726_161230_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46616.1|162070_162343_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46617.1|162335_162728_+	DNA-binding protein	NA	Q71TH9	Escherichia_phage	62.6	1.0e-43
>prophage 10
CP026242	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence	355789	190005	198655	355789		Halomonas_phage(25.0%)	11	NA	NA
AUV46642.1|190005_190644_-	ATPase	NA	B0ZSI1	Halomonas_phage	40.1	1.1e-31
AUV46643.1|190640_190895_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46808.1|190909_191752_-	RepA replication protein	NA	NA	NA	NA	NA
AUV46644.1|191778_192063_-	DNA-binding protein	NA	NA	NA	NA	NA
AUV46645.1|192175_192943_-	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
AUV46810.1|193286_193637_-	DUF2958 domain-containing protein	NA	A0A1W6DX76	Sphingobium_phage	45.1	1.3e-18
AUV46809.1|193956_194250_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUV46646.1|194246_194456_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46647.1|194552_194867_-	DUF736 domain-containing protein	NA	NA	NA	NA	NA
AUV46648.1|195677_197744_-	chromosome partitioning protein ParB	NA	G8DH78	Emiliania_huxleyi_virus	26.8	2.4e-22
AUV46649.1|197824_198655_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	39.6	8.4e-43
>prophage 11
CP026242	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence	355789	203243	209041	355789	transposase	Bacillus_phage(50.0%)	5	NA	NA
AUV46654.1|203243_205043_+	ATP-dependent helicase	NA	S5M596	Bacillus_phage	23.5	1.8e-29
AUV46655.1|205331_205628_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46656.1|205633_206665_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
AUV46657.1|206807_207734_+	hypothetical protein	NA	NA	NA	NA	NA
AUV46658.1|207973_209041_-	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	32.9	3.7e-35
>prophage 12
CP026242	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence	355789	216335	225144	355789		Salmonella_phage(100.0%)	8	NA	NA
AUV46663.1|216335_218012_-	restriction endonuclease subunit M	NA	J9Q747	Salmonella_phage	31.0	3.4e-67
AUV46664.1|218277_219432_-	DNA-binding protein	NA	A0A060D5B2	Salmonella_phage	27.8	6.9e-19
AUV46811.1|219792_220617_+	DNA modification methylase	NA	A0A1C9II58	Salmonella_phage	37.8	2.6e-44
AUV46665.1|220631_221453_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46666.1|221719_222439_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46667.1|222435_222636_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46668.1|222653_223727_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	34.1	2.9e-11
AUV46669.1|224268_225144_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	42.8	1.0e-59
>prophage 13
CP026242	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence	355789	239853	240858	355789		Aeromonas_phage(100.0%)	1	NA	NA
AUV46683.1|239853_240858_+	peptide transporter	NA	A0A1I9KFW9	Aeromonas_phage	31.1	1.6e-11
>prophage 14
CP026242	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence	355789	244105	245140	355789		Enterobacteria_phage(100.0%)	1	NA	NA
AUV46688.1|244105_245140_+	stbA family protein	NA	A0A0A7NPX4	Enterobacteria_phage	34.7	6.7e-42
>prophage 15
CP026242	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence	355789	260028	261837	355789		Bacillus_phage(100.0%)	1	NA	NA
AUV46698.1|260028_261837_+	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	25.9	9.7e-20
>prophage 16
CP026242	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence	355789	269684	270917	355789		Pseudomonas_phage(100.0%)	1	NA	NA
AUV46707.1|269684_270917_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.3	4.6e-13
>prophage 17
CP026242	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence	355789	293369	334188	355789	integrase,transposase	Escherichia_phage(45.83%)	37	329986:330045	334189:334327
AUV46732.1|293369_294446_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV46733.1|294938_295775_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AUV46734.1|295839_296238_-	VOC family protein	NA	NA	NA	NA	NA
AUV46735.1|296281_297391_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.3	4.9e-30
AUV46736.1|297425_297701_-	regulator protein FrmR	NA	NA	NA	NA	NA
AUV46815.1|298912_299896_+	oxidoreductase	NA	NA	NA	NA	NA
AUV46737.1|299958_300615_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUV46738.1|301038_301335_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUV46739.1|302406_302763_+	hypothetical protein	NA	U5P4I9	Shigella_phage	91.2	1.3e-32
AUV46740.1|302719_303871_+|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AUV46741.1|304262_304673_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46742.1|304966_306490_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AUV46816.1|307192_308173_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
AUV46817.1|309472_310402_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	53.1	1.4e-75
AUV46743.1|310605_311574_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
AUV46744.1|311735_312533_+	KR domain-containing protein	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.9	5.1e-13
AUV46745.1|312794_313763_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	3.8e-172
AUV46746.1|313861_315253_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUV46747.1|316088_317111_-|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
AUV46748.1|317273_317978_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV46749.1|318689_319310_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
AUV46750.1|319302_320568_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	4.6e-234
AUV46751.1|320579_321482_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	100.0	5.3e-160
AUV46752.1|321742_322504_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AUV46753.1|322524_323385_-	class A extended-spectrum beta-lactamase SHV-5	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
AUV46754.1|323682_323943_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
AUV46818.1|324029_325118_+	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AUV46755.1|326090_326795_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV46756.1|326834_327353_+	hypothetical protein	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	99.4	1.1e-96
AUV46757.1|327498_328203_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AUV46758.1|328193_328625_+	recombinase family protein	NA	F1BUU6	Erwinia_phage	48.6	2.3e-20
AUV46759.1|328971_329985_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
329986:330045	attL	GGCTTGTTATGACTGTTTTTTTGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCG	NA	NA	NA	NA
AUV46760.1|330141_330615_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
AUV46761.1|330707_331499_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AUV46762.1|332328_333033_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV46763.1|332978_333236_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46764.1|333174_334188_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
334189:334327	attR	GGCTTGTTATGACTGTTTTTTTGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTA	NA	NA	NA	NA
>prophage 18
CP026242	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence	355789	337782	338622	355789		Pandoravirus(100.0%)	1	NA	NA
AUV46770.1|337782_338622_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
>prophage 19
CP026242	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence	355789	341756	347312	355789	transposase	Pandoravirus(33.33%)	11	NA	NA
AUV46773.1|341756_342596_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUV46774.1|342525_342705_-	hypothetical protein	NA	NA	NA	NA	NA
AUV46775.1|342723_343224_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUV46776.1|343529_343643_-	NTP-binding protein	NA	NA	NA	NA	NA
AUV46777.1|343730_344495_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AUV46778.1|344536_344713_+	resolvase	NA	NA	NA	NA	NA
AUV46779.1|344732_344945_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AUV46820.1|344907_345027_+	mercury resistance protein	NA	NA	NA	NA	NA
AUV46780.1|345010_345247_-	mercury resistance protein	NA	NA	NA	NA	NA
AUV46781.1|345243_345609_-	transcriptional regulator	NA	NA	NA	NA	NA
AUV46782.1|345626_347312_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
>prophage 20
CP026242	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence	355789	354897	355068	355789		Pectobacterium_phage(100.0%)	1	NA	NA
AUV46791.1|354897_355068_-	hypothetical protein	NA	A0A1P7WFU2	Pectobacterium_phage	56.4	2.3e-08
