The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026199	Escherichia coli strain ECONIH6 chromosome, complete genome	4869246	662021	742530	4869246	holin,head,integrase,tail,capsid,tRNA,terminase,transposase,portal	Escherichia_phage(40.82%)	97	694680:694694	742632:742646
AUV19915.1|662021_663242_+|transposase	ISL3 family transposase ISKox3	transposase	NA	NA	NA	NA
AUV23793.1|663617_664529_+	hemolysin HlyE	NA	NA	NA	NA	NA
AUV19916.1|664735_665197_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
AUV19917.1|665273_665933_-	isomerase/hydrolase	NA	NA	NA	NA	NA
AUV19918.1|666004_666298_-	hypothetical protein	NA	NA	NA	NA	NA
AUV19919.1|666539_666941_+	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
AUV19920.1|667043_667412_-	hypothetical protein	NA	NA	NA	NA	NA
AUV19921.1|667564_667792_-	hypothetical protein	NA	NA	NA	NA	NA
AUV19922.1|667931_668627_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
AUV19923.1|668650_669463_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
AUV19924.1|669466_669733_+	cell division topological specificity factor	NA	NA	NA	NA	NA
AUV23794.1|670562_670748_-	hypothetical protein	NA	NA	NA	NA	NA
AUV19925.1|670848_671022_+	hypothetical protein	NA	NA	NA	NA	NA
AUV19926.1|671023_671368_+	glycine zipper family protein	NA	NA	NA	NA	NA
AUV19927.1|672890_674411_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AUV19928.1|674662_674806_+	hypothetical protein	NA	NA	NA	NA	NA
AUV19929.1|674810_675029_-	hypothetical protein	NA	NA	NA	NA	NA
AUV19930.1|675160_676684_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AUV19931.1|677015_677264_-	hypothetical protein	NA	NA	NA	NA	NA
AUV19932.1|677376_677643_-	RcsB connector protein for regulation of biofilm and acid-resistance	NA	NA	NA	NA	NA
AUV19933.1|677671_677944_-	two-component-system connector protein YmgA	NA	NA	NA	NA	NA
AUV19934.1|677986_678223_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
AUV19935.1|678536_679748_+	blue light- and temperature-regulated antirepressor BluF	NA	NA	NA	NA	NA
AUV19936.1|679952_680684_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
AUV19937.1|680904_681309_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AUV19938.1|681956_683153_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV19939.1|683462_683786_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
AUV19940.1|683888_685139_-	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	96.3	3.2e-22
AUV19941.1|685310_685964_+	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AUV19942.1|685973_686435_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AUV19943.1|686488_687595_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUV23795.1|687630_688272_+	lysogenization protein HflD	NA	NA	NA	NA	NA
AUV19944.1|688275_689646_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
AUV19945.1|689814_690486_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AUV19946.1|690485_691946_+	sensor protein PhoQ	NA	NA	NA	NA	NA
AUV19947.1|692021_693143_+	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AUV19948.1|693191_694418_-	peptidase T	NA	NA	NA	NA	NA
AUV23796.1|694473_694689_+	hypothetical protein	NA	NA	NA	NA	NA
AUV19949.1|694667_695804_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
694680:694694	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
AUV19950.1|695787_696651_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AUV23797.1|697247_697874_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUV19951.1|697818_697956_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AUV19952.1|698111_698642_-	chaperone of endosialidase	NA	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
AUV19953.1|699375_699747_-	hypothetical protein	NA	NA	NA	NA	NA
AUV19954.1|700040_701564_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AUV19955.1|705517_706117_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
AUV19956.1|706184_709664_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
AUV19957.1|709724_710372_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	2.6e-108
AUV19958.1|710269_711013_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
AUV19959.1|711018_711717_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
AUV19960.1|711716_712073_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
AUV23798.1|712050_715278_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
AUV23799.1|715324_715585_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
AUV19961.1|715626_716013_-|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
AUV19962.1|716012_716717_-|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
AUV19963.1|716777_717122_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
AUV19964.1|717118_717568_-	hypothetical protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
AUV19965.1|717564_717903_-|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
AUV19966.1|717911_718229_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
AUV19967.1|718305_719523_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
AUV19968.1|720128_721355_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
AUV19969.1|721502_723260_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
AUV19970.1|723259_723742_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
AUV19971.1|723889_724240_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
AUV19972.1|724532_724673_-	Rz1 lytic protein	NA	U5P461	Shigella_phage	84.6	1.0e-09
AUV19973.1|724765_725059_+	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
AUV19974.1|725149_725332_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
AUV19975.1|725384_725612_+	hypothetical protein	NA	NA	NA	NA	NA
AUV19976.1|725548_726082_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
AUV19977.1|726145_726496_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
AUV19978.1|726500_726716_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
AUV19979.1|726865_727027_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
AUV19980.1|727023_727212_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
AUV19981.1|727472_727808_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
AUV19982.1|727878_728091_+	hypothetical protein	NA	NA	NA	NA	NA
AUV19983.1|729060_729882_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
AUV19984.1|729878_730259_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
AUV19985.1|730259_731318_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
AUV19986.1|731319_731598_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
AUV19987.1|731765_731978_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
AUV19988.1|732180_732360_-	hypothetical protein	NA	NA	NA	NA	NA
AUV19989.1|733012_733195_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
AUV19990.1|733288_733645_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
AUV19991.1|733702_734125_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
AUV19992.1|734165_735236_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
AUV19993.1|735307_735733_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUV19994.1|735716_735959_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
AUV23800.1|736164_736689_+	LexA family transcriptional repressor	NA	H9C160	Pectobacterium_phage	28.0	2.2e-12
AUV19995.1|736900_737059_+	hypothetical protein	NA	NA	NA	NA	NA
AUV19996.1|737042_737342_+	hypothetical protein	NA	NA	NA	NA	NA
AUV19997.1|737413_737632_+	hypothetical protein	NA	NA	NA	NA	NA
AUV19998.1|737596_737851_-	hypothetical protein	NA	NA	NA	NA	NA
AUV19999.1|738200_738389_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AUV20000.1|738385_738577_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUV20001.1|738670_741112_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
AUV20002.1|741173_741443_+	excisionase	NA	NA	NA	NA	NA
AUV20003.1|741411_742530_+|integrase	integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
742632:742646	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 2
CP026199	Escherichia coli strain ECONIH6 chromosome, complete genome	4869246	1679560	1734019	4869246	integrase,tail,terminase,transposase,portal,lysis	Enterobacteria_phage(39.62%)	68	1674729:1674777	1719483:1719531
1674729:1674777	attL	AAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AUV23836.1|1679560_1679689_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.6	1.7e-11
AUV20850.1|1679743_1683502_-	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	93.4	0.0e+00
AUV20851.1|1683566_1684166_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
AUV20852.1|1684235_1687733_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.0	0.0e+00
AUV20853.1|1687793_1688441_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.3	6.2e-110
AUV20854.1|1688338_1689082_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	2.3e-148
AUV20855.1|1689087_1689786_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
AUV20856.1|1689795_1690125_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	1.7e-60
AUV20857.1|1690124_1693190_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
AUV20858.1|1693161_1693491_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AUV23837.1|1693499_1693886_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
AUV20859.1|1693946_1694690_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.2	2.3e-132
AUV20860.1|1694700_1695102_-|tail	phage tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
AUV20861.1|1695098_1695677_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
AUV20862.1|1695688_1695964_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AUV20863.1|1695956_1696325_-	DUF2190 domain-containing protein	NA	A0A291AWX2	Escherichia_phage	99.1	9.7e-52
AUV20864.1|1696366_1698490_-	peptidase S14	NA	A0A291AWT6	Escherichia_phage	99.4	0.0e+00
AUV20865.1|1698377_1699847_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	3.1e-282
AUV20866.1|1699846_1700059_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AUV20867.1|1700055_1702158_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.1	0.0e+00
AUV20868.1|1702157_1702649_-	DUF1441 domain-containing protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
AUV20869.1|1703324_1703477_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	98.0	4.7e-21
AUV20870.1|1703464_1703932_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
AUV20871.1|1703928_1704426_-	lysozyme	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
AUV20872.1|1704425_1704641_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AUV20873.1|1704708_1705761_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
AUV20874.1|1705911_1706115_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
AUV20875.1|1706383_1707325_+	hypothetical protein	NA	A5LH79	Enterobacteria_phage	44.2	5.0e-68
AUV20876.1|1707346_1707796_+	hypothetical protein	NA	A5LH78	Enterobacteria_phage	43.8	8.0e-24
AUV20877.1|1707831_1708200_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	87.5	9.4e-55
AUV20878.1|1708214_1709204_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	7.5e-192
AUV20879.1|1709211_1710021_-	DNA-binding protein	NA	A0A291AWU7	Escherichia_phage	98.1	1.4e-148
AUV20880.1|1710040_1710430_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
AUV20881.1|1710426_1710753_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
AUV20882.1|1710749_1711403_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	8.1e-126
AUV20883.1|1711402_1711897_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
AUV20884.1|1711893_1712865_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	89.5	4.4e-136
AUV20885.1|1712854_1713034_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AUV20886.1|1713209_1713761_-	hypothetical protein	NA	U5P4K1	Shigella_phage	98.9	3.8e-100
AUV20887.1|1713753_1714014_-	XRE family transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	7.1e-41
AUV20888.1|1713985_1714138_-	amino acid permease	NA	NA	NA	NA	NA
AUV20889.1|1714111_1714804_+	XRE family transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
AUV20890.1|1714859_1715138_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	97.4	3.0e-13
AUV20891.1|1715239_1715434_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	98.4	2.5e-30
AUV20892.1|1715506_1715869_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AUV20893.1|1715934_1716759_+	DUF2303 domain-containing protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AUV20894.1|1716886_1717423_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
AUV20895.1|1717413_1717776_+	hypothetical protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
AUV20896.1|1717775_1718081_+	hypothetical protein	NA	U5P0J0	Shigella_phage	98.0	5.8e-50
AUV20897.1|1718080_1718431_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
AUV23838.1|1718532_1719471_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	98.7	3.3e-181
AUV20898.1|1719675_1720929_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
1719483:1719531	attR	AAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AUV20899.1|1720940_1722044_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AUV20900.1|1722331_1723387_+	outer membrane pore protein E	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
AUV20901.1|1723425_1723827_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
AUV20902.1|1723884_1725129_-	esterase	NA	NA	NA	NA	NA
AUV20903.1|1725220_1725679_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AUV20904.1|1725939_1727397_+	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
AUV20905.1|1727453_1727990_-	peptide chain release factor H	NA	NA	NA	NA	NA
AUV20906.1|1727922_1728189_-	hypothetical protein	NA	NA	NA	NA	NA
AUV20907.1|1728175_1728373_+	hypothetical protein	NA	NA	NA	NA	NA
AUV20908.1|1728494_1728947_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUV20909.1|1728956_1729355_-	mRNA interferase YafO	NA	NA	NA	NA	NA
AUV20910.1|1729357_1729651_-	antitoxin YafN	NA	NA	NA	NA	NA
AUV20911.1|1729702_1730758_-	DNA polymerase IV	NA	NA	NA	NA	NA
AUV23839.1|1730828_1731599_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
AUV20912.1|1731558_1733298_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AUV20913.1|1733521_1734019_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
CP026199	Escherichia coli strain ECONIH6 chromosome, complete genome	4869246	2096785	2125497	4869246	holin,transposase	Escherichia_phage(22.22%)	25	NA	NA
AUV21233.1|2096785_2098171_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	1.9e-257
AUV21234.1|2098409_2099783_-	esterase-like activity of phytase	NA	NA	NA	NA	NA
AUV21235.1|2100146_2100356_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.9e-06
AUV21236.1|2100518_2100776_-	biofilm development YmgB/AriR family protein	NA	NA	NA	NA	NA
AUV21237.1|2102526_2103048_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AUV21238.1|2103044_2103998_+	FecR family protein	NA	NA	NA	NA	NA
AUV21239.1|2104084_2106409_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUV21240.1|2106453_2107356_+	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AUV21241.1|2107352_2108351_+	iron-dicitrate transporter permease subunit	NA	NA	NA	NA	NA
AUV21242.1|2108347_2109304_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AUV21243.1|2109304_2110072_+	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AUV21244.1|2110629_2111043_-	hypothetical protein	NA	NA	NA	NA	NA
AUV21245.1|2111537_2113061_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AUV21246.1|2113354_2113792_+	hypothetical protein	NA	NA	NA	NA	NA
AUV21247.1|2114642_2115464_+	carbohydrate transporter	NA	NA	NA	NA	NA
AUV21248.1|2115466_2116555_+	glycosyl transferase	NA	NA	NA	NA	NA
AUV21249.1|2116559_2117510_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AUV21250.1|2117574_2118519_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AUV21251.1|2118699_2119839_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
AUV21252.1|2119986_2121990_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AUV21253.1|2121934_2122093_+|holin	choline transporter	holin	NA	NA	NA	NA
AUV21254.1|2122052_2123330_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AUV21255.1|2123609_2124772_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	2.0e-50
AUV21256.1|2124838_2125057_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUV21257.1|2125107_2125497_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.2	1.9e-61
>prophage 4
CP026199	Escherichia coli strain ECONIH6 chromosome, complete genome	4869246	2545892	2586002	4869246	holin,head,integrase,plate,tail,capsid,terminase,transposase,portal,lysis	Escherichia_phage(53.19%)	49	2542768:2542782	2586084:2586098
2542768:2542782	attL	TGTAGGCCTGATAAG	NA	NA	NA	NA
AUV21624.1|2545892_2547262_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
AUV21625.1|2547334_2547589_-	transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AUV21626.1|2547634_2548798_-	hypothetical protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
AUV21627.1|2548797_2549277_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
AUV21628.1|2549291_2551739_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.2	0.0e+00
AUV23871.1|2551731_2551851_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AUV21629.1|2551883_2552159_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
AUV21630.1|2552215_2552734_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AUV21631.1|2552746_2553937_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
AUV21632.1|2553996_2554599_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	95.3	3.5e-99
AUV21633.1|2554606_2556142_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
AUV21634.1|2556190_2556538_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AUV21635.1|2556534_2556939_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
AUV21636.1|2557080_2557596_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	56.8	5.0e-46
AUV23872.1|2557610_2558213_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	75.5	2.5e-81
AUV21637.1|2558184_2558601_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.0	3.4e-21
AUV21638.1|2559895_2560507_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.4e-116
AUV21639.1|2560499_2561408_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	3.7e-161
AUV21640.1|2561412_2561760_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
AUV21641.1|2561756_2562392_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.5e-111
AUV21642.1|2562458_2562911_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	4.5e-75
AUV21643.1|2562903_2563371_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	3.3e-81
AUV21644.1|2563333_2563507_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
AUV21645.1|2563478_2563904_-	protein lysB	NA	A0A0F7L9Y0	Escherichia_phage	94.3	1.3e-63
AUV21646.1|2563891_2564317_-	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	92.9	3.7e-55
AUV21647.1|2564331_2564829_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
AUV21648.1|2564828_2565110_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AUV21649.1|2565113_2565317_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	98.5	2.6e-30
AUV21650.1|2565316_2565826_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AUV21651.1|2565925_2566669_-|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	96.4	4.6e-125
AUV21652.1|2566672_2567746_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	98.9	2.2e-200
AUV21653.1|2567804_2568659_-|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.6	1.7e-136
AUV21654.1|2568832_2570605_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
AUV21655.1|2570604_2571639_+|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.1	1.6e-200
AUV21656.1|2571677_2571887_-	hypothetical protein	NA	M1TAP7	Escherichia_phage	83.0	2.7e-14
AUV21657.1|2572010_2574494_+	helicase	NA	NA	NA	NA	NA
AUV21658.1|2575811_2576558_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AUV21659.1|2576572_2578114_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
AUV21660.1|2579588_2579864_-	hypothetical protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
AUV21661.1|2579860_2580085_-	hypothetical protein	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
AUV21662.1|2580084_2580387_-	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
AUV21663.1|2580386_2580611_-	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AUV23873.1|2580674_2581175_-	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AUV21664.1|2581344_2581617_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
AUV21665.1|2581753_2582047_+	transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
AUV21666.1|2582116_2583097_+|integrase	integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
AUV23874.1|2583283_2583784_-	periplasmic protein CpxP	NA	NA	NA	NA	NA
AUV21667.1|2583933_2584632_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AUV21668.1|2584628_2586002_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
2586084:2586098	attR	CTTATCAGGCCTACA	NA	NA	NA	NA
>prophage 5
CP026199	Escherichia coli strain ECONIH6 chromosome, complete genome	4869246	3924771	3937954	4869246		Escherichia_phage(50.0%)	12	NA	NA
AUV22902.1|3924771_3925533_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
AUV22903.1|3925526_3926153_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AUV22904.1|3926292_3927432_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AUV22905.1|3927494_3928487_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AUV22906.1|3928580_3929945_-	permease	NA	NA	NA	NA	NA
AUV22907.1|3930033_3930810_-	hypothetical protein	NA	NA	NA	NA	NA
AUV22908.1|3930814_3931453_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AUV22909.1|3931449_3932712_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
AUV22910.1|3932708_3933617_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
AUV22911.1|3933812_3934580_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AUV22912.1|3934630_3935287_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
AUV22913.1|3935392_3937954_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 6
CP026199	Escherichia coli strain ECONIH6 chromosome, complete genome	4869246	4288252	4331618	4869246	holin,integrase,coat,tail,terminase,transposase,portal,lysis	Enterobacteria_phage(54.39%)	61	4285784:4285800	4334872:4334888
4285784:4285800	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
AUV23222.1|4288252_4289686_-	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
AUV23223.1|4289901_4290816_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
AUV23224.1|4290887_4292135_+	sucrose transporter	NA	NA	NA	NA	NA
AUV23225.1|4292664_4292865_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AUV23226.1|4292988_4293333_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	98.2	2.2e-58
AUV23227.1|4293360_4293528_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
AUV23228.1|4293746_4293899_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	73.7	5.1e-07
AUV23229.1|4293876_4294119_-	hypothetical protein	NA	NA	NA	NA	NA
AUV23230.1|4295222_4295975_-	hypothetical protein	NA	K7P6J7	Enterobacteria_phage	79.6	2.6e-99
AUV23231.1|4295971_4296514_-	hypothetical protein	NA	K7P7V4	Enterobacteria_phage	72.2	4.2e-59
AUV23232.1|4296510_4296675_-	DUF2737 domain-containing protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.9e-23
AUV23233.1|4296685_4296979_-	RecBCD nuclease inhibitor	NA	K7P7E6	Enterobacteria_phage	99.0	1.9e-50
AUV23234.1|4296992_4297472_-	hypothetical protein	NA	Q716E9	Shigella_phage	99.4	4.6e-94
AUV23235.1|4297481_4297955_-	single-stranded DNA-binding protein	NA	G8EYH4	Enterobacteria_phage	96.8	2.5e-60
AUV23236.1|4297955_4298663_-	recombinase	NA	K7PKU3	Enterobacteria_phage	99.6	6.5e-137
AUV23237.1|4298917_4299130_-	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	100.0	1.3e-32
AUV23238.1|4299484_4299727_-	hypothetical protein	NA	U5PUY0	Salmonella_phage	57.1	7.1e-19
AUV23239.1|4299737_4300037_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	97.0	1.7e-30
AUV23240.1|4300438_4301089_-	LexA family transcriptional repressor	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
AUV23241.1|4301169_4301355_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
AUV23242.1|4301463_4301757_+	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
AUV23243.1|4301779_4302052_+	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
AUV23949.1|4302114_4303002_+	replication protein	NA	A5VW95	Enterobacteria_phage	99.0	1.1e-144
AUV23244.1|4302998_4304375_+	replicative DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	9.7e-254
AUV23245.1|4304430_4304889_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.6e-80
AUV23246.1|4304885_4305413_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	98.9	6.2e-100
AUV23247.1|4305409_4305592_+	NinE family protein	NA	C6ZR57	Salmonella_phage	98.3	3.7e-28
AUV23248.1|4305588_4305759_+	protein ninF	NA	K7PM86	Enterobacteria_phage	100.0	5.5e-26
AUV23249.1|4305751_4306474_+	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
AUV23250.1|4306473_4306764_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	97.9	4.2e-50
AUV23251.1|4306760_4307123_+	hypothetical protein	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
AUV23252.1|4307119_4307308_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
AUV23253.1|4307304_4307928_+	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
AUV23950.1|4308068_4308251_-	hypothetical protein	NA	A0A088CPS7	Enterobacteria_phage	91.5	1.2e-23
AUV23254.1|4308361_4308685_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AUV23255.1|4308668_4309145_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
AUV23256.1|4309141_4309579_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	95.9	3.6e-69
AUV23257.1|4309566_4309719_+	hypothetical protein	NA	Q716B2	Shigella_phage	94.0	1.2e-19
AUV23258.1|4309958_4310339_+	hypothetical protein	NA	Q716B1	Shigella_phage	99.2	1.4e-66
AUV23259.1|4310442_4310685_+	DUF2560 domain-containing protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AUV23260.1|4310720_4311209_+	DNA-packaging protein	NA	A0A0M3ULC0	Salmonella_phage	100.0	5.0e-88
AUV23261.1|4311186_4312686_+|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.8	2.4e-306
AUV23262.1|4312686_4314852_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	98.8	0.0e+00
AUV23263.1|4314865_4315777_+	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	99.3	1.1e-160
AUV23264.1|4315776_4317075_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	95.6	3.4e-232
AUV23265.1|4317119_4317512_+	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	98.0	4.5e-23
AUV23266.1|4317489_4317990_+	recombinase RmuC	NA	G8EYJ2	Enterobacteria_phage	100.0	1.7e-91
AUV23267.1|4317990_4319409_+	hypothetical protein	NA	A0A088CQ70	Enterobacteria_phage	98.7	4.3e-273
AUV23268.1|4319408_4320110_+|tail	phage tail protein	tail	G5DA78	Enterobacteria_phage	97.4	4.3e-117
AUV23269.1|4320109_4320565_+	hypothetical protein	NA	A5VW67	Enterobacteria_phage	99.3	5.2e-87
AUV23270.1|4320567_4321260_+	DNA transfer protein	NA	A5VW66	Enterobacteria_phage	97.8	5.8e-114
AUV23271.1|4321270_4322686_+	acyltransferase	NA	I6RSG0	Salmonella_phage	80.9	4.4e-201
AUV23272.1|4322685_4324524_+	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	74.4	1.5e-246
AUV23951.1|4324548_4324917_-	hypothetical protein	NA	I6S5X4	Salmonella_phage	99.2	1.7e-64
AUV23273.1|4325094_4326063_+	hypothetical protein	NA	A9YX09	Burkholderia_phage	48.6	8.5e-71
AUV23274.1|4326078_4326330_-	toxin-antitoxin system HicB family antitoxin	NA	E7C9U8	Salmonella_phage	91.6	1.1e-35
AUV23275.1|4326476_4328384_+	hypothetical protein	NA	A0A2P1CCP7	Klebsiella_phage	75.2	2.4e-242
AUV23276.1|4328595_4329816_+|transposase	ISL3 family transposase ISKox3	transposase	NA	NA	NA	NA
AUV23277.1|4329871_4330111_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	57.0	2.3e-17
AUV23278.1|4330110_4330428_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.5	2.8e-23
AUV23279.1|4330460_4331618_-|integrase	integrase	integrase	A5VW56	Enterobacteria_phage	99.5	3.7e-222
4334872:4334888	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 7
CP026199	Escherichia coli strain ECONIH6 chromosome, complete genome	4869246	4674987	4685299	4869246		Enterobacteria_phage(22.22%)	10	NA	NA
AUV23574.1|4674987_4675662_+	hypothetical protein	NA	A0A1V0E6Q2	Klebsiella_phage	25.2	6.4e-09
AUV23575.1|4675697_4677026_+	flippase	NA	NA	NA	NA	NA
AUV23963.1|4677105_4677498_+	serine acetyltransferase	NA	A0A191KBJ5	Streptococcus_virus	41.1	6.8e-11
AUV23576.1|4677669_4679076_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
AUV23577.1|4679300_4680365_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	4.4e-105
AUV23578.1|4680391_4681261_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	9.8e-111
AUV23579.1|4681292_4682183_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.2	3.7e-28
AUV23580.1|4682197_4682752_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.8	1.0e-52
AUV23581.1|4682932_4684099_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
AUV23582.1|4684291_4685299_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
>prophage 1
CP026200	Escherichia coli strain ECONIH6 plasmid pECO-6dfa, complete sequence	97800	0	72564	97800	protease,integrase,transposase	Escherichia_phage(42.86%)	59	67563:67622	73583:74351
AUV23976.1|2239_2944_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV23977.1|3190_3673_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	6.6e-16
AUV23978.1|4877_5582_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV23979.1|6518_6761_+	relaxase	NA	NA	NA	NA	NA
AUV23980.1|6792_7470_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUV23981.1|7548_8748_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AUV23982.1|8779_9664_-	EamA family transporter	NA	NA	NA	NA	NA
AUV24051.1|9801_10194_-	cysteine hydrolase	NA	NA	NA	NA	NA
AUV23983.1|12790_13072_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
AUV23984.1|13068_13338_-	hypothetical protein	NA	NA	NA	NA	NA
AUV23985.1|14727_14907_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	60.3	6.8e-11
AUV24052.1|15130_15448_+	hypothetical protein	NA	NA	NA	NA	NA
AUV24053.1|15555_16443_+	WYL domain-containing protein	NA	NA	NA	NA	NA
AUV23986.1|16452_17052_+	DUF1819 domain-containing protein	NA	NA	NA	NA	NA
AUV23987.1|17048_17633_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
AUV23988.1|17651_21329_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
AUV23989.1|21345_23109_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AUV23990.1|23124_26754_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
AUV23991.1|26753_29411_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
AUV24054.1|29472_31518_+|protease	BREX system Lon protease-like protein BrxL	protease	NA	NA	NA	NA
AUV23992.1|32193_33198_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV23993.1|35075_35780_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV23994.1|35770_36007_+	hypothetical protein	NA	NA	NA	NA	NA
AUV23995.1|36280_37246_-	chromosome partitioning protein ParB	NA	Q1MVJ4	Enterobacteria_phage	100.0	3.3e-168
AUV23996.1|37242_38448_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	100.0	2.0e-226
AUV23997.1|38847_39708_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	99.7	1.4e-157
AUV23998.1|40025_40292_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	94.8	2.3e-26
AUV23999.1|40361_41561_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AUV24000.1|41570_41759_-	hypothetical protein	NA	NA	NA	NA	NA
AUV24001.1|41773_41986_-	hypothetical protein	NA	NA	NA	NA	NA
AUV24002.1|42437_43403_+	DNA primase	NA	A0A1V0EEV1	Caulobacter_phage	43.0	3.3e-59
AUV24003.1|43882_44314_+	hypothetical protein	NA	NA	NA	NA	NA
AUV24004.1|44345_44873_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	2.8e-20
AUV24005.1|44865_45612_-	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
AUV24006.1|45626_47534_-	MFS transporter	NA	NA	NA	NA	NA
AUV24007.1|48242_48635_-	DNA-binding protein	NA	NA	NA	NA	NA
AUV24008.1|48631_50833_-	type IA DNA topoisomerase	NA	NA	NA	NA	NA
AUV24009.1|50829_51138_-	hypothetical protein	NA	NA	NA	NA	NA
AUV24010.1|51113_51449_-	hypothetical protein	NA	NA	NA	NA	NA
AUV24011.1|51475_51793_-	hypothetical protein	NA	NA	NA	NA	NA
AUV24012.1|51883_52285_-	hypothetical protein	NA	NA	NA	NA	NA
AUV24013.1|52271_53321_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
AUV24014.1|53324_54521_-	hypothetical protein	NA	NA	NA	NA	NA
AUV24015.1|54517_55411_-	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
AUV24016.1|55403_56090_-	hypothetical protein	NA	NA	NA	NA	NA
AUV24017.1|56299_57307_-	conjugal transfer protein	NA	NA	NA	NA	NA
AUV24018.1|57324_57609_-	entry exclusion protein	NA	NA	NA	NA	NA
AUV24055.1|57620_58331_-	type IV secretion system protein VirB5	NA	NA	NA	NA	NA
AUV24019.1|58355_61106_-	ATPase	NA	NA	NA	NA	NA
AUV24020.1|61115_61415_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
AUV24021.1|61425_62088_-	transglycosylase	NA	NA	NA	NA	NA
AUV24022.1|62090_62306_-	hypothetical protein	NA	NA	NA	NA	NA
AUV24023.1|62298_62607_-	hypothetical protein	NA	NA	NA	NA	NA
AUV24024.1|62920_63835_+	hypothetical protein	NA	NA	NA	NA	NA
AUV24025.1|63838_64822_+	hypothetical protein	NA	NA	NA	NA	NA
AUV24026.1|64814_65303_+	oxidoreductase	NA	NA	NA	NA	NA
AUV24027.1|65299_67018_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	27.8	1.6e-27
67563:67622	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
AUV24028.1|68931_69636_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
AUV24029.1|71586_72564_-|integrase	integrase	integrase	A0A0K0N6I5	Gordonia_phage	34.9	1.1e-06
73583:74351	attR	GCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCATCGTTGTGTACTTTATGGAGGATCGTTTGGTTGGCGATCAAAAAATCTATAATTTCTTGAATTCTTTCGCTACGAGCATTGGCTCTTAACAAAGTCAAAACGCTTACCATATGTTGCTGGCAGTATTTGTTGTCTAAATTCACTCGCACTTCATTAGAGTGCATTGCTATAACTGTATTGATAATGTTTTGATCGCCAAGCATGCCAAAAAACTGATCATACAAAGGTCGTCCCGCCGGAGAAACACCAGTATTATATGGTATTCCTTTACCAACACGACAAATCAAAACTGTTTTTATAAGCTTATGAACCCTCTCTAAAGGTATGTCATTTTCAGTCTTTAAATACGAAAGAATCTTCCGCATATGAGGGGGTTCATTATAAAAGTTATCCCAAGCATACCTAGCCTCTAAGAGATCGTCGGCATGGCCGTCCAGTGATATAATTCTAGAGTCTAATGATTGATAACGATTACCATCACAAAACGTAAAAAACTCAATACCTAAAGCATGTTTCTCGTTGTGAAGATTGTTCTTGTATCCGTCTAGCGTCACGCCGAGCTTGTATTTTACGTTATCACTGCTTTTATTCCAGATATGCGGAGCAAAAAGAGCGATATTTTTTCTGACAACATTTCCTGTTGAATCAGCTGTATATATGCCGAAAATACTATTGAGTAGATTGTCAGTATTCTGAAGCGACAGATCA	NA	NA	NA	NA
>prophage 1
CP026201	Escherichia coli strain ECONIH6 plasmid pNDM-d2e9, complete sequence	100989	29879	58217	100989	transposase,integrase	Escherichia_phage(35.71%)	30	38099:38158	58222:59023
AUV24158.1|29879_32867_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
AUV24084.1|32902_33607_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV24085.1|33929_35462_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AUV24086.1|35990_36440_-	hypothetical protein	NA	NA	NA	NA	NA
AUV24087.1|36954_37065_-	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	88.6	1.9e-08
AUV24088.1|37069_37807_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
AUV24089.1|37932_38028_-	23S rRNA methyltransferase attenuator leader peptide ErmL	NA	NA	NA	NA	NA
38099:38158	attL	TGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
AUV24090.1|38162_38867_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV24091.1|38988_39903_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AUV24092.1|39899_41138_+	MFS transporter	NA	NA	NA	NA	NA
AUV24093.1|41137_41722_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUV24094.1|41667_42024_+	hypothetical protein	NA	NA	NA	NA	NA
AUV24095.1|42214_42979_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AUV24096.1|43257_43815_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AUV24097.1|43997_44858_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AUV24098.1|45027_45783_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
AUV24099.1|45863_46412_-	sodium:proton antiporter	NA	NA	NA	NA	NA
AUV24100.1|46432_46825_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	58.1	8.5e-22
AUV24101.1|47018_47723_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV24102.1|48281_49094_+	subclass B1 metallo-beta-lactamase NDM-5	NA	NA	NA	NA	NA
AUV24103.1|49097_49463_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
AUV24104.1|49467_50106_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AUV24105.1|50116_51148_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
AUV24106.1|51460_53002_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AUV24107.1|53406_54246_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUV24108.1|54239_54587_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AUV24109.1|54750_55542_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AUV24110.1|55949_56447_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AUV24111.1|56591_57479_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	42.2	9.2e-56
AUV24112.1|57512_58217_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
58222:59023	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCACTTCGACGACTACCTGCTGCCGGCCGAGAAGTTCGCCGCACTCAAGCGCGAGCAGGCCCTGCCCCTGGCGATCAACCCGAACAGCGACCAGTACCTGGAAGAGCGTTTGCAGCTGCTGGACGAGCAGTTGGCCACCGTCACCCGCCTGGCCAAGGACAACGAGCTGCCCGATGCCATCCTCACCGAGTCAGGGCTGAAAATCACCCCGCTGGATGCGGCGGTGCCGGATCGGGCGCAGGCGCTGATCGACCAAACCAGCCAGTTACTGCCGCGCATCAAGATCACCGAACTGCTGATGGACGTGGACGACTGGACGGGCTTCAGCCGCCACTTCACCCACTTGAAGGACGGGGCCGAGGCCAAAGACAGGACGTTGCTGCTGTCCGCAATCCTCGGTGATGCGATCAACCTCGGGCTGACCAAGATGGCCGAGTCGAGCCCCGGCCTGACCTACGCCAAGCTGTCCTGGCTGCAAGCCTGGCACATCCGCGACGAAACCTATTCGGCGGCCTTGGCCGAGCTGGTCAACCACCAGTATCGCCACGCCTTTGCCGCCCACTGGGGCGACGGCACGACCTCATCCTCCGATGGCCAGCGCTTCCGCGCGGGTGGCCGGGGCGAGAGCACCGGGCACGTCAACCCGAAGTACGGTAGCGAGCCGGGACGGCTGTTCTATACCCATATCTCCGACCAGTACGCGCCGTTCAGCACCCGCGTGGTGAATGTCGGCGTCCGCGATTCC	NA	NA	NA	NA
