The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026235	Citrobacter freundii complex sp. CFNIH3 chromosome, complete genome	5334524	982540	1018036	5334524	transposase	Escherichia_phage(33.33%)	42	NA	NA
AUV25039.1|982540_983661_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	3.9e-51
AUV25040.1|983866_984208_-	toxin	NA	NA	NA	NA	NA
AUV25041.1|984228_984546_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AUV25042.1|984558_984786_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
AUV25043.1|984794_985271_-	hypothetical protein	NA	NA	NA	NA	NA
AUV25044.1|985286_985745_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
AUV25045.1|985842_986082_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AUV25046.1|986158_986626_-	hypothetical protein	NA	NA	NA	NA	NA
AUV25047.1|986648_987092_-	hypothetical protein	NA	NA	NA	NA	NA
AUV25048.1|987091_987328_-	hypothetical protein	NA	NA	NA	NA	NA
AUV25049.1|987364_988066_-	WYL domain-containing protein	NA	NA	NA	NA	NA
AUV25050.1|988283_989105_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	6.1e-46
AUV25051.1|989196_990060_-	hypothetical protein	NA	NA	NA	NA	NA
AUV25052.1|990166_991093_-	hypothetical protein	NA	NA	NA	NA	NA
AUV25053.1|991542_991749_+	AlpA family phage regulatory protein	NA	A0A1U9GWX3	Vibrio_phage	40.7	8.5e-05
AUV25054.1|991894_992104_-	hypothetical protein	NA	NA	NA	NA	NA
AUV25055.1|992153_992765_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AUV25056.1|993070_993448_+	hypothetical protein	NA	NA	NA	NA	NA
AUV25057.1|994273_995410_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AUV25058.1|995422_995515_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
AUV28875.1|995594_996893_+	phytase AppA	NA	NA	NA	NA	NA
AUV28876.1|997012_997660_-	tyrosine-protein kinase etk	NA	NA	NA	NA	NA
AUV28877.1|997666_997816_+	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	100.0	2.1e-13
AUV25059.1|997853_998834_-|transposase	IS5/IS1182 family transposase	transposase	Q38213	Escherichia_phage	97.5	5.4e-182
AUV25060.1|998959_999241_-	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
AUV25061.1|999221_999551_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	43.1	3.1e-17
AUV25062.1|1000598_1001621_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV25063.1|1002066_1002771_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV25064.1|1003132_1004815_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.7	1.1e-09
AUV25065.1|1004914_1005232_+	hypothetical protein	NA	NA	NA	NA	NA
AUV25066.1|1005252_1005666_+	hypothetical protein	NA	Q716C1	Shigella_phage	43.0	1.6e-10
AUV25067.1|1005622_1006774_+|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AUV25068.1|1007141_1007573_-	hypothetical protein	NA	NA	NA	NA	NA
AUV25069.1|1007866_1009390_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AUV25070.1|1009823_1010828_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUV25071.1|1010857_1012258_-	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	26.1	2.0e-20
AUV25072.1|1012257_1013628_-	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
AUV25073.1|1013765_1015283_-	porin	NA	NA	NA	NA	NA
AUV25074.1|1015448_1016372_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
AUV25075.1|1016600_1016771_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUV28878.1|1016849_1017017_+	ABC transporter	NA	NA	NA	NA	NA
AUV25076.1|1017055_1018036_-|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 2
CP026235	Citrobacter freundii complex sp. CFNIH3 chromosome, complete genome	5334524	1953396	1959157	5334524	transposase	uncultured_Caudovirales_phage(66.67%)	9	NA	NA
AUV25891.1|1953396_1953609_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	76.5	2.7e-22
AUV25892.1|1953592_1953808_+	cold-shock protein	NA	NA	NA	NA	NA
AUV25893.1|1953881_1954112_+	hypothetical protein	NA	NA	NA	NA	NA
AUV25894.1|1954318_1954492_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
AUV25895.1|1955125_1956236_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.5	2.9e-06
AUV25896.1|1956279_1956978_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.3	1.1e-91
AUV25897.1|1957064_1957385_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	52.4	1.1e-19
AUV25898.1|1957429_1958719_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.9	1.3e-167
AUV25899.1|1958731_1959157_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	73.6	2.9e-52
>prophage 3
CP026235	Citrobacter freundii complex sp. CFNIH3 chromosome, complete genome	5334524	2087430	2146720	5334524	coat,integrase,transposase	Vibrio_phage(18.18%)	52	2085835:2085851	2138817:2138833
2085835:2085851	attL	TTAGCCCGGATAAATTC	NA	NA	NA	NA
AUV26019.1|2087430_2088399_-|coat	spore coat protein U	coat	NA	NA	NA	NA
AUV26020.1|2088412_2090698_-	fimbrial protein	NA	NA	NA	NA	NA
AUV26021.1|2090753_2091476_-	molecular chaperone	NA	NA	NA	NA	NA
AUV26022.1|2091490_2092021_-	SCPU domain-containing protein	NA	NA	NA	NA	NA
AUV26023.1|2092296_2093277_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
AUV26024.1|2093541_2094273_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	49.2	3.0e-52
AUV26025.1|2094494_2095706_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AUV26026.1|2096024_2096261_+	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
AUV26027.1|2096303_2096576_+	hypothetical protein	NA	NA	NA	NA	NA
AUV26028.1|2096610_2096877_+	two-component-system connector protein AriR	NA	NA	NA	NA	NA
AUV26029.1|2097005_2097251_+	hypothetical protein	NA	NA	NA	NA	NA
AUV26030.1|2097250_2097802_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AUV26031.1|2097944_2098736_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUV26032.1|2098884_2099778_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUV26033.1|2099802_2100792_-	aldo/keto reductase	NA	NA	NA	NA	NA
AUV26034.1|2100818_2101670_-	2,5-diketo-D-gluconic acid reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.9	9.8e-47
AUV26035.1|2101937_2103167_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
AUV26036.1|2103324_2104869_+	PTS glucose transporter subunit IIB	NA	A0A2I7SAJ6	Vibrio_phage	46.8	3.3e-08
AUV26037.1|2104883_2106644_+	sulfatase	NA	NA	NA	NA	NA
AUV26038.1|2106646_2107525_+	aldose epimerase	NA	NA	NA	NA	NA
AUV26039.1|2107568_2108450_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AUV26040.1|2108433_2108826_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
AUV26041.1|2108822_2109077_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
AUV26042.1|2109308_2109647_+	hypothetical protein	NA	NA	NA	NA	NA
AUV26043.1|2110989_2111751_-	carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUV26044.1|2111728_2112208_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AUV28925.1|2112315_2112963_-	DUF4405 domain-containing protein	NA	NA	NA	NA	NA
AUV26045.1|2113014_2113671_-	flavodoxin	NA	NA	NA	NA	NA
AUV26046.1|2113735_2115205_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AUV26047.1|2115220_2115901_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	4.6e-31
AUV26048.1|2116120_2117170_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUV26049.1|2118255_2119341_+	DNA (cytosine-5-)-methyltransferase	NA	A7XXH6	Thermus_virus	32.6	9.9e-36
AUV26050.1|2119350_2122116_+	hypothetical protein	NA	NA	NA	NA	NA
AUV26051.1|2122151_2124932_+	kinetochore protein	NA	NA	NA	NA	NA
AUV26052.1|2124946_2130898_+	helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	30.7	2.6e-05
AUV26053.1|2130902_2132051_+	hypothetical protein	NA	NA	NA	NA	NA
AUV26054.1|2132510_2132846_-	hypothetical protein	NA	NA	NA	NA	NA
AUV26055.1|2132881_2133241_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUV26056.1|2133255_2133783_-	hypothetical protein	NA	NA	NA	NA	NA
AUV28926.1|2133973_2134348_+	XRE family transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	40.8	1.1e-05
AUV26057.1|2134617_2135010_+	hypothetical protein	NA	NA	NA	NA	NA
AUV28927.1|2135130_2135592_+	hypothetical protein	NA	NA	NA	NA	NA
AUV26058.1|2135593_2136046_+	DNA repair protein	NA	NA	NA	NA	NA
AUV26059.1|2136334_2137357_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV26060.1|2137459_2138389_+|integrase	integrase	integrase	A0A1B1P7C7	Bacillus_phage	28.5	1.2e-10
AUV26061.1|2138375_2138990_-	hypothetical protein	NA	NA	NA	NA	NA
2138817:2138833	attR	GAATTTATCCGGGCTAA	NA	NA	NA	NA
AUV26062.1|2139213_2139411_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.9	1.5e-06
AUV26063.1|2139412_2139871_+	hypothetical protein	NA	NA	NA	NA	NA
AUV28928.1|2141441_2142839_+	hypothetical protein	NA	NA	NA	NA	NA
AUV26064.1|2143143_2144586_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
AUV26065.1|2144553_2144670_+	arsenate reductase	NA	NA	NA	NA	NA
AUV26066.1|2145600_2146720_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	3.9e-51
>prophage 4
CP026235	Citrobacter freundii complex sp. CFNIH3 chromosome, complete genome	5334524	2778494	2844888	5334524	holin,integrase,tail,coat,terminase,protease	Escherichia_phage(43.1%)	85	2791388:2791415	2842644:2842671
AUV26629.1|2778494_2779376_-|protease	protease HtpX	protease	NA	NA	NA	NA
AUV26630.1|2779568_2781617_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.6	1.8e-86
AUV26631.1|2781636_2782323_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AUV26632.1|2782419_2782917_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AUV26633.1|2783045_2784329_+	hypothetical protein	NA	NA	NA	NA	NA
AUV26634.1|2784297_2786931_+	MCE family protein	NA	NA	NA	NA	NA
AUV26635.1|2787014_2788436_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AUV26636.1|2788533_2788773_+	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
AUV26637.1|2788875_2789067_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUV26638.1|2789067_2789709_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	48.1	1.6e-54
AUV26639.1|2789786_2791067_-	hypothetical protein	NA	NA	NA	NA	NA
2791388:2791415	attL	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
AUV26640.1|2791719_2792391_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	1.8e-80
AUV26641.1|2792383_2793652_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	80.6	9.3e-203
AUV26642.1|2793654_2794074_-	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	55.9	8.8e-33
AUV26643.1|2794151_2794394_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	75.9	4.4e-29
AUV26644.1|2794438_2795797_-|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	52.4	5.8e-118
AUV26645.1|2795806_2796751_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	67.1	1.3e-119
AUV26646.1|2796750_2799999_-	host specificity protein J	NA	G8C7R4	Escherichia_phage	67.8	0.0e+00
AUV26647.1|2800053_2800653_-|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	92.5	6.6e-98
AUV26648.1|2800640_2801372_-	peptidase P60	NA	G8C7R2	Escherichia_phage	89.7	8.4e-140
AUV26649.1|2801384_2802158_-|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	89.0	8.1e-133
AUV26650.1|2802166_2802517_-	hypothetical protein	NA	G8C7R0	Escherichia_phage	91.4	1.2e-54
AUV28960.1|2802778_2803141_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	39.3	2.5e-12
AUV26651.1|2803186_2803411_-	hypothetical protein	NA	NA	NA	NA	NA
AUV26652.1|2803431_2804007_+	hypothetical protein	NA	M9NZJ1	Enterobacteria_phage	28.4	7.6e-19
AUV26653.1|2804571_2804796_-	hypothetical protein	NA	NA	NA	NA	NA
AUV26654.1|2804795_2807927_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	43.2	1.8e-162
AUV26655.1|2807926_2808214_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	63.1	5.5e-18
AUV26656.1|2808231_2808570_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	85.7	1.9e-49
AUV26657.1|2808610_2809141_-	hypothetical protein	NA	A0A1V0E5P7	Salmonella_phage	93.1	3.2e-88
AUV26658.1|2809357_2810290_-|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	91.6	2.8e-156
AUV26659.1|2810336_2810786_-	hypothetical protein	NA	G8C7Q2	Escherichia_phage	89.9	6.5e-74
AUV26660.1|2810775_2811375_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	83.9	4.1e-92
AUV26661.1|2811376_2811730_-	hypothetical protein	NA	G8C7Q0	Escherichia_phage	87.1	7.9e-51
AUV26662.1|2811731_2812214_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	88.1	6.1e-78
AUV26663.1|2812216_2812558_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	87.2	4.8e-13
AUV26664.1|2812597_2813737_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	84.0	4.8e-174
AUV26665.1|2813754_2814507_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	92.4	2.3e-124
AUV26666.1|2814779_2815886_-	hypothetical protein	NA	G8C7P5	Escherichia_phage	91.3	1.9e-191
AUV26667.1|2815887_2817291_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	91.6	5.2e-247
AUV26668.1|2817295_2818867_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	92.4	3.3e-306
AUV26669.1|2818863_2819514_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	76.9	1.1e-90
AUV26670.1|2819637_2820066_+	hypothetical protein	NA	NA	NA	NA	NA
AUV26671.1|2820415_2820619_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	66.7	1.2e-14
AUV26672.1|2820575_2820848_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	66.7	3.6e-19
AUV26673.1|2820844_2821387_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	72.1	3.2e-75
AUV26674.1|2821386_2821662_-|holin	phage holin family protein	holin	NA	NA	NA	NA
AUV26675.1|2821658_2822057_-	hypothetical protein	NA	NA	NA	NA	NA
AUV26676.1|2822364_2822694_-	hypothetical protein	NA	NA	NA	NA	NA
AUV26677.1|2823321_2824026_-	antiterminator	NA	I6PDF8	Cronobacter_phage	56.2	1.5e-69
AUV26678.1|2824022_2824160_-	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	88.4	9.2e-16
AUV26679.1|2824156_2824765_-	protein NinG	NA	A0A0M4RU10	Salmonella_phage	65.7	3.1e-47
AUV28961.1|2824767_2824974_-	hypothetical protein	NA	K7PJT9	Enterobacteria_phage	81.8	2.3e-26
AUV26680.1|2824973_2825573_-	DUF1367 domain-containing protein	NA	K7PKS6	Enterobacteria_phage	97.0	7.7e-107
AUV26681.1|2825678_2825933_-	hypothetical protein	NA	NA	NA	NA	NA
AUV26682.1|2825932_2826190_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	80.3	1.5e-27
AUV26683.1|2826189_2826516_-	hypothetical protein	NA	NA	NA	NA	NA
AUV26684.1|2826609_2827470_-	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	48.3	4.3e-34
AUV26685.1|2827466_2827886_-	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	74.8	1.4e-59
AUV26686.1|2827887_2828184_-	hypothetical protein	NA	NA	NA	NA	NA
AUV26687.1|2828180_2828408_-	hypothetical protein	NA	NA	NA	NA	NA
AUV26688.1|2828404_2828950_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	50.0	3.2e-11
AUV26689.1|2828946_2829258_-	hypothetical protein	NA	NA	NA	NA	NA
AUV26690.1|2829276_2830026_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	87.1	1.3e-122
AUV26691.1|2830028_2830976_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	30.7	3.8e-23
AUV26692.1|2831143_2831683_-	regulator	NA	K7PJT7	Enterobacteria_phage	84.4	4.7e-79
AUV26693.1|2831713_2831941_-	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	53.5	1.2e-15
AUV28962.1|2832009_2832732_+	XRE family transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	55.1	2.2e-71
AUV26694.1|2832899_2833823_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	93.8	2.1e-172
AUV26695.1|2833913_2834294_+	hypothetical protein	NA	NA	NA	NA	NA
AUV28963.1|2834325_2834550_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	2.8e-17
AUV26696.1|2834779_2835049_+	hypothetical protein	NA	NA	NA	NA	NA
AUV26697.1|2835029_2835323_-	hypothetical protein	NA	NA	NA	NA	NA
AUV28964.1|2835502_2835709_+	cell division inhibitor protein	NA	K7PM31	Enterobacteria_phage	100.0	1.5e-33
AUV26698.1|2836021_2838895_+	exodeoxyribonuclease VIII	NA	K7P6V4	Enterobacteria_phage	73.4	0.0e+00
AUV26699.1|2838909_2839950_+	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	76.4	2.0e-155
AUV26700.1|2839984_2840329_+	hypothetical protein	NA	NA	NA	NA	NA
AUV26701.1|2840321_2840948_+	morphogenetic protein	NA	H2BDG4	Pseudomonas_virus	45.4	3.0e-45
AUV26702.1|2840934_2841177_+	DUF4060 domain-containing protein	NA	K7PHF4	Enterobacteria_phage	89.9	2.3e-33
AUV26703.1|2841241_2841514_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	63.3	5.5e-28
AUV26704.1|2841482_2842568_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	69.5	3.9e-149
AUV26705.1|2842904_2843243_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
2842644:2842671	attR	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
AUV26706.1|2843263_2844136_-	hypothetical protein	NA	NA	NA	NA	NA
AUV26707.1|2844139_2844514_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AUV26708.1|2844657_2844888_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
>prophage 5
CP026235	Citrobacter freundii complex sp. CFNIH3 chromosome, complete genome	5334524	3100176	3106477	5334524		Escherichia_phage(33.33%)	6	NA	NA
AUV26932.1|3100176_3100725_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	53.6	2.7e-50
AUV26933.1|3100740_3101622_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.1	7.5e-26
AUV26934.1|3101650_3102517_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.0	3.5e-108
AUV26935.1|3102535_3103624_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	49.4	3.1e-90
AUV26936.1|3104023_3104917_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	5.6e-45
AUV26937.1|3105082_3106477_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	35.4	4.7e-22
>prophage 6
CP026235	Citrobacter freundii complex sp. CFNIH3 chromosome, complete genome	5334524	3148362	3157929	5334524	protease	Bacillus_phage(28.57%)	8	NA	NA
AUV26969.1|3148362_3149766_+	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.9	5.0e-32
AUV26970.1|3149762_3150485_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
AUV26971.1|3150620_3150953_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AUV26972.1|3151112_3152474_+	U32 family peptidase	NA	Q6DW11	Phage_TP	93.4	2.8e-205
AUV26973.1|3152732_3155009_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
AUV26974.1|3155039_3155360_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
AUV26975.1|3155683_3155908_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
AUV26976.1|3155982_3157929_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.2	3.7e-41
>prophage 7
CP026235	Citrobacter freundii complex sp. CFNIH3 chromosome, complete genome	5334524	3196026	3204469	5334524	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
AUV27011.1|3196026_3198060_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	1.2e-53
AUV27012.1|3198267_3198726_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	9.2e-52
AUV28977.1|3198768_3199239_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	77.6	8.3e-64
AUV27013.1|3199285_3200005_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AUV27014.1|3200001_3201687_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.4	5.6e-280
AUV27015.1|3201912_3202644_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.0	1.0e-105
AUV27016.1|3202718_3202826_+	hypothetical protein	NA	NA	NA	NA	NA
AUV27017.1|3202806_3203538_-	ABC transporter permease	NA	NA	NA	NA	NA
AUV27018.1|3203521_3204469_-	ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	4.2e-22
>prophage 8
CP026235	Citrobacter freundii complex sp. CFNIH3 chromosome, complete genome	5334524	3413464	3485972	5334524	holin,portal,head,capsid,tRNA,integrase,tail,transposase,terminase,protease	Enterobacteria_phage(20.37%)	90	3438101:3438123	3479088:3479110
AUV27195.1|3413464_3414277_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AUV27196.1|3414276_3415290_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUV27197.1|3415357_3416494_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	26.3	1.2e-18
AUV28987.1|3416602_3417604_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AUV27198.1|3417600_3418779_-	MFS transporter	NA	NA	NA	NA	NA
AUV27199.1|3418958_3419336_-	hypothetical protein	NA	NA	NA	NA	NA
AUV27200.1|3419509_3419761_+	transcriptional regulator	NA	A0A0M4UV99	Ralstonia_phage	58.5	1.9e-14
AUV27201.1|3419916_3420285_+	hypothetical protein	NA	H6SUH4	Campylobacter_virus	35.0	1.2e-06
AUV27202.1|3420284_3420809_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AUV27203.1|3420862_3422083_-	beta-ketoacyl-[acyl-carrier-protein] synthase I	NA	NA	NA	NA	NA
AUV27204.1|3422182_3424243_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AUV27205.1|3424364_3424643_-	hypothetical protein	NA	NA	NA	NA	NA
AUV27206.1|3424675_3425224_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AUV27207.1|3425223_3426033_-	hypothetical protein	NA	NA	NA	NA	NA
AUV27208.1|3426032_3426857_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AUV27209.1|3426860_3427946_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.0	5.9e-89
AUV27210.1|3427985_3428918_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUV27211.1|3429084_3429636_+	endonuclease SmrB	NA	NA	NA	NA	NA
AUV27212.1|3429716_3430202_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AUV27213.1|3430410_3432558_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AUV27214.1|3432557_3433868_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AUV27215.1|3434043_3434328_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
AUV27216.1|3434699_3435980_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AUV27217.1|3436039_3436795_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AUV27218.1|3437083_3438025_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	88.1	1.3e-148
3438101:3438123	attL	GTCCCCTTAGTTAAATGGATATA	NA	NA	NA	NA
AUV27219.1|3438239_3438629_-	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.9	2.3e-51
AUV27220.1|3438948_3439191_+	DNA-damage-inducible protein I	NA	Q6UAW0	Klebsiella_phage	76.6	7.6e-29
AUV27221.1|3439229_3440273_-	hypothetical protein	NA	Q5G8V6	Enterobacteria_phage	77.6	2.0e-62
AUV27222.1|3440282_3441227_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	66.8	1.3e-119
AUV27223.1|3441226_3444457_-	host specificity protein	NA	O64335	Escherichia_phage	64.9	0.0e+00
AUV27224.1|3444510_3445098_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	47.9	3.6e-48
AUV27225.1|3445097_3445808_-	peptidase P60	NA	F1C573	Cronobacter_phage	70.2	1.0e-97
AUV27226.1|3445810_3446569_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.6	3.9e-95
AUV27227.1|3446565_3446904_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
AUV27228.1|3446906_3450398_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	86.6	0.0e+00
AUV27229.1|3450459_3450825_-	hypothetical protein	NA	NA	NA	NA	NA
AUV27230.1|3450871_3451150_-	hypothetical protein	NA	Q9MCS5	Enterobacteria_phage	94.6	3.1e-42
AUV27231.1|3451158_3451548_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	85.3	7.3e-58
AUV27232.1|3451575_3452280_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	73.9	1.7e-92
AUV27233.1|3452337_3452685_-	hypothetical protein	NA	A0A220NRP0	Escherichia_phage	75.7	6.3e-45
AUV27234.1|3452681_3453131_-	hypothetical protein	NA	S4TR46	Salmonella_phage	85.9	5.0e-66
AUV27235.1|3453127_3453466_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	69.6	2.3e-39
AUV27236.1|3453474_3453795_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	44.1	4.8e-15
AUV27237.1|3453791_3454016_-	hypothetical protein	NA	NA	NA	NA	NA
AUV27238.1|3454054_3455263_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.4	5.4e-192
AUV27239.1|3455276_3455930_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	85.5	2.3e-104
AUV27240.1|3455916_3457146_-|portal	phage portal protein	portal	U5P411	Shigella_phage	82.9	3.3e-205
AUV27241.1|3457145_3457331_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	57.6	2.9e-12
AUV27242.1|3457341_3459099_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	89.6	0.0e+00
AUV27243.1|3459098_3459596_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	73.3	6.3e-62
AUV28988.1|3459752_3460103_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	79.3	7.8e-51
AUV27244.1|3460557_3460824_-	hypothetical protein	NA	NA	NA	NA	NA
AUV27245.1|3460820_3461129_-	hypothetical protein	NA	Q5QF73	Pseudomonas_virus	56.4	4.2e-16
AUV28989.1|3461221_3461761_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	73.8	7.3e-56
AUV27246.1|3461781_3462270_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	71.3	1.4e-66
AUV28990.1|3462253_3462586_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	95.4	4.2e-54
AUV27247.1|3463034_3463568_-	hypothetical protein	NA	NA	NA	NA	NA
AUV27248.1|3463723_3464134_-	antitermination protein	NA	A0A088CD47	Shigella_phage	77.3	4.1e-51
AUV27249.1|3464123_3464768_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	66.8	1.3e-83
AUV27250.1|3464922_3465567_-	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	60.0	3.4e-44
AUV27251.1|3465536_3466508_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	60.9	3.0e-108
AUV27252.1|3466504_3468034_-	helicase	NA	A0A286N2P9	Klebsiella_phage	67.3	4.1e-205
AUV27253.1|3468026_3468302_-	hypothetical protein	NA	A0A1P8VVT6	Streptococcus_phage	42.3	3.0e-05
AUV27254.1|3468462_3468741_-	hypothetical protein	NA	NA	NA	NA	NA
AUV27255.1|3468782_3469313_-	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	62.4	3.9e-54
AUV27256.1|3469341_3469584_-	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	67.1	3.8e-20
AUV27257.1|3469682_3470393_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	67.4	3.4e-77
AUV27258.1|3470469_3470676_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	70.6	8.7e-18
AUV27259.1|3471401_3471761_+	hypothetical protein	NA	NA	NA	NA	NA
AUV27260.1|3472098_3472458_+	hypothetical protein	NA	I6NMK2	Burkholderia_virus	35.6	5.4e-07
AUV27261.1|3472501_3473314_+	hypothetical protein	NA	NA	NA	NA	NA
AUV27262.1|3473391_3474201_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	55.1	1.7e-72
AUV27263.1|3474197_3474323_+	sodium:solute symporter	NA	NA	NA	NA	NA
AUV27264.1|3474319_3474544_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	50.0	1.0e-11
AUV27265.1|3474540_3474792_+	hypothetical protein	NA	NA	NA	NA	NA
AUV27266.1|3474778_3475003_+	hypothetical protein	NA	NA	NA	NA	NA
AUV27267.1|3475610_3475823_+	hypothetical protein	NA	NA	NA	NA	NA
AUV27268.1|3475819_3476377_+	hypothetical protein	NA	K7P6J7	Enterobacteria_phage	31.7	7.1e-06
AUV27269.1|3476380_3476689_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	72.7	1.9e-32
AUV27270.1|3476692_3477472_+	hypothetical protein	NA	C6ZR26	Salmonella_phage	57.8	1.2e-14
AUV27271.1|3477481_3477739_+	hypothetical protein	NA	A0A2R2Z2X2	Escherichia_phage	61.4	8.6e-15
AUV27272.1|3477722_3478892_-|integrase	integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	86.1	1.2e-201
AUV27273.1|3479275_3480613_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	38.2	3.5e-67
3479088:3479110	attR	GTCCCCTTAGTTAAATGGATATA	NA	NA	NA	NA
AUV27274.1|3480605_3481346_+	hypothetical protein	NA	NA	NA	NA	NA
AUV27275.1|3481501_3481693_+	AlpA family transcriptional regulator	NA	E5E3Y1	Burkholderia_phage	49.0	4.2e-06
AUV27276.1|3481741_3481933_+	hypothetical protein	NA	NA	NA	NA	NA
AUV27277.1|3482014_3482209_+	DNA-binding protein	NA	NA	NA	NA	NA
AUV27278.1|3482205_3482592_+	hypothetical protein	NA	NA	NA	NA	NA
AUV28991.1|3483017_3483713_+	replication protein	NA	NA	NA	NA	NA
AUV27279.1|3484991_3485972_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
>prophage 9
CP026235	Citrobacter freundii complex sp. CFNIH3 chromosome, complete genome	5334524	4190156	4305399	5334524	plate,tRNA,integrase,transposase,protease	Escherichia_phage(32.14%)	104	4240561:4240620	4256064:4256720
AUV27853.1|4190156_4190915_+|protease	metalloprotease	protease	NA	NA	NA	NA
AUV27854.1|4191026_4191947_-	agmatinase	NA	NA	NA	NA	NA
AUV27855.1|4192089_4194066_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AUV27856.1|4194074_4194206_-	virulence promoting factor	NA	NA	NA	NA	NA
AUV27857.1|4194973_4196128_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	5.3e-128
AUV27858.1|4196525_4197920_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	25.7	7.5e-28
AUV27859.1|4197997_4198495_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
AUV27860.1|4198589_4199297_+	deoxyribonuclease I	NA	NA	NA	NA	NA
AUV27861.1|4199372_4200104_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AUV27862.1|4200116_4201064_+	glutathione synthase	NA	NA	NA	NA	NA
AUV27863.1|4201240_4201804_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
AUV27864.1|4201803_4202220_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AUV27865.1|4202216_4203197_-	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AUV27866.1|4203390_4203810_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AUV27867.1|4204467_4205172_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AUV27868.1|4205190_4205757_+	YggT family protein	NA	NA	NA	NA	NA
AUV27869.1|4205753_4206044_+	YggU family protein	NA	NA	NA	NA	NA
AUV27870.1|4206051_4206645_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
AUV27871.1|4206637_4207774_+	YggW family oxidoreductase	NA	NA	NA	NA	NA
AUV27872.1|4208031_4209078_-	L-asparaginase 2	NA	NA	NA	NA	NA
AUV27873.1|4209266_4209986_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
AUV27874.1|4210035_4210362_-	DUF469 domain-containing protein	NA	NA	NA	NA	NA
AUV27875.1|4210361_4211081_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AUV29015.1|4211241_4212294_+	adenine DNA glycosylase	NA	NA	NA	NA	NA
AUV27876.1|4212321_4212597_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AUV27877.1|4212694_4213777_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	4.5e-12
AUV27878.1|4213987_4215244_+	nucleoside permease	NA	NA	NA	NA	NA
AUV29016.1|4215299_4217435_-	ornithine decarboxylase	NA	NA	NA	NA	NA
AUV27879.1|4217903_4218611_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
AUV27880.1|4218987_4220019_-	recombinase XerD	NA	NA	NA	NA	NA
AUV27881.1|4220079_4221699_-	relaxase	NA	NA	NA	NA	NA
AUV27882.1|4221765_4223274_-	DNA helicase	NA	A0A075DXT4	Acinetobacter_phage	31.3	2.7e-47
AUV27883.1|4224194_4225127_-	hypothetical protein	NA	NA	NA	NA	NA
AUV27884.1|4225232_4226219_-	DNA primase	NA	A0A1V0EEV1	Caulobacter_phage	40.7	4.9e-50
AUV27885.1|4226730_4227333_-	hypothetical protein	NA	NA	NA	NA	NA
AUV27886.1|4228139_4228505_-	hypothetical protein	NA	NA	NA	NA	NA
AUV27887.1|4228601_4228976_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29017.1|4229019_4229352_+	hypothetical protein	NA	NA	NA	NA	NA
AUV27888.1|4230250_4231150_-	DNA-binding protein	NA	NA	NA	NA	NA
AUV27889.1|4232120_4232315_+	hypothetical protein	NA	NA	NA	NA	NA
AUV27890.1|4232482_4232791_+	hypothetical protein	NA	NA	NA	NA	NA
AUV27891.1|4232907_4233876_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	5.0e-172
AUV27892.1|4234193_4235219_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV27893.1|4236641_4237622_+|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AUV29018.1|4237660_4237819_-	ABC transporter	NA	NA	NA	NA	NA
AUV27894.1|4238570_4239515_-|transposase	IS5/IS1182 family transposase	transposase	A0A077SK28	Escherichia_phage	57.4	3.7e-95
AUV29019.1|4240437_4240647_-	hypothetical protein	NA	NA	NA	NA	NA
4240561:4240620	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
AUV27895.1|4240623_4241328_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV27896.1|4241218_4242178_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
AUV29020.1|4242383_4243250_+	PSE family carbenicillin-hydrolyzing class A beta-lactamase CARB-2	NA	A0A077SL40	Escherichia_phage	44.1	4.8e-57
AUV29021.1|4243367_4244159_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AUV27897.1|4244247_4245597_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	26.0	2.6e-17
AUV27898.1|4246397_4247657_+	chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
AUV27899.1|4247781_4248414_+	type B-2 chloramphenicol O-acetyltransferase CatB11	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	43.0	7.1e-26
AUV27900.1|4248392_4248674_+	hypothetical protein	NA	NA	NA	NA	NA
AUV27901.1|4248603_4248951_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AUV27902.1|4248944_4249784_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AUV27903.1|4250188_4251730_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AUV27904.1|4251995_4252496_+	hypothetical protein	NA	A0A2L0UZT6	Agrobacterium_phage	28.6	2.0e-07
AUV27905.1|4252495_4253065_+	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	NA	NA	NA	NA
AUV27906.1|4253627_4255103_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
AUV27907.1|4255158_4256043_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AUV27908.1|4256126_4256831_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
4256064:4256720	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACC	NA	NA	NA	NA
AUV27909.1|4257157_4257658_+	ferritin	NA	NA	NA	NA	NA
AUV27910.1|4257810_4257936_+	ABC transporter	NA	NA	NA	NA	NA
AUV27911.1|4257974_4258955_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
AUV27912.1|4259232_4259514_-	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
AUV27913.1|4260004_4260286_-	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
AUV27914.1|4261012_4261966_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV27915.1|4262153_4262762_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUV27916.1|4262758_4263910_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUV27917.1|4263906_4265112_+	ABC transporter permease	NA	NA	NA	NA	NA
AUV27918.1|4265113_4265824_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	3.7e-31
AUV27919.1|4265852_4266326_+	cytochrome C	NA	NA	NA	NA	NA
AUV27920.1|4266312_4267800_+	RND transporter	NA	NA	NA	NA	NA
AUV27921.1|4267929_4268487_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	82.1	2.6e-48
AUV27922.1|4269788_4270793_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AUV27923.1|4271252_4271573_+	DUF134 domain-containing protein	NA	NA	NA	NA	NA
AUV27924.1|4271547_4272009_+	dinitrogenase iron-molybdenum cofactor	NA	NA	NA	NA	NA
AUV27925.1|4272169_4272607_+	PaaI family thioesterase	NA	NA	NA	NA	NA
AUV27926.1|4272721_4273198_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	31.7	4.1e-18
AUV27927.1|4273502_4273853_-	transcriptional regulator	NA	NA	NA	NA	NA
AUV27928.1|4276711_4277832_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AUV27929.1|4279075_4280152_+	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.4	2.8e-06
AUV27930.1|4280200_4280797_+	hypothetical protein	NA	NA	NA	NA	NA
AUV27931.1|4281467_4282055_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUV27932.1|4282244_4282484_+	thioredoxin family protein	NA	NA	NA	NA	NA
AUV27933.1|4282492_4283233_+	hypothetical protein	NA	NA	NA	NA	NA
AUV27934.1|4283274_4283811_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
AUV27935.1|4283970_4285311_-	ImpA domain-containing protein	NA	NA	NA	NA	NA
AUV27936.1|4285312_4285756_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AUV27937.1|4286686_4287631_-	hypothetical protein	NA	NA	NA	NA	NA
AUV27938.1|4287669_4288704_-	hypothetical protein	NA	NA	NA	NA	NA
AUV27939.1|4288779_4289598_-	hypothetical protein	NA	NA	NA	NA	NA
AUV27940.1|4290017_4290998_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	3.0e-185
AUV27941.1|4292723_4293692_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AUV27942.1|4293702_4296096_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	26.9	2.1e-06
AUV27943.1|4296151_4296553_-	hypothetical protein	NA	NA	NA	NA	NA
AUV27944.1|4296559_4297252_-	hypothetical protein	NA	NA	NA	NA	NA
AUV27945.1|4298455_4301077_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	28.3	8.1e-92
AUV27946.1|4301238_4301730_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUV27947.1|4301746_4303411_-	hypothetical protein	NA	NA	NA	NA	NA
AUV27948.1|4303414_4304056_-	type VI secretion system protein ImpK	NA	NA	NA	NA	NA
AUV27949.1|4304061_4305399_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 10
CP026235	Citrobacter freundii complex sp. CFNIH3 chromosome, complete genome	5334524	4565173	4572824	5334524		Pseudoalteromonas_phage(16.67%)	10	NA	NA
AUV28183.1|4565173_4566151_+	calcium/sodium antiporter	NA	A0A2D1GNI8	Pseudoalteromonas_phage	23.0	8.1e-05
AUV28184.1|4566164_4567151_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	8.7e-39
AUV28185.1|4567171_4567738_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.3	2.5e-54
AUV28186.1|4567734_4568310_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AUV28187.1|4568278_4568827_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AUV28188.1|4568833_4569559_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
AUV28189.1|4569605_4571039_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
AUV28190.1|4571061_4571349_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	4.2e-10
AUV28191.1|4571432_4571924_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AUV28192.1|4571969_4572824_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
>prophage 11
CP026235	Citrobacter freundii complex sp. CFNIH3 chromosome, complete genome	5334524	4594825	4648497	5334524	portal,capsid,tRNA,integrase,tail,protease,terminase,head	uncultured_Caudovirales_phage(60.0%)	60	4636119:4636134	4661578:4661593
AUV28208.1|4594825_4595329_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	7.3e-26
AUV28209.1|4595334_4595973_-	stringent starvation protein A	NA	NA	NA	NA	NA
AUV28210.1|4596087_4596372_+	hypothetical protein	NA	NA	NA	NA	NA
AUV28211.1|4596289_4596682_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
AUV28212.1|4596697_4597126_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
AUV28213.1|4597344_4598472_-	cell division protein ZapE	NA	NA	NA	NA	NA
AUV28214.1|4598664_4599063_+	hypothetical protein	NA	NA	NA	NA	NA
AUV28215.1|4599231_4600599_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	1.5e-20
AUV28216.1|4600688_4601756_+|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AUV28217.1|4601876_4602812_-	malate dehydrogenase	NA	NA	NA	NA	NA
AUV28218.1|4603248_4603719_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
AUV28219.1|4604095_4604362_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AUV28220.1|4604418_4604697_-	hypothetical protein	NA	NA	NA	NA	NA
AUV28221.1|4604816_4606784_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AUV28222.1|4606789_4607722_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AUV28223.1|4607729_4607933_-	protein AaeX	NA	NA	NA	NA	NA
AUV28224.1|4608117_4609047_+	transcriptional regulator	NA	NA	NA	NA	NA
AUV28225.1|4609141_4610587_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AUV28226.1|4610735_4614536_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
AUV28227.1|4614650_4616120_-	ribonuclease G	NA	NA	NA	NA	NA
AUV28228.1|4616109_4616703_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AUV28229.1|4616710_4617199_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AUV28230.1|4617199_4618222_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AUV28231.1|4618286_4619330_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AUV29036.1|4619427_4619628_+	hypothetical protein	NA	NA	NA	NA	NA
AUV28232.1|4619636_4621577_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AUV28233.1|4621802_4622777_+	oxidoreductase	NA	NA	NA	NA	NA
AUV28234.1|4622896_4623901_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AUV28235.1|4623901_4624501_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AUV28236.1|4624893_4625364_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AUV28237.1|4625374_4626724_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AUV28238.1|4626831_4627074_+	hypothetical protein	NA	NA	NA	NA	NA
AUV28239.1|4627063_4628515_+	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AUV28240.1|4628527_4629409_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AUV28241.1|4629769_4630735_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AUV28242.1|4630760_4631057_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUV28243.1|4631205_4631394_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29037.1|4631402_4631996_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	51.8	5.9e-51
AUV28244.1|4632028_4633690_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	97.3	0.0e+00
AUV28245.1|4633673_4634030_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	95.8	4.6e-59
AUV28246.1|4634303_4634747_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	97.3	4.4e-83
AUV28247.1|4634746_4635040_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	97.9	4.7e-49
AUV28248.1|4635036_4635375_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	93.8	1.6e-53
AUV29038.1|4635371_4636589_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	94.6	6.4e-225
4636119:4636134	attL	AGCCCCGGTAAACGGC	NA	NA	NA	NA
AUV28249.1|4636599_4637163_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	90.3	5.0e-92
AUV28250.1|4637155_4637719_-	HNH endonuclease	NA	A0A2I7RZ08	Vibrio_phage	42.8	2.2e-31
AUV28251.1|4637770_4638937_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	99.5	1.2e-215
AUV28252.1|4639169_4639466_-	hypothetical protein	NA	A0A2H4JB54	uncultured_Caudovirales_phage	83.2	2.1e-41
AUV28253.1|4639808_4641941_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.4	9.2e-211
AUV28254.1|4641940_4642306_-	hypothetical protein	NA	NA	NA	NA	NA
AUV28255.1|4642302_4642671_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	5.7e-52
AUV28256.1|4642667_4642982_-	hypothetical protein	NA	NA	NA	NA	NA
AUV28257.1|4642974_4643163_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29039.1|4643155_4643335_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	96.6	2.3e-27
AUV29040.1|4643558_4643753_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AUV28258.1|4643876_4644656_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
AUV28259.1|4644666_4644951_-	transcriptional regulator	NA	NA	NA	NA	NA
AUV28260.1|4645111_4646017_-	hypothetical protein	NA	NA	NA	NA	NA
AUV28261.1|4646109_4647336_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.4	9.5e-152
AUV28262.1|4647612_4648497_+	adenine-specific DNA-methyltransferase	NA	A0A0P0CJX0	Ostreococcus_lucimarinus_virus	31.4	8.9e-27
4661578:4661593	attR	GCCGTTTACCGGGGCT	NA	NA	NA	NA
>prophage 12
CP026235	Citrobacter freundii complex sp. CFNIH3 chromosome, complete genome	5334524	4709239	4800419	5334524	holin,portal,capsid,tRNA,integrase,tail,transposase,terminase,head	Enterobacteria_phage(41.38%)	96	4707437:4707454	4785998:4786015
4707437:4707454	attL	CTGCGCCAACGGCGCGGT	NA	NA	NA	NA
AUV28309.1|4709239_4710391_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.6e-42
AUV28310.1|4710628_4711624_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
AUV28311.1|4711653_4712595_+	transcriptional regulator	NA	NA	NA	NA	NA
AUV28312.1|4716164_4716854_+	sel1 repeat family protein	NA	NA	NA	NA	NA
AUV28313.1|4716904_4718218_-	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
AUV28314.1|4718562_4719183_-	heme lyase NrfEFG subunit NrfG	NA	NA	NA	NA	NA
AUV29043.1|4719179_4719566_-	heme lyase NrfEFG subunit NrfF	NA	NA	NA	NA	NA
AUV28315.1|4720248_4721253_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AUV28316.1|4722726_4723683_-	cytochrome c nitrite reductase subunit NrfD	NA	NA	NA	NA	NA
AUV28317.1|4723679_4724351_-	cytochrome c nitrite reductase Fe-S protein	NA	NA	NA	NA	NA
AUV28318.1|4724347_4724914_-	cytochrome c nitrite reductase pentaheme subunit	NA	NA	NA	NA	NA
AUV28319.1|4724958_4726395_-	ammonia-forming nitrite reductase cytochrome c552 subunit	NA	NA	NA	NA	NA
AUV28320.1|4726576_4727980_+|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
AUV29044.1|4728008_4728641_-	hypothetical protein	NA	NA	NA	NA	NA
AUV28321.1|4729111_4731070_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.5	4.6e-92
AUV28322.1|4731064_4731262_-	hypothetical protein	NA	NA	NA	NA	NA
AUV28323.1|4731306_4731621_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
AUV28324.1|4731617_4733267_+	cation/acetate symporter ActP	NA	NA	NA	NA	NA
AUV28325.1|4733309_4733999_-	LrgB family protein	NA	NA	NA	NA	NA
AUV28326.1|4733991_4734402_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
AUV28327.1|4734503_4735394_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUV28328.1|4735478_4737125_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
AUV28329.1|4737282_4738632_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.1	2.0e-158
AUV28330.1|4739235_4739694_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
AUV28331.1|4739780_4740104_+	DNA-binding transcriptional regulator SoxS	NA	NA	NA	NA	NA
AUV28332.1|4740106_4741693_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AUV28333.1|4742244_4742526_+	hypothetical protein	NA	NA	NA	NA	NA
AUV28334.1|4742592_4743120_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	94.5	4.3e-53
AUV28335.1|4743371_4746194_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.5	5.2e-312
AUV28336.1|4746288_4746645_-	hypothetical protein	NA	NA	NA	NA	NA
AUV28337.1|4746771_4747485_-	class B acid phosphatase	NA	NA	NA	NA	NA
AUV28338.1|4747734_4748928_-	aromatic amino acid transaminase	NA	NA	NA	NA	NA
AUV28339.1|4749057_4750137_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.6	8.1e-30
AUV28340.1|4750184_4751600_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	77.9	1.8e-199
AUV29045.1|4751664_4752648_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AUV28341.1|4752880_4753123_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
AUV28342.1|4753256_4754294_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AUV28343.1|4754381_4755476_+|integrase	integrase	integrase	S5MDN5	Escherichia_phage	85.0	2.1e-179
AUV28344.1|4755506_4755896_-	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	73.6	5.1e-51
AUV28345.1|4755974_4756217_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	75.3	9.9e-29
AUV28346.1|4756423_4757554_-|tail	phage tail protein	tail	S4TSP4	Salmonella_phage	82.4	1.3e-168
AUV28347.1|4757612_4757852_-	cor protein	NA	K7PLZ0	Enterobacterial_phage	58.4	1.1e-19
AUV28348.1|4758545_4762196_-	host specificity protein	NA	O64335	Escherichia_phage	82.7	0.0e+00
AUV28349.1|4762358_4762991_+	hypothetical protein	NA	NA	NA	NA	NA
AUV28350.1|4763074_4763665_-|tail	phage tail protein	tail	K7PHE5	Enterobacteria_phage	84.7	1.3e-90
AUV29046.1|4763760_4763961_-	hypothetical protein	NA	NA	NA	NA	NA
AUV28351.1|4764275_4764989_-	peptidase P60	NA	K7PGR2	Enterobacteria_phage	91.5	1.2e-135
AUV28352.1|4764990_4765746_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	86.5	3.7e-130
AUV28353.1|4765742_4766090_-|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	69.6	2.3e-39
AUV28354.1|4766093_4768610_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	69.2	4.6e-312
AUV28355.1|4768587_4768908_-|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	69.8	2.7e-34
AUV28356.1|4768916_4769324_-|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	60.0	1.3e-25
AUV28357.1|4769360_4770098_-|tail	phage tail protein	tail	O64327	Escherichia_phage	67.2	4.0e-89
AUV28358.1|4770105_4770504_-|tail	phage tail protein	tail	K7P7G5	Enterobacteria_phage	81.1	1.0e-59
AUV28359.1|4770500_4771055_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	93.3	6.5e-76
AUV28360.1|4771064_4771418_-|tail	phage tail protein	tail	K7P6U9	Enterobacteria_phage	74.4	2.9e-45
AUV28361.1|4771429_4771834_-	DNA-packaging protein	NA	E4WL26	Enterobacteria_phage	51.8	3.0e-22
AUV28362.1|4771879_4772905_-|capsid	major capsid protein E	capsid	K7P6G7	Enterobacteria_phage	92.7	8.7e-183
AUV28363.1|4772972_4773305_-|head	head decoration protein	head	E4WL24	Enterobacteria_phage	82.7	5.0e-47
AUV28364.1|4773314_4774652_-|capsid	capsid assembly protein	capsid	O64320	Escherichia_phage	84.3	4.3e-190
AUV28365.1|4774632_4776225_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	91.5	4.1e-288
AUV28366.1|4776221_4776428_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	95.5	3.2e-28
AUV28367.1|4776427_4778350_-|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	97.7	0.0e+00
AUV28368.1|4778324_4778870_-|terminase	terminase small subunit	terminase	E4WL18	Enterobacteria_phage	100.0	1.2e-95
AUV28369.1|4779119_4779848_-	Fur-regulated protein	NA	M9NZE9	Enterobacteria_phage	84.7	3.7e-103
AUV28370.1|4780159_4780699_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AUV28371.1|4780695_4781313_-	endolysin	NA	Q8HA86	Salmonella_phage	78.9	8.0e-91
AUV28372.1|4781312_4781594_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	51.1	1.1e-18
AUV28373.1|4781580_4781967_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	91.4	1.5e-55
AUV28374.1|4782113_4783166_-	DNA adenine methylase	NA	Q8SBE2	Shigella_phage	80.4	2.3e-170
AUV28375.1|4783316_4783508_-	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	85.7	1.3e-23
AUV28376.1|4783748_4784438_-	antitermination protein	NA	NA	NA	NA	NA
AUV28377.1|4784459_4785455_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	70.5	1.0e-143
AUV28378.1|4785451_4786138_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	53.8	9.9e-58
4785998:4786015	attR	CTGCGCCAACGGCGCGGT	NA	NA	NA	NA
AUV28379.1|4786151_4786538_-	hypothetical protein	NA	A0A192Y8N5	Salmonella_phage	88.4	9.2e-61
AUV28380.1|4786534_4788469_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	55.2	2.3e-205
AUV28381.1|4788461_4789784_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	52.3	2.8e-117
AUV28382.1|4789780_4790638_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	96.1	5.6e-66
AUV28383.1|4790627_4790807_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	3.0e-14
AUV28384.1|4790979_4791531_-	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	67.8	1.2e-66
AUV28385.1|4791559_4791802_-	cytoplasmic chaperone TorD	NA	NA	NA	NA	NA
AUV28386.1|4791939_4792626_+	XRE family transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	42.0	2.3e-38
AUV28387.1|4792617_4793499_-	NAD-dependent DNA ligase	NA	U3PB51	Vibrio_phage	29.8	1.5e-34
AUV28388.1|4793698_4794067_+	DNA-binding protein	NA	NA	NA	NA	NA
AUV28389.1|4794097_4794298_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	70.6	4.8e-05
AUV28390.1|4794407_4794767_+	hypothetical protein	NA	U5P4J6	Shigella_phage	64.6	9.3e-07
AUV28391.1|4794763_4795135_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	92.7	1.1e-58
AUV28392.1|4795191_4796019_+	hypothetical protein	NA	Q8HAA2	Salmonella_phage	90.2	6.2e-139
AUV28393.1|4796147_4796687_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	80.4	7.2e-80
AUV28394.1|4796847_4797102_+	hypothetical protein	NA	NA	NA	NA	NA
AUV28395.1|4797098_4797443_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29048.1|4798256_4798568_+	hypothetical protein	NA	Q9G077	Enterobacteria_phage	39.8	2.9e-09
AUV29047.1|4798569_4799142_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	80.4	1.6e-90
AUV28396.1|4799179_4799452_+	pyocin activator protein PrtN	NA	S5MQM5	Escherichia_phage	89.8	1.2e-38
AUV28397.1|4799516_4799810_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	98.2	2.9e-22
AUV28398.1|4799885_4800419_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	84.7	3.9e-86
>prophage 1
CP026237	Citrobacter freundii complex sp. CFNIH3 plasmid pCFR-9161, complete sequence	235027	1211	36767	235027	transposase	Salmonella_phage(42.86%)	37	NA	NA
AUV29130.1|1211_2234_+|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
AUV29131.1|2998_3826_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	39.9	3.7e-51
AUV29132.1|3907_4111_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29133.1|4388_4619_-	thioredoxin family protein	NA	NA	NA	NA	NA
AUV29134.1|4632_5634_-	permease	NA	NA	NA	NA	NA
AUV29327.1|5790_6300_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AUV29328.1|6450_6636_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29135.1|6890_7895_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AUV29136.1|8082_8691_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUV29137.1|8687_9839_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUV29138.1|9835_11041_+	ABC transporter permease	NA	NA	NA	NA	NA
AUV29139.1|11042_11753_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	3.7e-31
AUV29140.1|11781_12255_+	cytochrome C	NA	NA	NA	NA	NA
AUV29141.1|12241_13729_+	RND transporter	NA	NA	NA	NA	NA
AUV29142.1|13859_14417_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	3.4e-48
AUV29143.1|14419_15817_+	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	32.1	1.3e-117
AUV29144.1|15895_16900_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AUV29145.1|17359_17680_+	DUF134 domain-containing protein	NA	NA	NA	NA	NA
AUV29146.1|17654_18116_+	dinitrogenase iron-molybdenum cofactor	NA	NA	NA	NA	NA
AUV29147.1|18276_18714_+	PaaI family thioesterase	NA	NA	NA	NA	NA
AUV29148.1|18828_19305_+	DNA starvation/stationary phase protection protein	NA	G0X506	Salmonella_phage	28.7	6.7e-05
AUV29149.1|19609_19960_-	transcriptional regulator	NA	NA	NA	NA	NA
AUV29150.1|20120_21779_+	CoA-disulfide reductase	NA	NA	NA	NA	NA
AUV29151.1|22042_22684_-	resolvase	NA	NA	NA	NA	NA
AUV29152.1|22851_25890_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.5	5.0e-295
AUV29153.1|25913_26936_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV29154.1|27483_27762_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29155.1|27982_28312_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
AUV29156.1|28292_28574_+	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
AUV29157.1|28851_29832_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	4.4e-184
AUV29158.1|29951_30656_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.6e-138
AUV29159.1|30982_31483_+	ferritin	NA	NA	NA	NA	NA
AUV29160.1|31635_31770_+	ABC transporter	NA	NA	NA	NA	NA
AUV29161.1|31803_32508_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.6e-138
AUV29329.1|32592_33135_-|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	81.3	3.3e-48
AUV29162.1|33169_33775_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AUV29163.1|33869_36767_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
>prophage 2
CP026237	Citrobacter freundii complex sp. CFNIH3 plasmid pCFR-9161, complete sequence	235027	54660	128700	235027	transposase,protease	Escherichia_phage(41.67%)	60	NA	NA
AUV29183.1|54660_55665_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AUV29184.1|55743_58710_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.0	0.0e+00
AUV29185.1|58868_59159_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AUV29186.1|59155_59557_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AUV29187.1|59546_59903_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AUV29188.1|60157_60484_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29189.1|60480_60981_+|transposase	transposase	transposase	NA	NA	NA	NA
AUV29190.1|60977_61349_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29191.1|61342_61900_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
AUV29192.1|61978_62983_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AUV29193.1|63263_64232_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
AUV29194.1|64323_64896_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29195.1|64983_65433_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29196.1|65539_65941_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29197.1|65971_67243_-	MFS transporter	NA	NA	NA	NA	NA
AUV29198.1|67230_67743_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29199.1|67746_68217_-	thiol-disulfide isomerase	NA	NA	NA	NA	NA
AUV29200.1|69309_70314_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AUV29201.1|71775_72480_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV29202.1|72456_72666_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29203.1|72957_73218_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AUV29204.1|73217_73529_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUV29205.1|73552_76633_+|transposase	DDE transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
AUV29206.1|77257_77911_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUV29207.1|78653_78893_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29332.1|79698_79773_-	positive regulator of RepFIC repA1 expression	NA	NA	NA	NA	NA
AUV29208.1|79853_79967_+	replication protein RepA	NA	NA	NA	NA	NA
AUV29209.1|80007_80265_-	replication protein RepA	NA	NA	NA	NA	NA
AUV29210.1|80504_81083_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AUV29211.1|82615_85321_-	HTH-type transcriptional regulator MalT	NA	NA	NA	NA	NA
AUV29212.1|86499_88632_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29213.1|88633_89983_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29214.1|89979_90861_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUV29215.1|90875_92795_-	TolC family protein	NA	NA	NA	NA	NA
AUV29216.1|106792_107773_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.2e-184
AUV29333.1|107811_107928_-	ABC transporter	NA	NA	NA	NA	NA
AUV29217.1|108991_109963_-	plasmid-partitioning protein	NA	I3WF22	Macacine_betaherpesvirus	86.0	2.7e-149
AUV29218.1|109962_111129_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
AUV29219.1|111880_112891_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	8.8e-87
AUV29220.1|113227_113509_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29221.1|113607_114348_-	recombinase	NA	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AUV29222.1|114468_114690_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AUV29223.1|114996_115245_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AUV29224.1|115493_117167_-	DNA repair protein	NA	NA	NA	NA	NA
AUV29225.1|117414_117618_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29226.1|117731_118541_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29227.1|118558_118921_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29334.1|119104_119500_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29228.1|119483_119714_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AUV29229.1|119710_120127_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AUV29230.1|120200_121763_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AUV29231.1|121747_122770_+	DNA helicase UvrD	NA	NA	NA	NA	NA
AUV29232.1|122950_123645_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	3.7e-129
AUV29335.1|123958_124045_-	ABC transporter	NA	NA	NA	NA	NA
AUV29233.1|124020_124386_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29234.1|124382_124868_-	plasmid transfer protein	NA	NA	NA	NA	NA
AUV29235.1|125625_126426_+	trhR	NA	NA	NA	NA	NA
AUV29236.1|126519_127500_+|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AUV29336.1|127538_127718_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29237.1|127719_128700_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	3.4e-184
>prophage 3
CP026237	Citrobacter freundii complex sp. CFNIH3 plasmid pCFR-9161, complete sequence	235027	132854	200999	235027	transposase,plate,integrase	Escherichia_phage(36.67%)	54	135669:135728	202369:203761
AUV29243.1|132854_133943_-|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
AUV29244.1|134071_135604_-|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
135669:135728	attL	GGGCTTTGTTAATGGAATGGTCGCCTCCCATCTCTTGTGCCACAGTGGGACGATAAATCG	NA	NA	NA	NA
AUV29245.1|135755_136781_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV29246.1|137075_138044_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.0	4.2e-179
AUV29247.1|138362_139388_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV29248.1|139814_142007_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
AUV29249.1|142136_143420_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
AUV29250.1|143509_144943_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
AUV29251.1|144961_147409_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	70.5	9.4e-26
AUV29252.1|147522_149166_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	25.0	1.5e-22
AUV29253.1|149290_149857_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AUV29254.1|150191_150470_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29255.1|152168_152522_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
AUV29256.1|152569_152932_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AUV29257.1|152949_154701_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AUV29258.1|154749_156039_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.5e-171
AUV29259.1|156051_156477_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
AUV29337.1|156507_156912_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AUV29260.1|156920_157493_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	89.0	2.0e-83
AUV29261.1|157656_160665_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
AUV29262.1|160689_160878_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29263.1|160876_161857_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
AUV29338.1|161895_162027_-	ABC transporter	NA	NA	NA	NA	NA
AUV29264.1|162690_163395_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV29265.1|163612_164602_+|integrase	integrase	integrase	A0A0K0N6I5	Gordonia_phage	34.9	1.1e-06
AUV29266.1|164690_165803_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AUV29267.1|166078_166588_-|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	98.2	9.5e-90
AUV29268.1|166599_167181_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	100.0	5.9e-104
AUV29269.1|167216_168032_-	hypothetical protein	NA	Q1MVJ7	Enterobacteria_phage	95.2	6.6e-109
AUV29270.1|168041_169631_-	hypothetical protein	NA	A0A077SLN8	Escherichia_phage	98.9	1.2e-303
AUV29271.1|171662_172628_-	chromosome partitioning protein ParB	NA	Q1MVJ4	Enterobacteria_phage	98.8	6.3e-167
AUV29272.1|172624_173830_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	100.0	2.0e-226
AUV29273.1|174229_175090_-	replication protein RepA	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
AUV29339.1|175507_175906_+	hypothetical protein	NA	Q716C1	Shigella_phage	96.6	1.1e-37
AUV29274.1|176503_177529_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV29275.1|177823_178792_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
AUV29276.1|179092_179293_+	glycogen synthesis protein GlgS	NA	NA	NA	NA	NA
AUV29277.1|181183_181888_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV29278.1|182086_183469_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.5	9.4e-15
AUV29279.1|183709_184414_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV29280.1|186357_187062_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV29281.1|187120_187372_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29282.1|187485_188631_+	ABC transporter permease	NA	NA	NA	NA	NA
AUV29340.1|188627_189428_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	1.8e-10
AUV29283.1|189429_190368_+	MCE family protein	NA	NA	NA	NA	NA
AUV29284.1|190367_191009_+	ABC transporter	NA	NA	NA	NA	NA
AUV29285.1|191356_192634_+	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
AUV29286.1|193290_193560_+	hypothetical protein	NA	Q71TE9	Escherichia_phage	95.3	3.3e-41
AUV29287.1|194386_194764_+	hypothetical protein	NA	Q71TF0	Escherichia_phage	95.2	1.9e-63
AUV29288.1|194773_195856_+	murein transglycosylase B	NA	NA	NA	NA	NA
AUV29289.1|196873_197578_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV29290.1|198474_199278_-	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
AUV29291.1|199268_199808_-	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
AUV29292.1|200018_200999_-|transposase	IS5 family transposase ISEc68	transposase	Q38213	Escherichia_phage	80.9	1.4e-153
202369:203761	attR	GGGCTTTGTTAATGGAATGGTCGCCTCCCATCTCTTGTGCCACAGTGGGACGATAAATCGTCACTCATTGAACGGAGCGCTGCTATCATGAACGTTAAAACTATTGGAATCGATTTGGCAAAAAACGTTTTCCAGATCCATGGGGTTGACGAGCACGGAAAACGGTTGTTCAACAAACAACTCAGACGGGCACAAATGGCCTCCTTTTTTGCCAACATCCCACCCTGTTTGATCGGCATGGAGGCCTGTGCATCTGCTCATTTCTGGGCCAATAAACTGATATCGATGGGCCATAATGTCAAACTGATGGCCCCTCAGTTCGTCAAACCCTATGTTAAAACCAATAAGCATGATGCTGCAGACGCTGAAGCTATTTGTGAAGCCGTCACTCGACCTAACATGCGGTTCGTGCCGGTCAAAACCGCTGAGCAGCAAGCCGTATTGGCACTTCACCGGAGTCGTCAGAGCTTCATCAAACAGCGAACCGCACAAGCCAATCAAATCAGGGGGTTATTGGCCGAATTTGGCATTGTCGTCCCCCGAGGTATCCAGCAGCTACAGCGACGATTACCTGAGCTCGTGGAAGATGCGGATAACCCGTTACCCGTCCTGTTTCGTACACAGCTGAGTCTACTACAGCACCACATGGCGTACCTGTTCGATGTCATCGCTACACTCGACAAGCAGATTGAGCAGTGCTATCGGCAAAATGCTCTCTGCCAGCGTATCGGCAAGATCCCTGGTATTGGCCCTGTTACCGCCAGCGCGCTGATTGCGACCATTGGTAAAGCCAACAATTTCGAGAATGGCCGACAACTGGCTGCCTGGCTCGGATTGGTTCCACGTCAGCACTCCAGTGGGGGTAAACAAGTCCTGCTCGGGATAAGCAAGCGAGGTGATACCTATTTGAGGACCTTGCTTATCCATGGTGCCAGGGCGGTATTGCAGTCGGCCAAACATAAACAGGATGCCGTATCGAGCTGGGCTAACCAGCTAATGGCGCGCCGGAATAACAACATTGCCTCGGTAGCATTGGCTAACAAGAATGCGCGGACTGTGTGGGCGCTCCTGGCCAAAGAGCGGGAGTATTGTGCACCAATAATAAGCGCTTAAGTTGCTTAATCAGTAAGACAGAAACAACACCACCGATTGCCCAGGCAAGCATGAAGTGATGGCAAGACAGGTCAGACCGCGATGGGGAAAACCCGGTTTATTCAAGGCTCCTGAAAGAGCGCTTTGTTGATAGAGGCCTCCATCAGCGTATTCCATCAGGGACAGAGGTATTTTACATCACCTCGGCAAAGTCCGGATCTATGGCTGCAATCGATGACCAGTAAAGCCACCACAACATATTTAGCTTGGCAAACAGGAGGCGACCATCTATGAATAAATC	NA	NA	NA	NA
>prophage 4
CP026237	Citrobacter freundii complex sp. CFNIH3 plasmid pCFR-9161, complete sequence	235027	212835	224015	235027	transposase,integrase	Escherichia_phage(57.14%)	11	205724:205738	222258:222272
205724:205738	attL	AATCAGGGTGTTCAG	NA	NA	NA	NA
AUV29309.1|212835_213540_+	DDE domain-containing protein	NA	A0A077SL39	Escherichia_phage	98.3	7.1e-136
AUV29310.1|213670_214672_+	endoglucanase	NA	NA	NA	NA	NA
AUV29311.1|214728_215433_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
AUV29312.1|215483_216167_+	DNA polymerase V	NA	F1C5A5	Cronobacter_phage	61.8	5.4e-72
AUV29313.1|216171_216600_-	plasmid stability protein	NA	NA	NA	NA	NA
AUV29314.1|216568_217540_-	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	42.9	1.3e-66
AUV29315.1|217768_218413_+	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
AUV29316.1|218406_218682_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AUV29317.1|218819_219602_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	7.1e-52
AUV29318.1|219669_220278_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29319.1|221393_224015_+	histidinol-phosphatase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	23.6	1.1e-16
222258:222272	attR	CTGAACACCCTGATT	NA	NA	NA	NA
>prophage 1
CP026236	Citrobacter freundii complex sp. CFNIH3 plasmid pKPC-59e4, complete sequence	65291	0	1448	65291		Pandoravirus(100.0%)	2	NA	NA
AUV29072.1|226_445_+	hypothetical protein	NA	NA	NA	NA	NA
AUV29073.1|632_1448_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
>prophage 2
CP026236	Citrobacter freundii complex sp. CFNIH3 plasmid pKPC-59e4, complete sequence	65291	5231	6092	65291		Enterobacteria_phage(100.0%)	1	NA	NA
AUV29077.1|5231_6092_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
>prophage 3
CP026236	Citrobacter freundii complex sp. CFNIH3 plasmid pKPC-59e4, complete sequence	65291	9321	9879	65291		Enterobacteria_phage(100.0%)	1	NA	NA
AUV29080.1|9321_9879_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
>prophage 4
CP026236	Citrobacter freundii complex sp. CFNIH3 plasmid pKPC-59e4, complete sequence	65291	15954	28991	65291	transposase	Escherichia_phage(25.0%)	11	NA	NA
AUV29083.1|15954_16980_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AUV29084.1|16976_17756_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AUV29085.1|18142_19024_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AUV29086.1|19273_20593_-|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AUV29087.1|22194_22764_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
AUV29088.1|23115_24336_-	hypothetical protein	NA	NA	NA	NA	NA
AUV29089.1|24720_25440_-	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
AUV29090.1|25999_26341_+	ArdK family transcriptional regulator	NA	NA	NA	NA	NA
AUV29125.1|26355_27147_-	sprT domain-containing protein	NA	NA	NA	NA	NA
AUV29091.1|27297_28563_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	53.8	2.2e-119
AUV29092.1|28550_28991_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
>prophage 5
CP026236	Citrobacter freundii complex sp. CFNIH3 plasmid pKPC-59e4, complete sequence	65291	32354	40851	65291	transposase	uncultured_Caudovirales_phage(60.0%)	8	NA	NA
AUV29098.1|32354_35363_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
AUV29099.1|35526_36099_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	89.0	2.0e-83
AUV29126.1|36107_36512_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AUV29100.1|36542_36968_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
AUV29101.1|36980_38270_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.5e-171
AUV29102.1|38318_40070_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AUV29103.1|40087_40450_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AUV29104.1|40497_40851_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
>prophage 6
CP026236	Citrobacter freundii complex sp. CFNIH3 plasmid pKPC-59e4, complete sequence	65291	49515	54394	65291	transposase	Bacillus_phage(50.0%)	3	NA	NA
AUV29113.1|49515_52752_+	conjugative relaxase	NA	U5J9B0	Bacillus_phage	27.3	2.4e-05
AUV29114.1|52751_53117_+	FipA	NA	NA	NA	NA	NA
AUV29115.1|53689_54394_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 7
CP026236	Citrobacter freundii complex sp. CFNIH3 plasmid pKPC-59e4, complete sequence	65291	58135	61676	65291		uncultured_Caudovirales_phage(66.67%)	4	NA	NA
AUV29118.1|58135_59626_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	82.2	8.6e-224
AUV29119.1|59660_60515_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	48.6	1.3e-67
AUV29120.1|60605_60938_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AUV29121.1|61055_61676_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	37.1	1.1e-26
