The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	0	14860	5403218		uncultured_virus(33.33%)	12	NA	NA
AUU93317.1|787_1336_+	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
AUU93318.1|1368_3009_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
AUU93319.1|3063_3501_+	arginine:ornithine antiporter	NA	NA	NA	NA	NA
AUU93320.1|3482_4160_-	two-component system response regulator KdpE	NA	NA	NA	NA	NA
AUU93321.1|4156_6844_-	two-component system sensor histidine kinase KdbD	NA	NA	NA	NA	NA
AUU93322.1|6844_7420_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
AUU93323.1|7430_9479_-	K(+)-transporting ATPase subunit B	NA	A0A218MNH6	uncultured_virus	27.5	3.9e-25
AUU93324.1|9499_11179_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AUU93325.1|11178_11268_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUU98272.1|11577_11784_+	DUF2517 domain-containing protein	NA	NA	NA	NA	NA
AUU93326.1|11967_13410_+	deoxyribodipyrimidine photo-lyase	NA	F2Y1V1	Organic_Lake_phycodnavirus	33.1	2.3e-56
AUU93327.1|13381_14860_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.3	2.9e-46
>prophage 2
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	20669	21461	5403218		Kaumoebavirus(100.0%)	1	NA	NA
AUU93335.1|20669_21461_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.2	3.6e-11
>prophage 3
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	46012	49523	5403218		Vibriophage(33.33%)	4	NA	NA
AUU93356.1|46012_46732_+	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	34.6	2.0e-24
AUU93357.1|46728_47673_-	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.4	3.4e-24
AUU93358.1|47790_48156_-	hypothetical protein	NA	NA	NA	NA	NA
AUU93359.1|48470_49523_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.0	1.2e-81
>prophage 4
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	53884	60407	5403218		Tupanvirus(33.33%)	7	NA	NA
AUU93363.1|53884_54901_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.1	1.2e-78
AUU93364.1|55110_56583_-	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	28.5	2.0e-10
AUU93365.1|56650_57439_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AUU93366.1|57591_57741_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
AUU93367.1|57883_58657_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUU93368.1|58656_59346_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AUU98276.1|59348_60407_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.8	5.3e-18
>prophage 5
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	65253	65988	5403218		Enterobacteria_phage(100.0%)	1	NA	NA
AUU93375.1|65253_65988_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.3	1.4e-49
>prophage 6
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	69098	76953	5403218		Leptospira_phage(33.33%)	4	NA	NA
AUU93379.1|69098_72164_-	AcrB/AcrD/AcrF family protein	NA	S5VL66	Leptospira_phage	20.6	5.1e-21
AUU93380.1|72164_73250_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUU93381.1|73782_74214_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	41.4	1.3e-23
AUU93382.1|74265_76953_+	carbonate dehydratase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	26.3	2.9e-68
>prophage 7
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	86373	91457	5403218		Catovirus(50.0%)	4	NA	NA
AUU93388.1|86373_87900_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.0	3.7e-81
AUU93389.1|87998_89381_+	amino acid permease	NA	NA	NA	NA	NA
AUU93390.1|89620_90097_-	kinase inhibitor	NA	NA	NA	NA	NA
AUU98278.1|90167_91457_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	2.9e-18
>prophage 8
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	95260	95983	5403218		Planktothrix_phage(100.0%)	1	NA	NA
AUU93395.1|95260_95983_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	24.0	5.3e-09
>prophage 9
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	103854	104760	5403218		Streptococcus_phage(100.0%)	1	NA	NA
AUU93403.1|103854_104760_-	hypothetical protein	NA	A1IMD5	Streptococcus_phage	29.8	7.5e-29
>prophage 10
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	115164	116904	5403218		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AUU93419.1|115164_116904_-	multidrug ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	4.3e-17
>prophage 11
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	120818	131291	5403218	transposase	Escherichia_phage(16.67%)	10	NA	NA
AUU93423.1|120818_121799_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
AUU93424.1|122545_123295_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUU93425.1|123308_124154_+	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	30.3	3.1e-08
AUU93426.1|124153_125146_+	transketolase	NA	NA	NA	NA	NA
AUU93427.1|125360_126716_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.1	2.8e-48
AUU93428.1|126903_129060_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	1.5e-43
AUU93429.1|129089_130058_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AUU93430.1|130167_130428_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AUU93431.1|130713_130980_-	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	52.3	1.6e-16
AUU93432.1|131000_131291_-	DUF1471 domain-containing protein	NA	A0A1B2IB27	Erwinia_phage	47.9	1.1e-05
>prophage 12
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	135335	140486	5403218		Planktothrix_phage(33.33%)	6	NA	NA
AUU93436.1|135335_136058_-	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	3.3e-35
AUU93437.1|136054_136714_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AUU93438.1|136839_137586_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
AUU93439.1|137993_138497_-	DNA starvation/stationary phase protection protein	NA	A0A222Z0F3	Streptomyces_phage	47.6	9.3e-05
AUU93440.1|138734_139622_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AUU93441.1|139973_140486_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.7e-14
>prophage 13
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	144488	145865	5403218		Pandoravirus(100.0%)	1	NA	NA
AUU93446.1|144488_145865_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	23.8	7.2e-23
>prophage 14
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	148874	150467	5403218		Tupanvirus(100.0%)	1	NA	NA
AUU93450.1|148874_150467_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	5.0e-60
>prophage 15
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	158447	160880	5403218		Bacteriophage(100.0%)	1	NA	NA
AUU93455.1|158447_160880_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A2K8HAT8	Bacteriophage	47.4	8.0e-09
>prophage 16
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	165123	166983	5403218		Planktothrix_phage(100.0%)	1	NA	NA
AUU93460.1|165123_166983_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.2	6.3e-14
>prophage 17
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	178846	180846	5403218		Stx2-converting_phage(50.0%)	2	NA	NA
AUU93470.1|178846_180049_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.3	2.5e-96
AUU93471.1|180087_180846_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.6	2.4e-12
>prophage 18
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	188318	199906	5403218		Bacillus_phage(33.33%)	13	NA	NA
AUU93479.1|188318_188582_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AUU93480.1|188784_189072_+	hypothetical protein	NA	NA	NA	NA	NA
AUU93481.1|189055_189778_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AUU93482.1|189892_190795_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
AUU93483.1|190883_191363_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
AUU93484.1|191711_192824_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AUU98282.1|192987_194121_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AUU93485.1|194131_195085_+	putrescine ABC transporter permease	NA	NA	NA	NA	NA
AUU93486.1|195081_195927_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AUU93487.1|195984_196473_+	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AUU93488.1|196514_197642_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AUU93489.1|197720_198437_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
AUU93490.1|198433_199906_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
>prophage 19
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	203050	207401	5403218		Planktothrix_phage(50.0%)	5	NA	NA
AUU93494.1|203050_203779_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
AUU93495.1|204005_204521_-	lipoprotein	NA	NA	NA	NA	NA
AUU93496.1|205167_205347_-	hypothetical protein	NA	NA	NA	NA	NA
AUU93497.1|205399_206539_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUU93498.1|206570_207401_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
>prophage 20
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	220217	244054	5403218	tRNA,protease	uncultured_Mediterranean_phage(16.67%)	17	NA	NA
AUU93507.1|220217_221333_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AUU93508.1|221329_223270_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AUU93509.1|223209_223392_+	hypothetical protein	NA	NA	NA	NA	NA
AUU93510.1|223346_223568_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AUU93511.1|223893_224211_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AUU93512.1|224241_226521_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AUU93513.1|226640_226859_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AUU93514.1|227212_227914_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUU93515.1|227958_229680_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.6	1.2e-14
AUU93516.1|229680_231447_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
AUU93517.1|231561_232530_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
AUU93518.1|233062_233557_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AUU93519.1|233692_237946_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
AUU93520.1|238068_238680_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUU93521.1|238688_240032_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	5.6e-81
AUU93522.1|240122_241415_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AUU93523.1|241615_244054_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.2	2.8e-219
>prophage 21
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	247131	250346	5403218		Tetraselmis_virus(100.0%)	2	NA	NA
AUU93527.1|247131_247872_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.4e-20
AUU93528.1|248063_250346_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	8.4e-162
>prophage 22
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	254397	255486	5403218		Streptococcus_phage(100.0%)	1	NA	NA
AUU93531.1|254397_255486_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	5.0e-80
>prophage 23
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	259659	264202	5403218		Bacillus_phage(100.0%)	3	NA	NA
AUU93535.1|259659_259947_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.2e-10
AUU93536.1|260152_262417_+	ComEC family protein	NA	NA	NA	NA	NA
AUU93537.1|262453_264202_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	4.6e-59
>prophage 24
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	283235	284636	5403218	tRNA	Bandra_megavirus(100.0%)	1	NA	NA
AUU93552.1|283235_284636_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.8	1.0e-80
>prophage 25
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	290698	295821	5403218		Agrobacterium_phage(33.33%)	3	NA	NA
AUU93557.1|290698_291901_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.5	5.1e-41
AUU93558.1|292227_294843_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	1.7e-20
AUU93559.1|295047_295821_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	2.9e-29
>prophage 26
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	304587	306495	5403218		Tupanvirus(100.0%)	1	NA	NA
AUU93568.1|304587_306495_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	1.2e-49
>prophage 27
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	319189	321244	5403218		Bacillus_phage(100.0%)	1	NA	NA
AUU93583.1|319189_321244_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.0	1.8e-14
>prophage 28
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	333230	335378	5403218		Bacillus_phage(100.0%)	1	NA	NA
AUU93587.1|333230_335378_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	25.1	1.7e-26
>prophage 29
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	344722	345382	5403218		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUU93596.1|344722_345382_-	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
>prophage 30
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	369665	373184	5403218		Enterobacteria_phage(100.0%)	4	NA	NA
AUU93619.1|369665_369839_+	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
AUU93620.1|370001_370940_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AUU93621.1|371345_372668_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.8	8.2e-202
AUU93622.1|372689_373184_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	75.0	6.9e-37
>prophage 31
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	389748	390807	5403218		Cronobacter_phage(100.0%)	1	NA	NA
AUU93637.1|389748_390807_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.6	8.6e-93
>prophage 32
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	398800	399328	5403218		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
AUU93648.1|398800_399328_+	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.3	1.3e-28
>prophage 33
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	407679	408600	5403218		Morganella_phage(100.0%)	1	NA	NA
AUU93655.1|407679_408600_-	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	42.2	3.3e-56
>prophage 34
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	411841	412093	5403218		Salmonella_phage(100.0%)	1	NA	NA
AUU93661.1|411841_412093_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	50.0	3.0e-12
>prophage 35
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	431256	432438	5403218		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AUU93678.1|431256_431991_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.0e-15
AUU93679.1|432201_432438_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 36
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	435717	436359	5403218		Pseudomonas_phage(100.0%)	1	NA	NA
AUU93682.1|435717_436359_+	thymidylate kinase	NA	Q2Z0N0	Pseudomonas_phage	37.0	3.8e-27
>prophage 37
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	456083	459834	5403218		Planktothrix_phage(50.0%)	4	NA	NA
AUU93700.1|456083_456785_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.4	7.8e-34
AUU93701.1|456784_458029_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AUU93702.1|458077_458989_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AUU93703.1|459003_459834_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	5.3e-21
>prophage 38
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	467094	471937	5403218		Synechococcus_phage(50.0%)	3	NA	NA
AUU93709.1|467094_468045_+	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	38.3	3.5e-13
AUU93710.1|468064_470071_+	transketolase	NA	NA	NA	NA	NA
AUU93711.1|470308_471937_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	1.9e-27
>prophage 39
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	476370	477507	5403218		Bacillus_virus(100.0%)	1	NA	NA
AUU93716.1|476370_477507_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.0	2.6e-31
>prophage 40
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	484072	485443	5403218		Bodo_saltans_virus(100.0%)	1	NA	NA
AUU93723.1|484072_485443_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	1.2e-107
>prophage 41
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	488671	489922	5403218		Phage_21(100.0%)	1	NA	NA
AUU93727.1|488671_489922_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 42
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	504514	506299	5403218		Bacillus_phage(100.0%)	1	NA	NA
AUU93745.1|504514_506299_-	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	36.1	9.9e-17
>prophage 43
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	509588	513172	5403218		Morganella_phage(50.0%)	7	NA	NA
AUU93749.1|509588_510503_+	lipid A biosynthesis palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	50.0	3.2e-72
AUU93750.1|510592_511231_+	leucine efflux protein	NA	NA	NA	NA	NA
AUU93751.1|511360_511624_+	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AUU93752.1|511682_511808_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98299.1|511925_512000_-	hypothetical protein	NA	NA	NA	NA	NA
AUU93753.1|511999_512101_-	hypothetical protein	NA	NA	NA	NA	NA
AUU93754.1|512158_513172_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
>prophage 44
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	520101	536729	5403218	transposase	Salmonella_phage(22.22%)	16	NA	NA
AUU93763.1|520101_520344_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	72.2	4.1e-27
AUU93764.1|520709_520961_+	hypothetical protein	NA	NA	NA	NA	NA
AUU93765.1|520960_522445_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AUU93766.1|522523_522943_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	57.5	5.5e-35
AUU93767.1|522945_524211_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	79.4	2.9e-196
AUU93768.1|524223_525123_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUU93769.1|525289_526039_+	KR domain-containing protein	NA	A0A0M4JSW6	Mollivirus	29.1	1.9e-14
AUU93770.1|526035_527253_-	MFS transporter	NA	NA	NA	NA	NA
AUU93771.1|527428_528310_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUU93772.1|528567_528879_+	hypothetical protein	NA	NA	NA	NA	NA
AUU93773.1|529000_529483_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	39.1	1.6e-17
AUU93774.1|529641_530205_+	hypothetical protein	NA	NA	NA	NA	NA
AUU93775.1|530250_531534_-	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.7e-10
AUU93776.1|532008_532977_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
AUU93777.1|535036_535783_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
AUU93778.1|535874_536729_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	26.0	2.8e-17
>prophage 45
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	540413	542479	5403218		Artogeia_rapae_granulovirus(50.0%)	2	NA	NA
AUU93784.1|540413_541667_-	chitinase	NA	D2J4H7	Artogeia_rapae_granulovirus	25.6	2.6e-24
AUU93785.1|541837_542479_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	37.1	1.9e-18
>prophage 46
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	548860	550807	5403218		Streptococcus_phage(100.0%)	1	NA	NA
AUU93792.1|548860_550807_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.3	8.2e-41
>prophage 47
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	556109	556742	5403218		Bacillus_phage(100.0%)	1	NA	NA
AUU93797.1|556109_556742_-	sulfate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.3	7.8e-09
>prophage 48
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	562799	564020	5403218		Klosneuvirus(100.0%)	1	NA	NA
AUU93804.1|562799_564020_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	8.0e-26
>prophage 49
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	570703	571531	5403218		Bacillus_virus(100.0%)	1	NA	NA
AUU93811.1|570703_571531_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.5	2.7e-70
>prophage 50
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	577795	583529	5403218		Tupanvirus(50.0%)	5	NA	NA
AUU93819.1|577795_580054_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.4	1.0e-143
AUU93820.1|580166_580499_+	cell division activator CedA	NA	NA	NA	NA	NA
AUU93821.1|580558_581950_-	L-cystine transporter	NA	NA	NA	NA	NA
AUU93822.1|582085_582676_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AUU93823.1|582767_583529_-	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	1.8e-15
>prophage 51
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	590823	591501	5403218		Cyanophage(100.0%)	1	NA	NA
AUU93831.1|590823_591501_-	Fe2+-dependent dioxygenase	NA	A0A127KM56	Cyanophage	33.8	2.5e-21
>prophage 52
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	598799	601757	5403218		Acinetobacter_phage(100.0%)	2	NA	NA
AUU93839.1|598799_600158_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.4	3.3e-36
AUU93840.1|600161_601757_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.5	2.8e-47
>prophage 53
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	613222	618588	5403218	protease	Chrysochromulina_ericina_virus(50.0%)	6	NA	NA
AUU93852.1|613222_613984_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	1.2e-08
AUU93853.1|613978_614194_+	hypothetical protein	NA	NA	NA	NA	NA
AUU93854.1|614238_615285_+|protease	protease SohB	protease	NA	NA	NA	NA
AUU93855.1|615332_615584_-	hypothetical protein	NA	NA	NA	NA	NA
AUU93856.1|615512_615734_+	hypothetical protein	NA	NA	NA	NA	NA
AUU93857.1|615990_618588_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
>prophage 54
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	623427	624030	5403218		Staphylococcus_phage(100.0%)	1	NA	NA
AUU93862.1|623427_624030_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
>prophage 55
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	629619	631554	5403218		Bodo_saltans_virus(100.0%)	1	NA	NA
AUU93871.1|629619_631554_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
>prophage 56
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	636184	651714	5403218	transposase,integrase	Enterobacteria_phage(53.85%)	15	632048:632062	648748:648762
632048:632062	attL	GCCAGCAGCGGCGCC	NA	NA	NA	NA
AUU93875.1|636184_636994_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
AUU93876.1|636995_637988_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AUU93877.1|637987_638878_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
AUU93878.1|639054_640242_+|integrase	integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	2.2e-121
AUU93879.1|640138_640453_-	hypothetical protein	NA	K7PM28	Enterobacteria_phage	52.5	2.1e-10
AUU93880.1|640463_640703_-	DUF4060 domain-containing protein	NA	K7PHF4	Enterobacteria_phage	75.6	5.5e-24
AUU93881.1|640740_641826_-	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	63.1	1.1e-122
AUU93882.1|641835_644997_-	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	64.5	0.0e+00
AUU93883.1|645791_646280_-	hypothetical protein	NA	A0A2H4J2Z0	uncultured_Caudovirales_phage	35.9	1.5e-23
AUU93884.1|646279_646867_-	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
AUU93885.1|647528_647912_-	transcriptional regulator	NA	K7PM35	Enterobacteria_phage	63.5	3.4e-39
AUU93886.1|648011_648239_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	63.5	8.4e-22
AUU93887.1|648241_648793_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	46.4	3.4e-32
648748:648762	attR	GGCGCCGCTGCTGGC	NA	NA	NA	NA
AUU93888.1|649790_650477_+	phage replication protein	NA	G8C7U6	Escherichia_phage	63.4	4.4e-82
AUU93889.1|650553_651714_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	3.5e-39
>prophage 57
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	656138	730037	5403218	plate,transposase,protease	Salmonella_phage(15.38%)	60	NA	NA
AUU93893.1|656138_657107_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.1	8.8e-177
AUU93894.1|659101_659650_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	97.2	3.8e-92
AUU93895.1|659727_660150_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	8.0e-26
AUU93896.1|660793_661045_+	hypothetical protein	NA	NA	NA	NA	NA
AUU93897.1|661044_662529_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AUU98305.1|662608_663028_+	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	58.3	8.5e-36
AUU93898.1|663029_664295_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.2	5.3e-206
AUU93899.1|664473_664722_+	hypothetical protein	NA	NA	NA	NA	NA
AUU93900.1|664853_665522_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	3.1e-80
AUU93901.1|665726_666692_-	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
AUU93902.1|666688_668332_-	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
AUU93903.1|668665_669571_-	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AUU93904.1|669681_670524_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUU93905.1|670490_672812_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUU93906.1|672983_674153_+	amidohydrolase	NA	NA	NA	NA	NA
AUU93907.1|674178_675570_+	MFS transporter	NA	NA	NA	NA	NA
AUU98306.1|675560_676535_-	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
AUU93908.1|676702_677371_+	phage shock protein PspA	NA	NA	NA	NA	NA
AUU93909.1|677426_677651_+	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
AUU93910.1|677650_678010_+	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
AUU93911.1|678038_678257_+	phage shock protein D	NA	NA	NA	NA	NA
AUU93912.1|678359_679757_+	hypothetical protein	NA	NA	NA	NA	NA
AUU93913.1|679753_680815_+	TIGR01620 family protein	NA	NA	NA	NA	NA
AUU93914.1|680904_681804_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUU93915.1|681917_683231_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AUU93916.1|683403_684945_+	transcriptional regulator TyrR	NA	NA	NA	NA	NA
AUU98307.1|685076_686099_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AUU93917.1|686169_686676_-	thiol peroxidase	NA	NA	NA	NA	NA
AUU93918.1|686778_687744_+	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
AUU93919.1|687740_688448_-	murein peptide amidase A	NA	NA	NA	NA	NA
AUU93920.1|688633_690250_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
AUU93921.1|690417_690804_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
AUU93922.1|691034_691868_+	hypothetical protein	NA	NA	NA	NA	NA
AUU93923.1|691992_692877_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUU93924.1|693049_694186_+	hypothetical protein	NA	NA	NA	NA	NA
AUU93925.1|694258_695461_+	MFS transporter	NA	NA	NA	NA	NA
AUU93926.1|695539_696409_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	7.4e-50
AUU93927.1|696576_696885_+	anti-sigma regulatory factor	NA	NA	NA	NA	NA
AUU93928.1|696955_697144_-	cold-shock protein	NA	NA	NA	NA	NA
AUU93929.1|697445_698360_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUU93930.1|698468_699230_+	KR domain-containing protein	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.3e-21
AUU93931.1|699446_700979_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	28.7	1.5e-21
AUU93932.1|701177_701744_-|protease	protease	protease	NA	NA	NA	NA
AUU93933.1|702384_702876_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AUU93934.1|702918_704463_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AUU98308.1|704475_705816_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AUU93935.1|705812_706502_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AUU93936.1|706498_708205_+	OmpA family protein	NA	NA	NA	NA	NA
AUU93937.1|708209_708701_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUU93938.1|708965_711620_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	1.7e-97
AUU93939.1|711612_714132_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.0e-18
AUU93940.1|714124_715336_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98309.1|715469_715745_+	hypothetical protein	NA	NA	NA	NA	NA
AUU93941.1|716536_718555_+	hypothetical protein	NA	NA	NA	NA	NA
AUU93942.1|719136_720117_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
AUU93943.1|720901_722110_+	hypothetical protein	NA	NA	NA	NA	NA
AUU93944.1|722106_725565_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
AUU93945.1|725561_727154_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AUU93946.1|727233_728988_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AUU93947.1|728951_730037_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 58
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	743467	744481	5403218		Planktothrix_phage(100.0%)	1	NA	NA
AUU93964.1|743467_744481_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	1.7e-29
>prophage 59
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	747802	754918	5403218	tRNA	Escherichia_phage(40.0%)	10	NA	NA
AUU98310.1|747802_748546_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	6.0e-16
AUU93969.1|748564_748756_-	hypothetical protein	NA	NA	NA	NA	NA
AUU93970.1|748825_749809_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AUU93971.1|749912_750146_+	hypothetical protein	NA	NA	NA	NA	NA
AUU93972.1|750124_750319_+	hypothetical protein	NA	NA	NA	NA	NA
AUU93973.1|750333_751707_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
AUU93974.1|751752_752688_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
AUU93975.1|752921_753356_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	50.7	3.2e-30
AUU93976.1|753437_753650_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
AUU93977.1|753793_754918_-	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	59.8	3.8e-115
>prophage 60
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	760036	761026	5403218		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AUU93982.1|760036_761026_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.9	2.5e-70
>prophage 61
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	787219	791844	5403218		Klosneuvirus(50.0%)	2	NA	NA
AUU94008.1|787219_791122_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.2	3.8e-53
AUU94009.1|791169_791844_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	52.5	6.0e-31
>prophage 62
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	800529	801735	5403218		Klosneuvirus(100.0%)	1	NA	NA
AUU94017.1|800529_801735_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.0	6.9e-22
>prophage 63
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	814484	818012	5403218		Enterobacteria_phage(50.0%)	6	NA	NA
AUU94027.1|814484_814877_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	38.5	3.0e-19
AUU94028.1|815127_815361_-	SirA-like protein	NA	NA	NA	NA	NA
AUU94029.1|815357_816566_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
AUU94030.1|816669_817023_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
AUU94031.1|817220_817739_+	hypothetical protein	NA	NA	NA	NA	NA
AUU94032.1|817808_818012_-	selenoprotein YdfZ	NA	J9Q802	Salmonella_phage	73.1	2.6e-22
>prophage 64
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	823114	828935	5403218		Clostridium_phage(33.33%)	6	NA	NA
AUU94037.1|823114_823729_-	serine recombinase	NA	A0A0A8WJD4	Clostridium_phage	28.1	2.5e-07
AUU94038.1|824178_824532_+	hypothetical protein	NA	NA	NA	NA	NA
AUU94039.1|824837_825446_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94040.1|825447_825798_-	hypothetical protein	NA	Q76YY7	Aeromonas_virus	28.6	2.0e-06
AUU98312.1|825787_826621_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AUU94041.1|827165_828935_-	recombinase family protein	NA	Q6V7T7	Burkholderia_virus	28.3	6.4e-32
>prophage 65
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	838799	842114	5403218		Bacillus_phage(50.0%)	2	NA	NA
AUU94049.1|838799_840101_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.9e-18
AUU98313.1|840671_842114_-	protein kinase	NA	M1PH48	Moumouvirus	29.7	3.7e-06
>prophage 66
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	853380	853896	5403218		Streptococcus_phage(100.0%)	1	NA	NA
AUU94062.1|853380_853896_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
>prophage 67
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	873242	876020	5403218		Lactobacillus_phage(100.0%)	1	NA	NA
AUU94080.1|873242_876020_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.1	6.2e-66
>prophage 68
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	885463	886423	5403218		Salmonella_phage(100.0%)	1	NA	NA
AUU94090.1|885463_886423_-	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
>prophage 69
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	903547	905674	5403218		Escherichia_phage(100.0%)	3	NA	NA
AUU94106.1|903547_904156_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.3	6.4e-24
AUU94107.1|904197_905055_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.9	9.0e-24
AUU94108.1|905056_905674_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
>prophage 70
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	910470	920420	5403218		uncultured_virus(20.0%)	10	NA	NA
AUU94113.1|910470_910797_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.9	1.1e-22
AUU94114.1|910910_912194_+	MFS transporter	NA	NA	NA	NA	NA
AUU94115.1|912447_913911_+	D-mannonate oxidoreductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.3	1.3e-43
AUU94116.1|914175_914607_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.7	2.7e-21
AUU94117.1|914657_915344_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUU94118.1|915435_916185_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
AUU94119.1|916315_918361_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	20.5	3.9e-17
AUU94120.1|918438_918831_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AUU98318.1|918852_919695_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUU94121.1|919745_920420_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.6	2.2e-81
>prophage 71
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	929564	946786	5403218	transposase	Escherichia_phage(70.0%)	15	NA	NA
AUU94132.1|929564_930185_-	aldolase	NA	A0A077SK32	Escherichia_phage	99.5	1.8e-114
AUU94133.1|930177_931443_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.0	2.1e-231
AUU94134.1|931454_932357_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AUU94135.1|932617_933379_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AUU94136.1|933399_934260_-	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
AUU94137.1|934557_934818_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AUU94138.1|934904_935993_+	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AUU94139.1|937253_938258_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AUU94140.1|938670_941778_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AUU94141.1|941974_943039_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	44.5	2.0e-65
AUU94142.1|943293_943734_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUU94143.1|943786_944002_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
AUU94144.1|943970_945068_-	transcriptional regulator FtrA	NA	NA	NA	NA	NA
AUU94145.1|945135_945534_+	rhodanese	NA	NA	NA	NA	NA
AUU94146.1|945682_946786_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	48.9	3.1e-101
>prophage 72
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	950937	952443	5403218		Brazilian_cedratvirus(50.0%)	2	NA	NA
AUU94150.1|950937_951735_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.9	2.4e-10
AUU94151.1|951744_952443_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	2.1e-15
>prophage 73
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	955689	956064	5403218		Streptococcus_phage(100.0%)	1	NA	NA
AUU98320.1|955689_956064_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	2.3e-08
>prophage 74
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	961141	962092	5403218		Catovirus(100.0%)	1	NA	NA
AUU94161.1|961141_962092_-	hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	34.7	4.8e-34
>prophage 75
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	966615	967377	5403218		Escherichia_phage(100.0%)	1	NA	NA
AUU94166.1|966615_967377_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	36.2	2.7e-32
>prophage 76
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	972825	974193	5403218		Bacillus_phage(100.0%)	1	NA	NA
AUU98322.1|972825_974193_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.7	2.9e-16
>prophage 77
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	986579	987371	5403218		Bacillus_virus(100.0%)	1	NA	NA
AUU94188.1|986579_987371_-	ABC transporter	NA	G3M9Y6	Bacillus_virus	30.5	2.5e-20
>prophage 78
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	997864	999244	5403218		Enterobacteria_phage(100.0%)	1	NA	NA
AUU94199.1|997864_999244_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	5.3e-18
>prophage 79
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1033198	1034731	5403218	transposase	Bacillus_phage(100.0%)	1	NA	NA
AUU94229.1|1033198_1034731_-|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
>prophage 80
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1043157	1045240	5403218	transposase	Erysipelothrix_phage(50.0%)	2	NA	NA
AUU94236.1|1043157_1043676_-	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	37.6	7.6e-26
AUU94237.1|1044271_1045240_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.9	4.5e-173
>prophage 81
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1058521	1059259	5403218		Planktothrix_phage(100.0%)	1	NA	NA
AUU94250.1|1058521_1059259_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.9	3.0e-36
>prophage 82
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1083016	1084273	5403218		Bacillus_phage(100.0%)	1	NA	NA
AUU94276.1|1083016_1084273_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.5	4.0e-20
>prophage 83
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1090267	1094385	5403218		Bacillus_virus(50.0%)	4	NA	NA
AUU94282.1|1090267_1090996_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	9.6e-19
AUU94283.1|1090992_1091733_+	ABC transporter permease	NA	NA	NA	NA	NA
AUU94284.1|1091757_1092693_+	thiamine biosynthesis protein	NA	NA	NA	NA	NA
AUU94285.1|1092999_1094385_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.0	7.4e-28
>prophage 84
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1098299	1100380	5403218		Bacillus_phage(100.0%)	2	NA	NA
AUU94289.1|1098299_1099643_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	24.3	1.4e-10
AUU94290.1|1099639_1100380_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.6	1.5e-30
>prophage 85
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1115777	1116458	5403218		Bacillus_virus(100.0%)	1	NA	NA
AUU94303.1|1115777_1116458_-	magnesium transport protein MgtC	NA	G3MA03	Bacillus_virus	41.9	2.1e-15
>prophage 86
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1127371	1127776	5403218		Stx_converting_phage(100.0%)	1	NA	NA
AUU94315.1|1127371_1127776_-	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	41.6	2.0e-10
>prophage 87
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1132583	1134921	5403218		Mycobacterium_phage(50.0%)	5	NA	NA
AUU94322.1|1132583_1132799_-	hypothetical protein	NA	H9NCK9	Mycobacterium_phage	48.0	9.4e-07
AUU94323.1|1132824_1133055_+	hypothetical protein	NA	NA	NA	NA	NA
AUU94324.1|1132957_1133158_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94325.1|1133164_1133350_-	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AUU98329.1|1134048_1134921_+	NAD(P)-dependent oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	58.6	1.3e-83
>prophage 88
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1140774	1145510	5403218		Tupanvirus(66.67%)	4	NA	NA
AUU94332.1|1140774_1142490_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	23.8	6.2e-32
AUU94333.1|1142526_1143480_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUU94334.1|1143647_1144247_-	pyrophosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	5.0e-21
AUU94335.1|1144499_1145510_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.8	4.9e-29
>prophage 89
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1149098	1150715	5403218		Planktothrix_phage(100.0%)	1	NA	NA
AUU94339.1|1149098_1150715_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	3.3e-19
>prophage 90
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1161986	1162760	5403218		Bacillus_phage(100.0%)	1	NA	NA
AUU94351.1|1161986_1162760_-	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	W8CYX9	Bacillus_phage	48.5	3.8e-05
>prophage 91
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1169239	1170739	5403218		Mycobacterium_phage(100.0%)	1	NA	NA
AUU94359.1|1169239_1170739_-	methyl viologen resistance protein SmvA	NA	A0A0M3UL24	Mycobacterium_phage	29.3	7.8e-31
>prophage 92
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1176846	1178391	5403218		Escherichia_phage(100.0%)	1	NA	NA
AUU94363.1|1176846_1178391_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	38.1	1.4e-19
>prophage 93
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1184026	1184728	5403218		Bacillus_virus(100.0%)	1	NA	NA
AUU98330.1|1184026_1184728_-	ABC transporter substrate-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	2.8e-31
>prophage 94
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1194166	1194946	5403218		Bacillus_virus(100.0%)	1	NA	NA
AUU94378.1|1194166_1194946_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.6e-19
>prophage 95
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1200884	1201436	5403218		Leuconostoc_phage(100.0%)	1	NA	NA
AUU94385.1|1200884_1201436_-	adenylate kinase	NA	A0A097BYE2	Leuconostoc_phage	33.7	8.1e-10
>prophage 96
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1206015	1208106	5403218		Salmonella_phage(100.0%)	1	NA	NA
AUU98332.1|1206015_1208106_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.6	1.6e-138
>prophage 97
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1224230	1225244	5403218		Mycoplasma_phage(100.0%)	1	NA	NA
AUU94407.1|1224230_1225244_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	56.4	2.1e-24
>prophage 98
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1232114	1234076	5403218	protease	Phage_TP(100.0%)	1	NA	NA
AUU94413.1|1232114_1234076_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.0	5.1e-22
>prophage 99
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1244506	1247147	5403218		Moumouvirus(100.0%)	2	NA	NA
AUU94425.1|1244506_1245595_+	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	25.2	4.1e-05
AUU94426.1|1245641_1247147_-	carboxylesterase/lipase family protein	NA	M1PNU1	Moumouvirus	38.0	9.5e-29
>prophage 100
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1253972	1256023	5403218		Prochlorococcus_phage(50.0%)	3	NA	NA
AUU94432.1|1253972_1255091_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	30.0	1.1e-32
AUU94433.1|1255115_1255391_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
AUU94434.1|1255495_1256023_-	cytochrome B	NA	A0A0U2QLA7	Escherichia_phage	46.8	5.9e-18
>prophage 101
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1261573	1262944	5403218		Pandoravirus(100.0%)	1	NA	NA
AUU94442.1|1261573_1262944_+	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	35.1	2.1e-67
>prophage 102
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1274199	1275474	5403218	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AUU94454.1|1274199_1275474_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.0	1.4e-86
>prophage 103
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1278809	1280171	5403218		Bacillus_phage(100.0%)	1	NA	NA
AUU94459.1|1278809_1280171_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.7	5.2e-18
>prophage 104
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1283977	1285465	5403218		Salmonella_phage(50.0%)	2	NA	NA
AUU94464.1|1283977_1284499_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	58.0	2.3e-51
AUU94465.1|1284568_1285465_-	oxidoreductase	NA	A0A1V0SDE7	Indivirus	28.7	1.4e-06
>prophage 105
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1289652	1290525	5403218		Bacillus_phage(100.0%)	1	NA	NA
AUU94472.1|1289652_1290525_+	endopeptidase	NA	A0A217EQL1	Bacillus_phage	39.5	1.7e-17
>prophage 106
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1293796	1305968	5403218	transposase	Enterobacteria_phage(16.67%)	13	NA	NA
AUU94477.1|1293796_1294822_+	PurR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.9	1.2e-30
AUU94478.1|1294748_1295753_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUU94479.1|1295865_1297047_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AUU94480.1|1297339_1298488_+	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	1.2e-84
AUU94481.1|1298524_1299160_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	1.3e-22
AUU94482.1|1299389_1300763_+	multidrug resistance protein MdtK	NA	NA	NA	NA	NA
AUU94483.1|1300938_1301277_+	acid-shock protein	NA	NA	NA	NA	NA
AUU94484.1|1301417_1301996_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	35.5	5.9e-19
AUU94485.1|1302675_1302903_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94486.1|1302899_1303163_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94487.1|1303104_1303287_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94488.1|1303730_1304711_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
AUU94489.1|1305083_1305968_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.3	4.3e-21
>prophage 107
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1311384	1312155	5403218		Escherichia_phage(100.0%)	1	NA	NA
AUU94496.1|1311384_1312155_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.4	2.4e-12
>prophage 108
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1317339	1319288	5403218		Bacillus_virus(50.0%)	2	NA	NA
AUU94501.1|1317339_1318320_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	1.5e-11
AUU94502.1|1318316_1319288_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.6	1.1e-17
>prophage 109
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1332992	1337510	5403218		Bacillus_virus(50.0%)	4	NA	NA
AUU94517.1|1332992_1333823_+	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.9e-26
AUU94518.1|1333824_1334640_+	ABC transporter permease	NA	NA	NA	NA	NA
AUU98338.1|1334669_1336088_+	FAD-binding protein	NA	NA	NA	NA	NA
AUU94519.1|1336142_1337510_-	chromate transporter	NA	A0A219VHC2	Ochrobactrum_phage	62.8	6.6e-29
>prophage 110
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1364748	1365372	5403218		Staphylococcus_phage(100.0%)	1	NA	NA
AUU94548.1|1364748_1365372_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	23.4	1.8e-05
>prophage 111
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1371388	1372459	5403218		Planktothrix_phage(100.0%)	1	NA	NA
AUU94553.1|1371388_1372459_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	1.4e-29
>prophage 112
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1391991	1392813	5403218		Planktothrix_phage(100.0%)	1	NA	NA
AUU94571.1|1391991_1392813_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	8.6e-16
>prophage 113
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1395974	1396748	5403218		Bacillus_virus(100.0%)	1	NA	NA
AUU94573.1|1395974_1396748_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.2	1.5e-30
>prophage 114
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1407398	1409362	5403218		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
AUU94583.1|1407398_1408415_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	4.3e-41
AUU94584.1|1408411_1409362_-	acetaldehyde dehydrogenase	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.3	2.8e-34
>prophage 115
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1416799	1417549	5403218		Brazilian_cedratvirus(100.0%)	1	NA	NA
AUU94592.1|1416799_1417549_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.1	5.8e-11
>prophage 116
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1427469	1430682	5403218		environmental_halophage(50.0%)	3	NA	NA
AUU94604.1|1427469_1428690_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.0	1.3e-92
AUU94605.1|1428686_1429961_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
AUU94606.1|1429935_1430682_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	29.8	8.4e-10
>prophage 117
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1445173	1445935	5403218		Indivirus(100.0%)	1	NA	NA
AUU94620.1|1445173_1445935_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	2.3e-15
>prophage 118
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1455914	1463883	5403218		Hokovirus(25.0%)	7	NA	NA
AUU94629.1|1455914_1458293_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	1.4e-172
AUU98345.1|1458632_1459466_+	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AUU98346.1|1459620_1460667_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	46.6	1.4e-82
AUU94630.1|1460774_1461002_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
AUU94631.1|1461031_1462474_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	37.5	2.3e-56
AUU94632.1|1462587_1463052_-	lipoprotein	NA	NA	NA	NA	NA
AUU94633.1|1463133_1463883_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	3.8e-10
>prophage 119
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1470950	1478119	5403218	tRNA	Geobacillus_virus(25.0%)	7	NA	NA
AUU94641.1|1470950_1471250_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AUU94642.1|1471254_1473642_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUU94643.1|1473657_1474641_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	4.9e-34
AUU94644.1|1474947_1475304_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AUU94645.1|1475354_1475552_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AUU94646.1|1475644_1476187_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	6.3e-15
AUU94647.1|1476190_1478119_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	1.8e-128
>prophage 120
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1487776	1490674	5403218		Lactobacillus_phage(33.33%)	3	NA	NA
AUU94659.1|1487776_1488604_-	transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	3.9e-08
AUU94660.1|1488659_1489664_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.6	2.6e-14
AUU94661.1|1489660_1490674_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	3.8e-13
>prophage 121
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1498933	1505200	5403218		Citrobacter_phage(25.0%)	7	NA	NA
AUU98347.1|1498933_1499551_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.2e-54
AUU94668.1|1500112_1500520_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
AUU94669.1|1500638_1501541_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	47.6	1.8e-59
AUU94670.1|1501738_1502752_-	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	29.4	1.1e-07
AUU94671.1|1502841_1503744_-	patatin family protein	NA	NA	NA	NA	NA
AUU94672.1|1503844_1504315_+	hypothetical protein	NA	NA	NA	NA	NA
AUU94673.1|1504357_1505200_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	43.1	8.3e-14
>prophage 122
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1509201	1510737	5403218		Escherichia_phage(100.0%)	1	NA	NA
AUU94678.1|1509201_1510737_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	2.8e-20
>prophage 123
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1527230	1528019	5403218		Bacillus_virus(100.0%)	1	NA	NA
AUU94686.1|1527230_1528019_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	2.6e-30
>prophage 124
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1533529	1570738	5403218	tRNA,plate,transposase	uncultured_Caudovirales_phage(33.33%)	32	NA	NA
AUU94693.1|1533529_1533760_-	cation transport regulator	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	48.0	5.4e-08
AUU94694.1|1534023_1535124_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AUU94695.1|1535210_1536065_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.2	2.3e-48
AUU94696.1|1536104_1536917_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94697.1|1536920_1537313_-	siroheme synthase	NA	NA	NA	NA	NA
AUU94698.1|1537312_1538161_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUU94699.1|1538160_1539243_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.9e-07
AUU94700.1|1539285_1540542_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
AUU94701.1|1540812_1541424_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
AUU94702.1|1541420_1542272_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AUU94703.1|1542455_1543403_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
AUU94704.1|1543527_1545207_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
AUU94705.1|1545207_1546254_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AUU94706.1|1546476_1546752_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94707.1|1547024_1547609_+|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUU94708.1|1547726_1548818_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
AUU94709.1|1548899_1549229_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
AUU94710.1|1549312_1550227_-	rhizopine-binding protein	NA	NA	NA	NA	NA
AUU94711.1|1550358_1551774_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94712.1|1551793_1552237_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AUU94713.1|1552239_1552782_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AUU94714.1|1552756_1553803_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AUU94715.1|1553802_1555566_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AUU94716.1|1555699_1558666_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AUU94717.1|1559130_1560342_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94718.1|1560346_1560604_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AUU94719.1|1560629_1561037_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94720.1|1562227_1563208_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
AUU94721.1|1563640_1565047_-	transglycosylase	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	31.6	1.5e-47
AUU94722.1|1565135_1566161_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUU94723.1|1566455_1567424_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	95.0	7.2e-179
AUU94724.1|1568110_1570738_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.8	5.9e-18
>prophage 125
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1576464	1577163	5403218		Bodo_saltans_virus(100.0%)	1	NA	NA
AUU94730.1|1576464_1577163_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
>prophage 126
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1582379	1631794	5403218	tail,holin,head	Salmonella_phage(28.07%)	70	NA	NA
AUU94734.1|1582379_1582847_-	hypothetical protein	NA	U5P083	Shigella_phage	34.4	2.1e-11
AUU94735.1|1582859_1583486_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	47.8	2.7e-22
AUU94736.1|1583485_1584259_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.1	1.8e-76
AUU94737.1|1584255_1585452_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.4	1.5e-157
AUU94738.1|1585451_1585805_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	1.8e-50
AUU94739.1|1585806_1586460_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	62.9	1.7e-59
AUU94740.1|1586790_1587039_+	hypothetical protein	NA	NA	NA	NA	NA
AUU94741.1|1587085_1587430_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94742.1|1587426_1588455_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	53.5	3.9e-98
AUU94743.1|1588457_1588760_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	8.8e-27
AUU94744.1|1588760_1589360_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	58.1	9.9e-54
AUU94745.1|1589359_1591363_-	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.4	5.7e-247
AUU98349.1|1591352_1591505_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
AUU94746.1|1591546_1591966_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	64.4	2.2e-39
AUU94747.1|1591969_1592410_-	DUF3277 domain-containing protein	NA	A0A0M5M1K6	Salmonella_phage	78.8	3.6e-61
AUU94748.1|1592420_1593572_-	hypothetical protein	NA	A0A0M4RD26	Salmonella_phage	81.5	6.1e-177
AUU94749.1|1593573_1594125_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	44.9	2.0e-40
AUU94750.1|1594117_1594522_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	71.5	1.1e-43
AUU94751.1|1594521_1595028_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94752.1|1595024_1595444_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	61.5	8.8e-41
AUU94753.1|1595412_1595694_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94754.1|1595733_1596675_-	hypothetical protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	75.2	1.8e-134
AUU94755.1|1596686_1597181_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.1	9.3e-50
AUU94756.1|1597184_1598387_-	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	52.8	9.1e-107
AUU94757.1|1598438_1598987_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	55.7	6.3e-47
AUU94758.1|1599042_1600494_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	69.2	6.5e-192
AUU94759.1|1600497_1602111_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	83.8	6.6e-278
AUU94760.1|1602113_1602587_-	hypothetical protein	NA	H9C190	Pectobacterium_phage	70.0	4.3e-52
AUU94761.1|1602617_1603253_-	hypothetical protein	NA	I6S676	Salmonella_phage	82.1	4.2e-103
AUU94762.1|1603775_1604225_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	71.8	1.2e-59
AUU94763.1|1604211_1604529_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	98.0	7.3e-48
AUU94764.1|1604777_1605599_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.1e-98
AUU94765.1|1605714_1606071_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.1	1.8e-39
AUU94766.1|1606067_1606352_-	hypothetical protein	NA	G8C7V5	Escherichia_phage	96.8	7.2e-47
AUU94767.1|1606344_1607016_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	73.1	1.7e-99
AUU94768.1|1607012_1607180_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	62.5	7.8e-09
AUU94769.1|1607185_1607782_-	hypothetical protein	NA	A0A0U2RT94	Escherichia_phage	54.3	1.2e-56
AUU94770.1|1607946_1608198_-	hypothetical protein	NA	A0A2P1MXF0	Escherichia_phage	42.7	5.3e-09
AUU98350.1|1608190_1608400_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
AUU94771.1|1608996_1609254_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94772.1|1610318_1610798_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	35.9	5.4e-10
AUU94773.1|1610794_1611097_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUU94774.1|1611093_1611966_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	69.0	3.2e-93
AUU94775.1|1611950_1612805_-	replication protein	NA	K7PGT1	Enterobacteria_phage	54.8	3.7e-62
AUU94776.1|1612891_1613212_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	69.8	5.0e-36
AUU94777.1|1613251_1613479_-	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	1.9e-18
AUU94778.1|1613547_1614270_+	ribonuclease BN	NA	E7C9R0	Salmonella_phage	62.4	3.9e-73
AUU94779.1|1614419_1614860_+	hypothetical protein	NA	NA	NA	NA	NA
AUU94780.1|1615633_1615849_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	2.0e-09
AUU94781.1|1615948_1616155_+	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	2.4e-31
AUU94782.1|1616213_1616732_+	hypothetical protein	NA	A0A1W6DY33	Salmonella_phage	44.7	3.7e-33
AUU94783.1|1616735_1617704_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	77.7	1.7e-39
AUU94784.1|1617711_1617996_+	hypothetical protein	NA	G8C7T1	Escherichia_phage	79.8	3.8e-40
AUU94785.1|1618011_1618857_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	9.0e-69
AUU94786.1|1618853_1619534_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	92.9	1.8e-123
AUU94787.1|1619530_1619959_+	regulator	NA	M9NYX4	Enterobacteria_phage	80.3	1.3e-63
AUU94788.1|1619955_1620612_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.0	3.5e-113
AUU94789.1|1620827_1621052_+	hypothetical protein	NA	G8C7U9	Escherichia_phage	73.2	1.6e-20
AUU94790.1|1621048_1621240_+	hypothetical protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	2.1e-13
AUU94791.1|1621614_1621860_+	excisionase	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
AUU94792.1|1621902_1623165_+	DUF3596 domain-containing protein	NA	A0A286S1S8	Klebsiella_phage	94.5	3.3e-232
AUU94793.1|1623149_1623431_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUU94794.1|1623405_1624212_-	molybdenum ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUU94795.1|1624226_1625522_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
AUU94796.1|1625825_1626752_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUU94797.1|1626850_1627327_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUU94798.1|1627376_1629020_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
AUU94799.1|1629303_1630197_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUU94800.1|1630202_1630922_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.1e-11
AUU94801.1|1630918_1631794_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	25.5	1.5e-10
>prophage 127
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1635656	1637951	5403218		Tetraselmis_virus(100.0%)	1	NA	NA
AUU98351.1|1635656_1637951_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	3.9e-159
>prophage 128
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1654059	1654671	5403218		Geobacillus_virus(100.0%)	1	NA	NA
AUU94821.1|1654059_1654671_-	murein transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
>prophage 129
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1670296	1677665	5403218	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
AUU98352.1|1670296_1671982_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.7e-34
AUU94838.1|1672187_1672769_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94839.1|1672807_1673503_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AUU94840.1|1673648_1675559_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.0	1.1e-90
AUU94841.1|1675690_1676035_+	RidA family protein	NA	NA	NA	NA	NA
AUU94842.1|1676035_1676221_-	YoaH family protein	NA	NA	NA	NA	NA
AUU94843.1|1676309_1677665_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	40.4	1.8e-42
>prophage 130
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1681573	1683133	5403218		Moraxella_phage(100.0%)	1	NA	NA
AUU94847.1|1681573_1683133_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.0	1.1e-40
>prophage 131
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1690573	1693366	5403218	transposase	Morganella_phage(50.0%)	6	NA	NA
AUU94854.1|1690573_1690783_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AUU98354.1|1690865_1690940_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AUU94855.1|1691052_1691259_+	hypothetical protein	NA	NA	NA	NA	NA
AUU94856.1|1691378_1691504_-	succinate dehydrogenase	NA	NA	NA	NA	NA
AUU94857.1|1691530_1691821_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94858.1|1692103_1693366_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 132
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1697681	1699730	5403218		Moraxella_phage(100.0%)	1	NA	NA
AUU94864.1|1697681_1699730_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	3.0e-86
>prophage 133
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1707237	1707891	5403218		Escherichia_phage(100.0%)	1	NA	NA
AUU94872.1|1707237_1707891_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	8.0e-57
>prophage 134
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1711614	1712583	5403218		Pectobacterium_phage(50.0%)	2	NA	NA
AUU94876.1|1711614_1711845_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	57.4	5.9e-15
AUU94877.1|1711923_1712583_+	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	31.7	2.2e-14
>prophage 135
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1720008	1721484	5403218		Cyanophage(100.0%)	1	NA	NA
AUU94884.1|1720008_1721484_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.2e-77
>prophage 136
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1725409	1741956	5403218	tRNA	Tupanvirus(37.5%)	18	NA	NA
AUU94889.1|1725409_1726729_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	38.2	5.3e-15
AUU94890.1|1726744_1727689_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUU94891.1|1727767_1728520_+	zinc ABC transporter ATP-binding protein ZnuC	NA	A0A2K9L3Z8	Tupanvirus	30.7	3.0e-15
AUU94892.1|1728519_1729305_+	zinc ABC transporter permease	NA	NA	NA	NA	NA
AUU94893.1|1729368_1730379_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	1.4e-07
AUU94894.1|1730387_1730999_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AUU94895.1|1731078_1731600_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	3.4e-10
AUU94896.1|1731634_1732375_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUU94897.1|1732402_1732846_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AUU94898.1|1732847_1734635_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
AUU94899.1|1734902_1735469_+	hydrolase	NA	NA	NA	NA	NA
AUU94900.1|1735465_1736284_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
AUU94901.1|1736336_1736732_+	hypothetical protein	NA	NA	NA	NA	NA
AUU94902.1|1736771_1737515_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
AUU94903.1|1737511_1738516_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AUU94904.1|1738597_1739341_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AUU94905.1|1739417_1739987_-	VOC family protein	NA	NA	NA	NA	NA
AUU94906.1|1740222_1741956_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
>prophage 137
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1761993	1797781	5403218	tail,holin,integrase	uncultured_Caudovirales_phage(31.43%)	47	1761679:1761738	1797908:1797969
1761679:1761738	attL	TCCCAATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAA	NA	NA	NA	NA
AUU94926.1|1761993_1762353_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	43.1	3.2e-15
AUU94927.1|1762349_1762886_-	lysozyme	NA	K7PM52	Enterobacteria_phage	73.4	2.4e-75
AUU94928.1|1762869_1763094_-|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	70.1	2.0e-20
AUU94929.1|1763183_1763465_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94930.1|1763478_1765725_-	hypothetical protein	NA	A0A0F6TJC8	Escherichia_coli_O157_typing_phage	38.7	4.3e-33
AUU94931.1|1765742_1767353_-	transcriptional regulator	NA	A0A2H4JCA3	uncultured_Caudovirales_phage	70.8	1.2e-226
AUU94932.1|1767349_1767691_-	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	48.2	2.0e-19
AUU94933.1|1767702_1768263_+	hypothetical protein	NA	NA	NA	NA	NA
AUU94934.1|1768259_1771136_-	hypothetical protein	NA	G9L6D4	Escherichia_phage	68.7	0.0e+00
AUU94935.1|1771135_1773847_-	lytic transglycosylase	NA	G9L6D3	Escherichia_phage	59.3	3.1e-296
AUU94936.1|1773852_1774341_-	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	49.0	3.5e-09
AUU94937.1|1774343_1774796_-	N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	43.0	5.8e-22
AUU94938.1|1774795_1776787_-	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	48.3	2.1e-185
AUU94939.1|1776786_1777350_-	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	49.2	7.6e-48
AUU94940.1|1777409_1778315_-	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	39.6	9.7e-45
AUU94941.1|1778530_1778887_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	70.7	1.1e-41
AUU94942.1|1778922_1779423_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	61.7	4.5e-52
AUU94943.1|1779636_1780485_-	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	42.5	1.2e-44
AUU94944.1|1780471_1780705_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94945.1|1780704_1782327_-|tail	phage tail protein	tail	A0A2H4J3N6	uncultured_Caudovirales_phage	59.8	1.1e-174
AUU94946.1|1782330_1782552_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94947.1|1782562_1783003_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94948.1|1783031_1783328_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94949.1|1783483_1783861_-	hypothetical protein	NA	A0A1I9KFA7	Aeromonas_phage	47.4	1.7e-19
AUU94950.1|1783778_1784276_-	hypothetical protein	NA	Q2NPG0	Xanthomonas_virus	42.2	2.8e-17
AUU94951.1|1784265_1784862_-	DUF1367 domain-containing protein	NA	H9C173	Pectobacterium_phage	70.2	4.0e-79
AUU94952.1|1784930_1785122_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94953.1|1785304_1785643_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.2	1.9e-46
AUU94954.1|1785655_1786273_-	hypothetical protein	NA	A0A2H4JEM6	uncultured_Caudovirales_phage	24.9	2.3e-05
AUU94955.1|1786269_1786500_-	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	37.3	3.8e-06
AUU94956.1|1786502_1787093_-	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	86.2	1.3e-95
AUU94957.1|1787238_1787472_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94958.1|1787475_1788144_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98358.1|1788182_1789577_-	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	46.7	1.9e-103
AUU94959.1|1789585_1790578_-	replication protein RepO	NA	A0A067ZIA1	Vibrio_phage	46.1	6.9e-28
AUU98359.1|1790580_1790739_-	adenylate cyclase	NA	NA	NA	NA	NA
AUU94960.1|1790822_1791269_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.4	1.7e-26
AUU94961.1|1791331_1791565_-	XRE family transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	44.4	2.9e-09
AUU94962.1|1791673_1792129_+	transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	55.0	4.1e-36
AUU94963.1|1792762_1793086_+	hypothetical protein	NA	NA	NA	NA	NA
AUU94964.1|1793093_1793339_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	55.0	2.8e-15
AUU94965.1|1793368_1795579_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.1	3.5e-96
AUU94966.1|1795578_1796139_+	hypothetical protein	NA	H9C156	Pectobacterium_phage	58.4	2.6e-48
AUU94967.1|1796140_1796326_+	hypothetical protein	NA	NA	NA	NA	NA
AUU94968.1|1796375_1796579_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	61.1	3.9e-10
AUU94969.1|1796535_1796781_+	hypothetical protein	NA	H9C153	Pectobacterium_phage	35.2	1.6e-05
AUU94970.1|1796764_1797781_+|integrase	integrase	integrase	H9C152	Pectobacterium_phage	64.5	5.7e-126
1797908:1797969	attR	TCCCAATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 138
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1803238	1803991	5403218		Bacillus_virus(100.0%)	1	NA	NA
AUU94976.1|1803238_1803991_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	2.2e-26
>prophage 139
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1814367	1819035	5403218		Burkholderia_phage(50.0%)	5	NA	NA
AUU98360.1|1814367_1814862_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	5.7e-31
AUU94987.1|1814842_1816276_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	4.0e-101
AUU94988.1|1816319_1817027_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
AUU94989.1|1817069_1817351_-	hypothetical protein	NA	NA	NA	NA	NA
AUU94990.1|1817889_1819035_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
>prophage 140
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1836269	1837538	5403218		Stenotrophomonas_phage(100.0%)	1	NA	NA
AUU95005.1|1836269_1837538_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.7	9.7e-75
>prophage 141
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1845479	1850222	5403218	transposase	Leptospira_phage(50.0%)	5	NA	NA
AUU95011.1|1845479_1846600_-|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.5e-50
AUU98362.1|1846795_1847038_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95012.1|1847107_1848211_+	phosphotransferase	NA	NA	NA	NA	NA
AUU95013.1|1848207_1849179_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
AUU95014.1|1849385_1850222_-	alpha/beta hydrolase	NA	A0A2D1GKK1	Mycobacterium_phage	28.8	4.8e-14
>prophage 142
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1865743	1870838	5403218		Stx2-converting_phage(50.0%)	3	NA	NA
AUU95034.1|1865743_1866913_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	80.7	7.6e-183
AUU95035.1|1867087_1868512_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AUU95036.1|1868735_1870838_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.9	2.8e-63
>prophage 143
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1875344	1876244	5403218		Cellulophaga_phage(100.0%)	1	NA	NA
AUU98365.1|1875344_1876244_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	1.4e-11
>prophage 144
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1882491	1900398	5403218	transposase	Catovirus(11.11%)	13	NA	NA
AUU95048.1|1882491_1883808_-	glycosyl transferase	NA	A0A1V0SAH6	Catovirus	37.5	7.1e-12
AUU95049.1|1883930_1885064_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AUU95050.1|1885076_1885970_-	glycosyl transferase	NA	NA	NA	NA	NA
AUU95051.1|1885966_1887121_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	40.9	9.4e-77
AUU95052.1|1887136_1889032_-	glycosyl transferase	NA	NA	NA	NA	NA
AUU95053.1|1889047_1889788_-	O-antigen export system ATP-binding protein RfbB	NA	A0A2K9L3Z8	Tupanvirus	24.9	1.7e-07
AUU98366.1|1889787_1890555_-	ABC transporter permease	NA	NA	NA	NA	NA
AUU95054.1|1891598_1892603_+	protein CapI	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	8.0e-32
AUU95055.1|1892830_1893799_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	2.2e-180
AUU95056.1|1894610_1895777_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
AUU95057.1|1895940_1897311_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	25.9	1.1e-31
AUU95058.1|1897333_1898749_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	8.9e-53
AUU95059.1|1898991_1900398_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	1.6e-38
>prophage 145
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1911672	1912665	5403218		Sulfolobales_Mexican_rudivirus(100.0%)	1	NA	NA
AUU95069.1|1911672_1912665_-	glycosyltransferase family 1 protein	NA	K4PAI8	Sulfolobales_Mexican_rudivirus	35.3	4.8e-05
>prophage 146
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1920862	1928696	5403218	transposase	Bacillus_phage(20.0%)	6	NA	NA
AUU98367.1|1920862_1921753_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.0	5.6e-45
AUU95075.1|1922186_1923155_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	3.8e-180
AUU95076.1|1923584_1925168_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	5.0e-36
AUU95077.1|1925504_1927352_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AUU95078.1|1927382_1927964_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
AUU95079.1|1928054_1928696_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.0e-36
>prophage 147
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1945816	1952723	5403218		Bacillus_phage(33.33%)	6	NA	NA
AUU95091.1|1945816_1947295_+	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
AUU95092.1|1947291_1948014_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AUU95093.1|1948332_1949694_+	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AUU98368.1|1949939_1950833_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AUU95094.1|1951075_1951849_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AUU98369.1|1951859_1952723_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 148
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1979742	1986798	5403218	tRNA	Enterobacteria_phage(50.0%)	7	NA	NA
AUU98372.1|1979742_1981776_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	8.9e-54
AUU95117.1|1981892_1982363_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	74.4	6.6e-61
AUU95118.1|1982410_1983130_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AUU98373.1|1983123_1984812_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.1	5.5e-259
AUU95119.1|1985041_1985155_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95120.1|1985129_1985867_-	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AUU95121.1|1985850_1986798_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	6.9e-25
>prophage 149
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1993332	1993887	5403218		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUU95126.1|1993332_1993887_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.8	1.3e-20
>prophage 150
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2009910	2011431	5403218		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AUU95141.1|2009910_2011431_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
>prophage 151
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2015195	2019102	5403218		Cellulophaga_phage(50.0%)	3	NA	NA
AUU95145.1|2015195_2015864_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	3.4e-55
AUU95146.1|2016224_2017058_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AUU95147.1|2017128_2019102_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	36.5	4.8e-12
>prophage 152
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2023502	2024357	5403218		Catovirus(100.0%)	1	NA	NA
AUU95152.1|2023502_2024357_+	endonuclease	NA	A0A1V0SBL9	Catovirus	33.2	1.5e-23
>prophage 153
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2032189	2036501	5403218		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
AUU95161.1|2032189_2033656_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.2	5.4e-45
AUU95162.1|2033776_2034754_+	GTP-binding protein	NA	NA	NA	NA	NA
AUU98374.1|2034797_2035505_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AUU95163.1|2035931_2036501_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.0	3.1e-12
>prophage 154
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2042256	2048343	5403218		Planktothrix_phage(33.33%)	5	NA	NA
AUU95168.1|2042256_2043846_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	4.5e-21
AUU95169.1|2043849_2044194_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95170.1|2044525_2045722_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	24.2	2.6e-21
AUU95171.1|2045718_2046438_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
AUU95172.1|2046585_2048343_+	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	41.8	6.4e-101
>prophage 155
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2052579	2065503	5403218	integrase	Vibrio_phage(33.33%)	15	2053990:2054003	2061293:2061306
AUU95178.1|2052579_2053587_-	nucleoid-associated protein	NA	A0A1V0E8C0	Vibrio_phage	49.8	2.4e-84
AUU95179.1|2053585_2053831_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95180.1|2053773_2054001_+	hypothetical protein	NA	NA	NA	NA	NA
2053990:2054003	attL	CCAGCGCATTAAGG	NA	NA	NA	NA
AUU95181.1|2054019_2055780_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
AUU95182.1|2056127_2057387_+|integrase	integrase	integrase	A0A1V0E8G8	Vibrio_phage	45.2	2.6e-96
AUU95183.1|2057513_2058581_+	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	32.3	6.8e-05
AUU95184.1|2058711_2058909_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AUU95185.1|2059008_2059242_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95186.1|2059234_2060278_+	topoisomerase	NA	A0A1B0VML8	Pseudomonas_phage	50.8	2.4e-39
AUU95187.1|2060261_2062109_+	hypothetical protein	NA	NA	NA	NA	NA
2061293:2061306	attR	CCAGCGCATTAAGG	NA	NA	NA	NA
AUU95188.1|2062807_2063077_+	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	43.5	3.1e-07
AUU95189.1|2063069_2063390_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95190.1|2063587_2063842_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUU95191.1|2064135_2064486_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUU95192.1|2064498_2065503_+	hypothetical protein	NA	A0A1P8DIG7	Virus_Rctr197k	37.7	2.8e-08
>prophage 156
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2074234	2074948	5403218		Shewanella_sp._phage(100.0%)	1	NA	NA
AUU95201.1|2074234_2074948_-	DUF1353 domain-containing protein	NA	A0A088C4U2	Shewanella_sp._phage	40.5	5.7e-08
>prophage 157
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2079438	2080599	5403218		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUU98376.1|2079438_2080599_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.2	6.6e-78
>prophage 158
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2084517	2088855	5403218	transposase	Acanthamoeba_polyphaga_mimivirus(50.0%)	3	NA	NA
AUU95208.1|2084517_2085582_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	49.5	3.5e-17
AUU95209.1|2085655_2086708_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AUU95210.1|2087886_2088855_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.1	8.8e-177
>prophage 159
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2093121	2105252	5403218		Pseudomonas_phage(33.33%)	8	NA	NA
AUU95213.1|2093121_2095962_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.9	8.3e-42
AUU95214.1|2096093_2098727_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	30.8	2.3e-94
AUU95215.1|2098873_2099602_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
AUU95216.1|2099645_2099834_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95217.1|2099946_2102232_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	2.5e-283
AUU95218.1|2102333_2103464_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.7	1.0e-176
AUU95219.1|2103463_2103718_+	2Fe-2S ferredoxin	NA	G9IAA2	Pseudomonas_phage	65.3	8.2e-26
AUU95220.1|2104181_2105252_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	52.6	2.1e-09
>prophage 160
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2113097	2114303	5403218		Oenococcus_phage(100.0%)	1	NA	NA
AUU95227.1|2113097_2114303_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.0	7.9e-26
>prophage 161
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2117418	2118372	5403218	transposase	Sodalis_phage(100.0%)	1	NA	NA
AUU95231.1|2117418_2118372_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	53.7	1.5e-67
>prophage 162
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2146401	2147001	5403218		Salmonella_phage(100.0%)	1	NA	NA
AUU95257.1|2146401_2147001_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	2.4e-07
>prophage 163
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2159403	2160177	5403218		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AUU95271.1|2159403_2160177_-	histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.9e-09
>prophage 164
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2164468	2165986	5403218		Mollivirus(100.0%)	1	NA	NA
AUU95277.1|2164468_2165986_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.6	1.0e-86
>prophage 165
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2170536	2268671	5403218	holin,integrase,capsid,protease,portal,terminase,tRNA,tail,head	Enterobacteria_phage(13.73%)	103	2193269:2193297	2234958:2234986
AUU95283.1|2170536_2171349_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AUU95284.1|2171348_2172362_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUU95285.1|2172425_2173562_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
AUU95286.1|2173672_2174650_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AUU95287.1|2174736_2175912_-	arabinose transporter	NA	NA	NA	NA	NA
AUU95288.1|2176121_2177342_-	beta-ketoacyl-[acyl-carrier-protein] synthase I	NA	NA	NA	NA	NA
AUU98377.1|2177500_2179489_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AUU98378.1|2179550_2179832_-	YfcL family protein	NA	NA	NA	NA	NA
AUU95289.1|2179863_2180412_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AUU95290.1|2180411_2181221_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95291.1|2181220_2182045_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AUU95292.1|2182047_2183133_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
AUU95293.1|2183174_2184107_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUU95294.1|2184274_2184826_+	endonuclease SmrB	NA	NA	NA	NA	NA
AUU95295.1|2184847_2185333_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AUU95296.1|2185542_2187687_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AUU95297.1|2187686_2188997_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AUU95298.1|2189156_2189441_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
AUU95299.1|2189809_2191138_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AUU95300.1|2191199_2191961_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AUU95301.1|2192250_2193180_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	81.4	3.0e-134
2193269:2193297	attL	TGTCCCCTTAGTTAAATGGATATAACGAG	NA	NA	NA	NA
AUU95302.1|2193403_2194003_-	DUF4760 domain-containing protein	NA	Q8HA56	Vibrio_phage	32.6	9.4e-20
AUU95303.1|2194654_2194894_-	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.7	6.8e-22
AUU95304.1|2195693_2196452_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95305.1|2196785_2197181_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95306.1|2197260_2198034_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95307.1|2198170_2198749_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95308.1|2200775_2203853_-	kinase	NA	A0A286S259	Klebsiella_phage	62.0	0.0e+00
AUU95309.1|2203849_2204230_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	84.1	6.9e-61
AUU95310.1|2204242_2204719_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
AUU95311.1|2204705_2205179_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.6e-54
AUU95312.1|2205200_2208587_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.7	1.2e-302
AUU95313.1|2208647_2208881_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
AUU95314.1|2208954_2209260_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
AUU95315.1|2209262_2209667_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
AUU95316.1|2209697_2210402_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	66.5	1.6e-79
AUU95317.1|2210458_2210806_-	hypothetical protein	NA	K7PKL6	Enterobacterial_phage	62.8	3.6e-32
AUU95318.1|2210802_2211252_-	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	82.6	2.3e-63
AUU95319.1|2211248_2211587_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	68.8	5.1e-39
AUU95320.1|2211595_2211913_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.9	2.1e-23
AUU95321.1|2211990_2213229_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	6.8e-158
AUU95322.1|2213238_2213838_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
AUU95323.1|2213830_2215057_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	84.8	7.1e-208
AUU95324.1|2215204_2216956_-|terminase	terminase	terminase	A0A1P8DTK0	Proteus_phage	72.2	5.2e-252
AUU95325.1|2216959_2217457_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.0	1.9e-63
AUU95326.1|2217614_2217965_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	80.2	2.7e-51
AUU95327.1|2218104_2218644_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95328.1|2218894_2219059_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	74.5	9.3e-15
AUU95329.1|2219048_2219324_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	82.8	1.3e-05
AUU95330.1|2219326_2219956_-	endolysin	NA	F1C591	Cronobacter_phage	77.8	3.1e-90
AUU95331.1|2219955_2220237_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	4.8e-19
AUU95332.1|2220223_2220610_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
AUU95333.1|2220775_2221015_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95334.1|2221165_2221744_-	hypothetical protein	NA	A0A0U2S606	Escherichia_phage	57.2	3.8e-50
AUU95335.1|2221740_2222382_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	68.4	3.7e-83
AUU95336.1|2222378_2223023_-	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	54.3	1.9e-39
AUU95337.1|2222992_2223964_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	61.6	3.9e-108
AUU95338.1|2223960_2225490_-	helicase	NA	A0A286N2P9	Klebsiella_phage	66.9	8.6e-203
AUU95339.1|2225482_2225758_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95340.1|2225919_2226198_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95341.1|2226233_2226704_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	75.0	4.2e-60
AUU95342.1|2226729_2226927_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	68.3	1.4e-17
AUU95343.1|2227030_2227678_+	phage repressor protein	NA	H9C160	Pectobacterium_phage	63.0	3.5e-73
AUU95344.1|2228245_2228425_-	hypothetical protein	NA	S5FM78	Shigella_phage	61.0	2.5e-13
AUU95345.1|2228849_2229209_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95346.1|2229252_2230065_+	DUF2303 domain-containing protein	NA	NA	NA	NA	NA
AUU95347.1|2230146_2231007_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	53.4	3.6e-73
AUU95348.1|2231196_2231325_+|integrase	integrase	integrase	NA	NA	NA	NA
AUU95349.1|2231321_2231546_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	52.3	1.4e-13
AUU95350.1|2231538_2231793_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95351.1|2232349_2232607_+	hypothetical protein	NA	G3CFG7	Escherichia_phage	63.2	1.5e-14
AUU95352.1|2232622_2233561_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
AUU95353.1|2233593_2234763_-|integrase	integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	85.0	3.1e-200
AUU95354.1|2235281_2235764_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
2234958:2234986	attR	TGTCCCCTTAGTTAAATGGATATAACGAG	NA	NA	NA	NA
AUU95355.1|2236131_2237013_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
AUU95356.1|2237022_2237931_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	4.6e-10
AUU95357.1|2238063_2238522_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.1	4.2e-12
AUU95358.1|2238518_2239715_+	cyanate transporter	NA	NA	NA	NA	NA
AUU98379.1|2240053_2240125_+	membrane protein YpdK	NA	NA	NA	NA	NA
AUU95359.1|2240195_2241410_-	alanine transaminase	NA	NA	NA	NA	NA
AUU95360.1|2241498_2241684_+	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
AUU95361.1|2241792_2243490_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
AUU98380.1|2243501_2244239_+	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
AUU95362.1|2244292_2245258_-	glucokinase	NA	NA	NA	NA	NA
AUU95363.1|2245521_2246757_+	ion channel protein	NA	NA	NA	NA	NA
AUU98381.1|2246753_2248415_-	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
AUU95364.1|2248595_2249588_+	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
AUU95365.1|2249718_2250078_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
AUU95366.1|2250135_2251377_-	divalent metal cation transporter	NA	NA	NA	NA	NA
AUU95367.1|2251723_2252926_+	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
AUU95368.1|2252932_2255146_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95369.1|2255767_2256121_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95370.1|2256124_2256517_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95371.1|2256568_2257987_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AUU95372.1|2258729_2259656_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.3	4.1e-06
AUU95373.1|2259744_2260743_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
AUU95374.1|2260739_2260958_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95375.1|2260959_2262975_-	DNA ligase	NA	A0A0K2QQN8	Ralstonia_phage	42.5	1.7e-145
AUU98382.1|2263044_2264118_-	cell division protein ZipA	NA	NA	NA	NA	NA
AUU95376.1|2264351_2265113_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
AUU95377.1|2265289_2266261_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	3.3e-75
AUU95378.1|2266641_2266899_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AUU95379.1|2266943_2268671_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.6	3.3e-17
>prophage 166
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2272279	2274404	5403218		Lactococcus_phage(50.0%)	2	NA	NA
AUU95385.1|2272279_2273191_-	cysteine synthase CysM	NA	A0A1W6JHY1	Lactococcus_phage	40.7	9.8e-53
AUU95386.1|2273309_2274404_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	7.2e-26
>prophage 167
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2277757	2281334	5403218		Pandoravirus(50.0%)	5	NA	NA
AUU95390.1|2277757_2278657_-	peroxidase	NA	S4VVJ7	Pandoravirus	32.6	3.8e-25
AUU95391.1|2278751_2279327_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AUU95392.1|2279388_2279838_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AUU95393.1|2279824_2280250_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AUU95394.1|2280461_2281334_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.2e-17
>prophage 168
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2313236	2414715	5403218	holin,integrase,capsid,protease,terminase,transposase,tRNA,tail	Salmonella_phage(28.79%)	112	2397324:2397352	2414935:2414963
AUU95424.1|2313236_2315240_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
AUU95425.1|2315249_2316125_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
AUU95426.1|2316244_2316958_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
AUU95427.1|2317174_2318209_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
AUU95428.1|2318225_2319104_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AUU95429.1|2319191_2319824_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
AUU95430.1|2319827_2320298_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
AUU95431.1|2320359_2321421_-	AI-2E family transporter	NA	NA	NA	NA	NA
AUU95432.1|2321643_2323107_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
AUU95433.1|2323116_2323476_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
AUU95434.1|2323603_2324527_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	58.8	4.6e-74
AUU95435.1|2324523_2325225_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
AUU95436.1|2325323_2326610_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
AUU95437.1|2326705_2327332_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AUU95438.1|2327549_2328983_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AUU95439.1|2328992_2329886_-	ROK family protein	NA	NA	NA	NA	NA
AUU95440.1|2330149_2331187_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
AUU95441.1|2331183_2331825_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	9.0e-29
AUU95442.1|2332005_2334066_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
AUU95443.1|2334069_2335602_+	exopolyphosphatase	NA	NA	NA	NA	NA
AUU95444.1|2338235_2338427_+	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
AUU95445.1|2338523_2339411_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUU95446.1|2339508_2340741_+	MFS transporter	NA	NA	NA	NA	NA
AUU95447.1|2341034_2342213_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
AUU95448.1|2342196_2344065_+	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	1.2e-07
AUU95449.1|2344284_2344767_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	83.8	5.0e-64
AUU95450.1|2344763_2345393_-	endolysin	NA	Q858F0	Salmonella_phage	77.9	9.6e-92
AUU95451.1|2345382_2345688_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
AUU95452.1|2345674_2346079_-	hypothetical protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
AUU95453.1|2346175_2346391_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95454.1|2346391_2348806_-	hypothetical protein	NA	A0A1J0MGQ6	Serratia_phage	40.6	8.7e-117
AUU95455.1|2348997_2350218_-|transposase	ISL3-like element ISCfr12 family transposase	transposase	NA	NA	NA	NA
AUU95456.1|2350317_2350578_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	64.0	9.3e-25
AUU95457.1|2350892_2351582_+	anti-repressor protein	NA	G9L6E2	Escherichia_phage	65.2	1.2e-79
AUU95458.1|2351776_2352409_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95459.1|2352507_2352660_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	5.6e-14
AUU98384.1|2352696_2352933_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95460.1|2353158_2353599_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95461.1|2353599_2353896_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95462.1|2353961_2355500_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	7.4e-295
AUU95463.1|2355548_2355896_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	3.3e-62
AUU95464.1|2355892_2356297_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
AUU95465.1|2359450_2362195_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.9	8.8e-97
AUU95466.1|2362207_2362705_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	41.7	5.2e-24
AUU95467.1|2362697_2363168_-	hypothetical protein	NA	Q858G2	Salmonella_phage	53.3	2.3e-42
AUU95468.1|2363169_2365653_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	57.1	1.4e-274
AUU95469.1|2365652_2366264_-	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	9.2e-47
AUU95470.1|2366312_2366591_-	hypothetical protein	NA	Q858G6	Salmonella_phage	59.6	2.3e-21
AUU95471.1|2366583_2366976_-	hypothetical protein	NA	T1SA71	Salmonella_phage	89.1	1.3e-54
AUU95472.1|2366985_2367993_-|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	4.7e-181
AUU98385.1|2368005_2368404_-	peptidase	NA	T1SAP9	Salmonella_phage	59.5	1.6e-36
AUU95473.1|2368706_2369012_-	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	6.4e-17
AUU95474.1|2369008_2370688_-|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	59.1	2.3e-193
AUU95475.1|2370691_2370895_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95476.1|2370916_2371105_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95477.1|2371637_2371994_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	69.9	4.1e-39
AUU95478.1|2372153_2373629_-|terminase	terminase	terminase	Q858H3	Salmonella_phage	92.2	5.4e-279
AUU95479.1|2373625_2374210_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	6.4e-90
AUU98386.1|2374267_2374597_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	56.1	3.0e-28
AUU95480.1|2374698_2375919_+|transposase	ISL3-like element ISCfr12 family transposase	transposase	NA	NA	NA	NA
AUU95481.1|2375998_2376337_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	85.5	2.1e-48
AUU95482.1|2376329_2376518_-	hypothetical protein	NA	R9TNE4	Aeromonas_phage	76.7	2.5e-19
AUU95483.1|2376517_2376778_-	eaa protein	NA	A0A077SLR0	Escherichia_phage	70.9	9.0e-28
AUU98387.1|2376770_2377313_-	Eaa protein	NA	R9TQX3	Aeromonas_phage	57.1	5.3e-46
AUU95484.1|2377429_2377741_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98388.1|2377737_2378094_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	34.1	3.7e-08
AUU95485.1|2378286_2378634_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	81.7	4.2e-49
AUU95486.1|2378752_2379538_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.0	1.4e-132
AUU95487.1|2379534_2380302_-	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.0	2.6e-139
AUU95488.1|2380301_2380511_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	79.7	1.0e-26
AUU95489.1|2380657_2380891_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	1.2e-23
AUU95490.1|2381045_2381627_+	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
AUU98389.1|2382029_2383061_+	hypothetical protein	NA	A0A059VK18	Pseudomonas_phage	51.6	4.2e-36
AUU95491.1|2383068_2383368_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	52.5	5.7e-18
AUU95492.1|2383364_2384264_+	endonuclease	NA	Q858E0	Salmonella_phage	91.0	1.9e-157
AUU95493.1|2384273_2385296_+	recombinase RecT	NA	Q858E1	Salmonella_phage	95.6	1.8e-180
AUU95494.1|2385346_2385595_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
AUU95495.1|2385704_2385998_+	perC transcriptional activator family protein	NA	T1S9J5	Salmonella_phage	70.1	1.2e-31
AUU95496.1|2385990_2386149_+	DUF1317 domain-containing protein	NA	T1SAR0	Salmonella_phage	82.4	6.7e-18
AUU95497.1|2386145_2386817_+	hypothetical protein	NA	R9VWB9	Serratia_phage	71.3	1.6e-92
AUU95498.1|2386813_2387005_+	hypothetical protein	NA	G9L698	Escherichia_phage	66.1	3.5e-13
AUU95499.1|2387590_2387953_+	hypothetical protein	NA	A0A173GC52	Salmonella_phage	35.7	1.3e-08
AUU95500.1|2387967_2389218_-|integrase	integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.5	1.8e-206
AUU95501.1|2389410_2390988_-	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AUU95502.1|2391055_2392522_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
AUU95503.1|2392680_2394072_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	3.7e-35
AUU95504.1|2394055_2394274_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95505.1|2394323_2395403_-	oxidoreductase	NA	NA	NA	NA	NA
AUU95506.1|2395586_2396066_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUU95507.1|2396096_2396288_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95508.1|2396287_2396980_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95509.1|2397059_2397305_-	hypothetical protein	NA	NA	NA	NA	NA
2397324:2397352	attL	CTGATAGCTTATTTGCTTTTCTTGATGTG	NA	NA	NA	NA
AUU95510.1|2397546_2397921_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95511.1|2398322_2398622_-	hypothetical protein	NA	A0A2H4JEE3	uncultured_Caudovirales_phage	40.3	7.4e-10
AUU98390.1|2399050_2401366_+	lytic transglycosylase domain-containing protein	NA	A0A193GYI3	Enterobacter_phage	35.0	2.7e-107
AUU95512.1|2401362_2403171_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	70.8	2.8e-237
AUU95513.1|2403174_2405652_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	83.8	0.0e+00
AUU95514.1|2405655_2405961_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95515.1|2406426_2406561_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95516.1|2406561_2406855_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95517.1|2407217_2409350_-	propanediol utilization protein	NA	A0A1W6JPG0	Morganella_phage	41.7	4.4e-128
AUU95518.1|2409360_2410002_-	hypothetical protein	NA	A0A1B5FPB4	Escherichia_phage	43.8	3.9e-24
AUU95519.1|2409998_2410343_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AUU95520.1|2410347_2410536_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95521.1|2410522_2410726_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95522.1|2410727_2410961_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98391.1|2410953_2411172_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AUU95523.1|2411389_2411587_+	hypothetical protein	NA	A0A0K2FIR8	Escherichia_phage	41.4	9.5e-06
AUU95524.1|2411686_2412265_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	58.2	3.3e-54
AUU95525.1|2412306_2412519_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AUU95526.1|2412805_2413456_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98392.1|2413452_2414715_-|integrase	integrase	integrase	A0A1W6JPG6	Morganella_phage	58.4	4.1e-142
2414935:2414963	attR	CTGATAGCTTATTTGCTTTTCTTGATGTG	NA	NA	NA	NA
>prophage 169
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2423814	2424246	5403218		Powai_lake_megavirus(100.0%)	1	NA	NA
AUU95535.1|2423814_2424246_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 170
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2434758	2441079	5403218		Mycoplasma_phage(20.0%)	8	NA	NA
AUU95541.1|2434758_2436045_-	peptidase B	NA	Q6GYZ8	Mycoplasma_phage	37.8	9.9e-35
AUU95542.1|2436115_2436316_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AUU95543.1|2436317_2436653_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AUU95544.1|2436654_2438505_-	molecular chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.5	1.4e-103
AUU95545.1|2438520_2439036_-	co-chaperone protein HscB	NA	NA	NA	NA	NA
AUU95546.1|2439110_2439434_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
AUU95547.1|2439451_2439838_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
AUU95548.1|2439864_2441079_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.8	3.2e-35
>prophage 171
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2456326	2478395	5403218	tRNA	Bacillus_phage(25.0%)	20	NA	NA
AUU95561.1|2456326_2457580_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	1.9e-99
AUU95562.1|2457598_2457865_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95563.1|2457905_2459096_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AUU95564.1|2459170_2459509_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
AUU95565.1|2459574_2460912_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	34.2	3.0e-10
AUU95566.1|2460898_2461606_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AUU95567.1|2461614_2463036_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	1.1e-13
AUU95568.1|2463626_2467514_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	5.0e-130
AUU95569.1|2467689_2469306_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
AUU95570.1|2469302_2469845_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	2.6e-05
AUU95571.1|2469874_2470510_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
AUU95572.1|2470723_2471572_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AUU95573.1|2471628_2471889_+	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	1.3e-18
AUU95574.1|2471901_2472282_-	holo-ACP synthase	NA	NA	NA	NA	NA
AUU95575.1|2472281_2473013_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AUU95576.1|2473024_2473762_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AUU95577.1|2473773_2474679_-	GTPase Era	NA	NA	NA	NA	NA
AUU95578.1|2474675_2475356_-	ribonuclease 3	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.6e-20
AUU95579.1|2475605_2476580_-	signal peptidase I	NA	NA	NA	NA	NA
AUU95580.1|2476595_2478395_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	5.5e-23
>prophage 172
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2483295	2573567	5403218	holin,integrase,portal,tRNA,tail	Enterobacteria_phage(20.37%)	97	2520141:2520156	2577806:2577821
AUU95586.1|2483295_2484033_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
AUU95587.1|2484164_2485496_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
AUU95588.1|2485541_2485925_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
AUU95589.1|2486237_2486927_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
AUU95590.1|2486984_2488070_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AUU95591.1|2488273_2488699_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
AUU95592.1|2488768_2489467_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AUU95593.1|2489501_2492153_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AUU95594.1|2492273_2493629_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AUU95595.1|2493670_2493994_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95596.1|2493997_2495296_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	4.1e-44
AUU95597.1|2501300_2503874_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
AUU95598.1|2504003_2504735_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AUU95599.1|2504731_2505712_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AUU95600.1|2505843_2506581_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AUU95601.1|2506851_2507187_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AUU98394.1|2507293_2507341_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95602.1|2507441_2508602_+	prephenate dehydratase	NA	NA	NA	NA	NA
AUU95603.1|2508598_2509471_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AUU95604.1|2509533_2510655_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AUU95605.1|2510664_2511735_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
AUU95606.1|2512077_2512587_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AUU95607.1|2512579_2513803_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUU95608.1|2513816_2514299_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95609.1|2514307_2515678_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
AUU95610.1|2515734_2516193_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AUU95611.1|2516312_2516660_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AUU95612.1|2516699_2517467_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AUU95613.1|2517498_2518047_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUU95614.1|2518065_2518314_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUU95615.1|2518573_2519938_-	signal recognition particle protein	NA	NA	NA	NA	NA
AUU95616.1|2520101_2520893_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
2520141:2520156	attL	GTCAGCCTCGCGCTGA	NA	NA	NA	NA
AUU95617.1|2520912_2522199_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AUU95618.1|2522318_2522909_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUU95619.1|2523033_2523912_+	NAD(+) kinase	NA	NA	NA	NA	NA
AUU95620.1|2523998_2525660_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AUU95621.1|2525807_2526149_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AUU95622.1|2526215_2526506_-	RnfH family protein	NA	NA	NA	NA	NA
AUU95623.1|2526495_2526972_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AUU95624.1|2527082_2527565_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
AUU95625.1|2528234_2528618_-	DNA polymerase V	NA	Q6UAV9	Klebsiella_phage	89.0	2.6e-63
AUU95626.1|2528697_2528937_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	87.3	7.2e-32
AUU95627.1|2529183_2529753_-	DNA-invertase	NA	A0A286S1P7	Klebsiella_phage	87.3	1.6e-85
AUU95628.1|2529960_2531559_+	hypothetical protein	NA	A0A1J0MGQ6	Serratia_phage	42.9	1.8e-126
AUU95629.1|2531558_2531786_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95630.1|2531817_2532093_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95631.1|2534203_2537266_-	kinase	NA	A0A286S259	Klebsiella_phage	80.6	0.0e+00
AUU95632.1|2537262_2537643_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	92.9	7.6e-68
AUU95633.1|2537652_2538135_-	ArsR family transcriptional regulator	NA	A0A286S2B1	Klebsiella_phage	83.8	1.1e-71
AUU95634.1|2538131_2538596_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	56.7	2.6e-49
AUU95635.1|2538595_2541292_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	58.0	2.1e-196
AUU95636.1|2541272_2541590_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	49.5	3.5e-18
AUU95637.1|2541610_2542006_-|tail	phage tail protein	tail	NA	NA	NA	NA
AUU95638.1|2542050_2542533_-|tail	phage tail protein	tail	O64327	Escherichia_phage	66.9	8.2e-59
AUU95639.1|2542540_2542939_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	62.5	3.6e-44
AUU95640.1|2542935_2543487_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	63.8	1.1e-51
AUU95641.1|2543476_2543770_-	ATP-binding protein	NA	NA	NA	NA	NA
AUU95642.1|2543762_2544089_-	recombinase RecA	NA	K7PJY3	Enterobacterial_phage	72.9	3.9e-36
AUU95643.1|2544176_2546192_-	peptidase S14	NA	K7PKX4	Enterobacterial_phage	86.4	0.0e+00
AUU95644.1|2546136_2547636_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	82.8	6.2e-246
AUU95645.1|2547632_2547848_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	75.7	5.5e-23
AUU95646.1|2547844_2549953_-	DNA packaging protein	NA	K7PH52	Enterobacterial_phage	84.1	0.0e+00
AUU95647.1|2549952_2550444_-	DUF1441 domain-containing protein	NA	K7PJY2	Enterobacterial_phage	84.0	8.4e-67
AUU95648.1|2550767_2550953_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	57.4	9.2e-11
AUU98395.1|2551020_2551230_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95649.1|2551505_2551748_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95650.1|2551744_2551891_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	83.3	1.5e-16
AUU95651.1|2551880_2552156_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	67.8	4.9e-24
AUU95652.1|2552152_2552497_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	64.9	3.0e-31
AUU95653.1|2552493_2553036_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	75.8	4.9e-76
AUU95654.1|2553038_2553392_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	75.7	1.2e-43
AUU95655.1|2553533_2554586_-	DNA adenine methylase	NA	A5LH81	Enterobacteria_phage	76.7	4.4e-166
AUU95656.1|2554735_2554930_-	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	81.5	1.9e-22
AUU95657.1|2555123_2555822_-	antitermination protein	NA	Q6UAU4	Klebsiella_phage	29.2	1.2e-10
AUU95658.1|2555843_2556905_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	55.1	1.7e-109
AUU95659.1|2556901_2558872_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	57.7	8.2e-214
AUU95660.1|2558864_2559764_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	73.2	1.7e-126
AUU95661.1|2559763_2560021_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	75.0	3.3e-22
AUU95662.1|2560017_2560896_-	GntR family transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	56.7	7.0e-32
AUU95663.1|2560892_2561072_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AUU95664.1|2561073_2561793_-	phage regulatory protein/antirepressor Ant	NA	A0A2I7RHG4	Vibrio_phage	51.8	2.8e-47
AUU95665.1|2561773_2561971_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95666.1|2561967_2562525_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	54.1	1.9e-43
AUU95667.1|2562553_2562763_-	cell division protein	NA	NA	NA	NA	NA
AUU95668.1|2562863_2563490_+	LexA family transcriptional repressor	NA	K7PM82	Enterobacteria_phage	47.3	1.0e-45
AUU95669.1|2564177_2564441_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	67.4	1.2e-06
AUU95670.1|2564760_2565132_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	93.5	2.8e-59
AUU95671.1|2565188_2566016_+	hypothetical protein	NA	Q8HAA2	Salmonella_phage	84.4	4.8e-131
AUU98396.1|2566157_2566685_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	69.7	9.3e-64
AUU95672.1|2566684_2566885_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95673.1|2566877_2567663_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	2.8e-64
AUU95674.1|2568177_2568582_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95675.1|2568578_2569298_+	hypothetical protein	NA	A0A1B0VCG7	Salmonella_phage	40.5	1.2e-26
AUU95676.1|2569297_2569813_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	77.0	3.4e-71
AUU95677.1|2570727_2570934_+	excisionase	NA	I6PBM8	Cronobacter_phage	77.0	3.1e-23
AUU95678.1|2570894_2572085_+|integrase	integrase	integrase	I6PDJ1	Cronobacter_phage	67.9	1.4e-147
AUU95679.1|2572361_2573567_+	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	49.8	3.7e-108
2577806:2577821	attR	GTCAGCCTCGCGCTGA	NA	NA	NA	NA
>prophage 173
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2576952	2585634	5403218	transposase	Enterobacteria_phage(85.71%)	9	NA	NA
AUU95681.1|2576952_2577519_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	3.7e-58
AUU95682.1|2577536_2577782_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	4.2e-19
AUU95683.1|2577778_2578516_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.2	7.1e-70
AUU95684.1|2579320_2579878_+	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	67.6	1.6e-29
AUU95685.1|2579874_2580102_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95686.1|2580098_2580419_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95687.1|2580430_2582764_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
AUU95688.1|2583067_2584279_+	hypothetical protein	NA	U5N3F3	Enterobacteria_phage	28.4	1.4e-33
AUU95689.1|2584665_2585634_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
>prophage 174
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2601499	2602402	5403218		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AUU95701.1|2601499_2602402_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
>prophage 175
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2607583	2612882	5403218		Lactobacillus_phage(25.0%)	5	NA	NA
AUU95708.1|2607583_2607829_+	NrdH-redoxin	NA	A0A0M7REK7	Lactobacillus_phage	41.1	5.5e-11
AUU95709.1|2607825_2608236_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
AUU95710.1|2608208_2610350_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	46.4	2.5e-184
AUU95711.1|2610360_2611323_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.2	1.5e-131
AUU95712.1|2611679_2612882_+	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.8	1.2e-26
>prophage 176
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2627599	2635804	5403218	tRNA	Vibrio_phage(20.0%)	9	NA	NA
AUU95727.1|2627599_2627785_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AUU98400.1|2627970_2628165_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95728.1|2628148_2630776_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	4.9e-81
AUU95729.1|2631026_2631527_-	regulatory protein RecX	NA	NA	NA	NA	NA
AUU95730.1|2631594_2632653_-	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	2.3e-114
AUU95731.1|2632743_2633241_-	hypothetical protein	NA	B5TK85	Pseudomonas_phage	50.3	3.1e-29
AUU95732.1|2633380_2634259_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUU95733.1|2634266_2635130_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AUU95734.1|2635126_2635804_-	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	29.3	3.0e-06
>prophage 177
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2641742	2642708	5403218		Tetraselmis_virus(100.0%)	1	NA	NA
AUU95743.1|2641742_2642708_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.6	1.6e-37
>prophage 178
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2669649	2671050	5403218		Pandoravirus(100.0%)	1	NA	NA
AUU95770.1|2669649_2671050_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.3	5.2e-45
>prophage 179
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2681415	2682237	5403218		Brazilian_cedratvirus(100.0%)	1	NA	NA
AUU95781.1|2681415_2682237_+	manganese/iron transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	2.1e-14
>prophage 180
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2693980	2697475	5403218		Staphylococcus_phage(50.0%)	2	NA	NA
AUU95792.1|2693980_2694760_+	heme ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	3.0e-10
AUU95793.1|2694913_2697475_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	1.3e-30
>prophage 181
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2700942	2707361	5403218		uncultured_Mediterranean_phage(40.0%)	7	NA	NA
AUU95798.1|2700942_2701830_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.3	8.7e-06
AUU95799.1|2701938_2703141_+	MFS transporter	NA	NA	NA	NA	NA
AUU95800.1|2703137_2703515_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AUU95801.1|2703567_2704560_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	4.6e-32
AUU95802.1|2704717_2705854_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	3.8e-06
AUU95803.1|2705979_2706606_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	6.3e-35
AUU95804.1|2706599_2707361_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	1.7e-58
>prophage 182
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2710431	2712464	5403218		Tupanvirus(50.0%)	2	NA	NA
AUU95810.1|2710431_2711037_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.6	6.1e-27
AUU95811.1|2711036_2712464_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.1	1.1e-34
>prophage 183
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2721230	2726567	5403218		Vibrio_phage(33.33%)	4	NA	NA
AUU95818.1|2721230_2721902_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	32.1	2.5e-13
AUU95819.1|2722376_2723486_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
AUU95820.1|2723549_2724848_-	enolase	NA	W6LP63	Streptococcus_phage	57.5	7.5e-131
AUU95821.1|2724929_2726567_-	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	2.3e-153
>prophage 184
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2730109	2735575	5403218		Erysipelothrix_phage(33.33%)	3	NA	NA
AUU95824.1|2730109_2731414_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	1.7e-34
AUU95825.1|2731527_2734278_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	28.9	6.4e-47
AUU95826.1|2734435_2735575_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.9	3.4e-47
>prophage 185
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2742989	2743835	5403218		Vibrio_phage(100.0%)	1	NA	NA
AUU95834.1|2742989_2743835_+	preQ(1) synthase	NA	A0A2I7SAX1	Vibrio_phage	37.4	1.5e-42
>prophage 186
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2754090	2755113	5403218		Bacillus_phage(100.0%)	1	NA	NA
AUU95843.1|2754090_2755113_-	methionine ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.0	1.0e-13
>prophage 187
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2761517	2762273	5403218		Bacillus_phage(100.0%)	1	NA	NA
AUU95848.1|2761517_2762273_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.6	2.9e-10
>prophage 188
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2773818	2776319	5403218	tRNA	environmental_halophage(50.0%)	3	NA	NA
AUU95859.1|2773818_2775024_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	6.8e-70
AUU95860.1|2775023_2775455_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AUU95861.1|2775497_2776319_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	31.7	1.6e-14
>prophage 189
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2783430	2785911	5403218		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUU95867.1|2783430_2785911_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.4	6.2e-17
>prophage 190
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2788991	2789252	5403218		Burkholderia_virus(100.0%)	1	NA	NA
AUU95870.1|2788991_2789252_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	31.8	1.6e-05
>prophage 191
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2800994	2801819	5403218		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AUU95880.1|2800994_2801819_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.3	4.3e-07
>prophage 192
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2834471	2846151	5403218		Deep-sea_thermophilic_phage(25.0%)	6	NA	NA
AUU95920.1|2834471_2835725_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	1.5e-14
AUU95921.1|2835952_2837284_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
AUU95922.1|2837513_2837834_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95923.1|2837891_2839736_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.8	5.3e-21
AUU95924.1|2839732_2843269_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.1	1.7e-07
AUU95925.1|2843265_2846151_-	pitrilysin	NA	A0A1V0SH69	Hokovirus	21.8	1.1e-44
>prophage 193
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2851662	2863580	5403218		Geobacillus_virus(25.0%)	10	NA	NA
AUU95931.1|2851662_2852457_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	72.7	2.4e-119
AUU95932.1|2852463_2853339_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AUU95933.1|2853584_2855831_-	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	23.3	5.6e-09
AUU95934.1|2855843_2856374_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AUU95935.1|2857056_2857752_+	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
AUU95936.1|2857815_2858529_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	4.5e-45
AUU95937.1|2858652_2858871_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
AUU95938.1|2859091_2860132_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AUU95939.1|2860234_2861428_-	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
AUU95940.1|2861420_2863580_-	bifunctional 2-acylglycerophosphoethanolamine acyltransferase/acyl-ACP synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	25.1	6.4e-18
>prophage 194
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2869557	2870568	5403218		Enterobacteria_phage(100.0%)	1	NA	NA
AUU95947.1|2869557_2870568_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	2.1e-27
>prophage 195
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2876281	2877409	5403218		Bacillus_phage(100.0%)	1	NA	NA
AUU95954.1|2876281_2877409_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	4.7e-12
>prophage 196
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2883172	2886643	5403218		Enterobacteria_phage(33.33%)	3	NA	NA
AUU95958.1|2883172_2884168_+	transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.2	2.8e-13
AUU95959.1|2884164_2885586_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.3	1.1e-23
AUU95960.1|2885881_2886643_-	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.0e-18
>prophage 197
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2902819	2965926	5403218	tRNA,transposase,integrase	Escherichia_phage(18.75%)	62	2899790:2899808	2943577:2943595
2899790:2899808	attL	GCTGGTCTGGGTATCGGTA	NA	NA	NA	NA
AUU95975.1|2902819_2903800_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
AUU95976.1|2904478_2904688_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AUU95977.1|2904783_2905680_-	EamA family transporter	NA	NA	NA	NA	NA
AUU95978.1|2905761_2906268_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUU95979.1|2906264_2907221_-	nickel transporter	NA	NA	NA	NA	NA
AUU95980.1|2908039_2908288_+	citrate lyase subunit alpha	NA	NA	NA	NA	NA
AUU95981.1|2908438_2909044_+|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	51.4	4.6e-51
AUU95982.1|2909509_2910118_+	tyrosine recombinase	NA	A0A2L1IV36	Escherichia_phage	50.7	2.6e-49
AUU95983.1|2910596_2911145_+	type-1 fimbrial protein subunit A	NA	NA	NA	NA	NA
AUU98407.1|2911239_2911752_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AUU95984.1|2911780_2912506_+	molecular chaperone FimC	NA	NA	NA	NA	NA
AUU95985.1|2912587_2915200_+	fimbrial protein	NA	NA	NA	NA	NA
AUU95986.1|2915207_2915738_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AUU95987.1|2915750_2916251_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AUU98408.1|2916268_2917174_+	fimbrial protein	NA	NA	NA	NA	NA
AUU95988.1|2917170_2918583_+	fimbrial protein	NA	NA	NA	NA	NA
AUU95989.1|2918625_2918898_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUU98409.1|2918909_2919140_-	hypothetical protein	NA	NA	NA	NA	NA
AUU95990.1|2919345_2919618_+	hypothetical protein	NA	NA	NA	NA	NA
AUU95991.1|2919624_2920650_+	multidrug transporter subunit MdtN	NA	NA	NA	NA	NA
AUU95992.1|2920662_2922600_+	multidrug transporter subunit MdtO	NA	NA	NA	NA	NA
AUU95993.1|2922596_2924045_+	multidrug resistance transporter	NA	NA	NA	NA	NA
AUU95994.1|2924107_2924407_-	DUF1889 domain-containing protein	NA	NA	NA	NA	NA
AUU95995.1|2924591_2926145_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.1	9.5e-157
AUU95996.1|2926617_2927040_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	65.7	4.5e-45
AUU95997.1|2927049_2928342_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.7	2.5e-163
AUU95998.1|2928393_2928723_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	54.0	2.9e-23
AUU95999.1|2928941_2929235_+	hypothetical protein	NA	NA	NA	NA	NA
AUU96000.1|2929265_2929838_+	DUF1349 domain-containing protein	NA	NA	NA	NA	NA
AUU96001.1|2929841_2930117_-	hypothetical protein	NA	NA	NA	NA	NA
AUU96002.1|2930288_2931188_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUU96003.1|2931326_2931635_+	superoxide dismutase	NA	NA	NA	NA	NA
AUU96004.1|2931643_2932201_+	flavodoxin family protein	NA	NA	NA	NA	NA
AUU96005.1|2932221_2933241_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	31.8	3.8e-05
AUU96006.1|2934094_2935120_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUU96007.1|2935414_2936383_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.1	8.8e-177
AUU96008.1|2937398_2938475_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUU96009.1|2938905_2939835_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUU96010.1|2939964_2941353_+	MFS transporter	NA	NA	NA	NA	NA
AUU96011.1|2941674_2942388_-	hypothetical protein	NA	I3PV79	Clostridium_phage	35.8	1.7e-12
AUU96012.1|2942438_2942627_-	hypothetical protein	NA	NA	NA	NA	NA
AUU96013.1|2942704_2943259_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AUU96014.1|2943493_2945011_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.2	8.6e-86
2943577:2943595	attR	TACCGATACCCAGACCAGC	NA	NA	NA	NA
AUU96015.1|2945020_2946119_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
AUU96016.1|2946204_2947938_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.2	4.9e-61
AUU96017.1|2947943_2948657_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AUU96018.1|2948679_2949576_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	7.9e-31
AUU96019.1|2949676_2950198_+	flavodoxin FldB	NA	NA	NA	NA	NA
AUU96020.1|2950204_2950615_-	hypothetical protein	NA	NA	NA	NA	NA
AUU96021.1|2950595_2950862_-	FAD assembly factor SdhE	NA	NA	NA	NA	NA
AUU96022.1|2951107_2952091_+|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
AUU96023.1|2952189_2952849_-	hemolysin III family protein	NA	NA	NA	NA	NA
AUU96024.1|2953012_2953324_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
AUU96025.1|2953373_2954102_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AUU96026.1|2954220_2955654_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	2.7e-33
AUU96027.1|2955778_2956138_+	copper resistance protein	NA	NA	NA	NA	NA
AUU96028.1|2956187_2958197_+	protein-disulfide reductase	NA	NA	NA	NA	NA
AUU96029.1|2958198_2958810_+	disulfide bond formation protein DsbA	NA	NA	NA	NA	NA
AUU96030.1|2958799_2959303_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
AUU96031.1|2959729_2960806_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUU96032.1|2962246_2962990_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUU96033.1|2963052_2965926_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.6	5.7e-264
>prophage 198
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2973868	2975101	5403218		Catovirus(100.0%)	1	NA	NA
AUU96042.1|2973868_2975101_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	6.9e-102
>prophage 199
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2991089	2992244	5403218		Staphylococcus_phage(100.0%)	1	NA	NA
AUU96058.1|2991089_2992244_+	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	1.4e-128
>prophage 200
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2999121	3000102	5403218	transposase	Escherichia_phage(100.0%)	1	NA	NA
AUU96067.1|2999121_3000102_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
>prophage 201
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3008316	3009399	5403218		Geobacillus_virus(100.0%)	1	NA	NA
AUU96079.1|3008316_3009399_+	lytic murein transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	9.9e-12
>prophage 202
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3015068	3016439	5403218		Lactococcus_phage(100.0%)	1	NA	NA
AUU98410.1|3015068_3016439_+	CBS domain-containing protein	NA	A0A1W6JIM2	Lactococcus_phage	37.3	6.6e-45
>prophage 203
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3036146	3046049	5403218		Staphylococcus_phage(25.0%)	8	NA	NA
AUU96105.1|3036146_3036974_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	3.4e-60
AUU96106.1|3037009_3037537_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUU96107.1|3037594_3039778_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.0e-103
AUU96108.1|3039901_3041314_-	cell division protein FtsP	NA	NA	NA	NA	NA
AUU96109.1|3041397_3042135_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
AUU96110.1|3042326_3044585_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.1	1.4e-84
AUU96111.1|3044706_3045576_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUU96112.1|3045653_3046049_-	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	42.5	9.8e-18
>prophage 204
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3049360	3051256	5403218		Bacillus_virus(100.0%)	1	NA	NA
AUU96117.1|3049360_3051256_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.7	5.9e-92
>prophage 205
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3055598	3062479	5403218		Erwinia_phage(25.0%)	8	NA	NA
AUU96123.1|3055598_3056270_+	DUF1190 domain-containing protein	NA	A0A173GEW8	Erwinia_phage	48.3	9.7e-42
AUU96124.1|3056275_3057436_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.9	1.1e-88
AUU96125.1|3057480_3058272_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
AUU96126.1|3058458_3059229_+	zinc transporter ZupT	NA	NA	NA	NA	NA
AUU96127.1|3059290_3059944_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
AUU96128.1|3060321_3060594_+	hypothetical protein	NA	NA	NA	NA	NA
AUU96129.1|3060629_3060827_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
AUU96130.1|3061045_3062479_-	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	2.0e-39
>prophage 206
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3067590	3068832	5403218	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
AUU96133.1|3067590_3068832_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	50.1	5.2e-89
>prophage 207
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3078125	3083509	5403218	tRNA	Moraxella_phage(33.33%)	5	NA	NA
AUU96146.1|3078125_3079139_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.2e-109
AUU96147.1|3079147_3079378_-	hypothetical protein	NA	NA	NA	NA	NA
AUU96148.1|3079376_3079592_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AUU96149.1|3079703_3081449_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
AUU96150.1|3081667_3083509_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
>prophage 208
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3091671	3092475	5403218		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AUU96157.1|3091671_3092475_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	1.2e-14
>prophage 209
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3110553	3111933	5403218		Klosneuvirus(100.0%)	1	NA	NA
AUU96173.1|3110553_3111933_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.5e-31
>prophage 210
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3116204	3117692	5403218		Staphylococcus_phage(100.0%)	1	NA	NA
AUU96179.1|3116204_3117692_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.3	1.0e-19
>prophage 211
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3127255	3128227	5403218		Escherichia_phage(100.0%)	1	NA	NA
AUU96188.1|3127255_3128227_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.4	1.5e-35
>prophage 212
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3145365	3146511	5403218		Streptococcus_phage(100.0%)	1	NA	NA
AUU96209.1|3145365_3146511_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.2	5.7e-50
>prophage 213
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3151785	3159661	5403218		Streptococcus_phage(25.0%)	10	NA	NA
AUU96214.1|3151785_3152649_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.5	2.1e-49
AUU96215.1|3152712_3154821_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
AUU96216.1|3154778_3155165_+	YraN family protein	NA	NA	NA	NA	NA
AUU96217.1|3155190_3155781_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
AUU96218.1|3155790_3156366_+	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AUU96219.1|3156487_3157528_-	permease	NA	NA	NA	NA	NA
AUU96220.1|3157603_3158251_-	hypothetical protein	NA	NA	NA	NA	NA
AUU96221.1|3158379_3158916_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	9.3e-11
AUU96222.1|3158877_3159321_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98416.1|3159376_3159661_+	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	52.6	2.3e-13
>prophage 214
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3165354	3167286	5403218		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AUU96229.1|3165354_3167286_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	2.1e-52
>prophage 215
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3172700	3179319	5403218		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
AUU96237.1|3172700_3175391_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.4	5.1e-25
AUU96238.1|3175415_3176903_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AUU96239.1|3176930_3177383_-	ribosome maturation factor	NA	NA	NA	NA	NA
AUU96240.1|3177975_3179319_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 216
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3183583	3186460	5403218	protease	Pandoravirus(50.0%)	2	NA	NA
AUU96246.1|3183583_3184432_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	30.7	6.0e-20
AUU96247.1|3184525_3186460_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	4.1e-117
>prophage 217
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3193058	3194500	5403218		Indivirus(50.0%)	2	NA	NA
AUU96256.1|3193058_3194030_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.0	1.0e-07
AUU96257.1|3194227_3194500_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	63.5	3.1e-15
>prophage 218
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3198549	3211480	5403218		Bacillus_virus(16.67%)	16	NA	NA
AUU96264.1|3198549_3199362_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	1.2e-17
AUU96265.1|3199353_3199557_+	hypothetical protein	NA	NA	NA	NA	NA
AUU96266.1|3199571_3200549_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
AUU96267.1|3200563_3201550_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	3.0e-39
AUU96268.1|3201564_3202131_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	81.3	5.3e-57
AUU96269.1|3202127_3202703_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AUU96270.1|3202671_3203217_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AUU96271.1|3203223_3203949_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
AUU96272.1|3203996_3205430_+	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AUU96273.1|3205452_3205740_+	hypothetical protein	NA	NA	NA	NA	NA
AUU96274.1|3205810_3206299_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AUU96275.1|3206344_3207199_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
AUU96276.1|3207195_3207468_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AUU96277.1|3207531_3208257_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AUU96278.1|3208253_3208907_-	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AUU96279.1|3209140_3211480_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	9.3e-39
>prophage 219
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3215424	3216357	5403218		Staphylococcus_phage(100.0%)	1	NA	NA
AUU96283.1|3215424_3216357_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.8	3.4e-16
>prophage 220
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3223802	3224297	5403218	protease	Pseudomonas_phage(100.0%)	1	NA	NA
AUU96287.1|3223802_3224297_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 221
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3228242	3229610	5403218	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AUU96293.1|3228242_3229610_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
>prophage 222
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3247318	3248362	5403218		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AUU96310.1|3247318_3248362_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 223
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3275898	3277370	5403218	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
AUU96334.1|3275898_3276408_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	1.5e-18
AUU96335.1|3276422_3277370_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
>prophage 224
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3297273	3300642	5403218		Tupanvirus(50.0%)	2	NA	NA
AUU96372.1|3297273_3298458_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
AUU96373.1|3298527_3300642_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.6	1.8e-57
>prophage 225
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3308487	3318131	5403218		Tupanvirus(25.0%)	11	NA	NA
AUU96386.1|3308487_3310392_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.9	6.5e-75
AUU98420.1|3310454_3310655_-	hypothetical protein	NA	NA	NA	NA	NA
AUU96387.1|3310595_3311618_+	hydrolase	NA	NA	NA	NA	NA
AUU96388.1|3311614_3311833_+	hypothetical protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	37.3	4.0e-05
AUU96389.1|3311869_3312739_+	phosphoribulokinase	NA	NA	NA	NA	NA
AUU96390.1|3312793_3313198_-	OsmC family protein	NA	NA	NA	NA	NA
AUU98421.1|3313157_3313346_+	hypothetical protein	NA	NA	NA	NA	NA
AUU96391.1|3313504_3314137_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AUU96392.1|3314188_3316267_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	84.8	4.1e-62
AUU96393.1|3316256_3317477_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AUU96394.1|3317567_3318131_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	58.4	1.4e-57
>prophage 226
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3329532	3330360	5403218		Vibrio_phage(100.0%)	1	NA	NA
AUU96406.1|3329532_3330360_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.0	6.1e-70
>prophage 227
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3345183	3348955	5403218		Bacillus_phage(66.67%)	3	NA	NA
AUU96420.1|3345183_3346806_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.3	7.6e-141
AUU96421.1|3346883_3348239_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.7	1.2e-11
AUU96422.1|3348235_3348955_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 228
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3361781	3364172	5403218		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AUU96434.1|3361781_3364172_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.1e-13
>prophage 229
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3367516	3368275	5403218		Escherichia_phage(100.0%)	1	NA	NA
AUU96437.1|3367516_3368275_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	2.3e-23
>prophage 230
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3371336	3373784	5403218		Dickeya_phage(100.0%)	1	NA	NA
AUU96441.1|3371336_3373784_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	2.7e-33
>prophage 231
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3391528	3393336	5403218		Enterococcus_phage(50.0%)	2	NA	NA
AUU96457.1|3391528_3392269_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	4.1e-09
AUU96458.1|3392265_3393336_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
>prophage 232
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3396761	3398994	5403218		Streptococcus_phage(33.33%)	4	NA	NA
AUU96462.1|3396761_3397130_-	type II toxin-antitoxin system death-on-curing family toxin	NA	E4ZFM2	Streptococcus_phage	30.1	3.5e-09
AUU96463.1|3397126_3397348_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
AUU96464.1|3397511_3398225_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	30.6	2.2e-15
AUU96465.1|3398226_3398994_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	5.8e-14
>prophage 233
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3410918	3416719	5403218		Klosneuvirus(25.0%)	5	NA	NA
AUU96477.1|3410918_3412184_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	1.0e-23
AUU96478.1|3412302_3413826_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.2	1.4e-14
AUU96479.1|3413878_3414733_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
AUU96480.1|3415002_3416058_-	cell division protein FtsX	NA	NA	NA	NA	NA
AUU96481.1|3416050_3416719_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	5.0e-14
>prophage 234
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3419803	3424163	5403218		Dickeya_phage(50.0%)	4	NA	NA
AUU96486.1|3419803_3420430_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	60.2	2.1e-30
AUU96487.1|3420508_3422719_+	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	36.1	1.1e-113
AUU96488.1|3423045_3423291_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	86.1	4.7e-10
AUU96489.1|3423497_3424163_+	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	55.8	2.1e-57
>prophage 235
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3430462	3434569	5403218		Tupanvirus(66.67%)	3	NA	NA
AUU96496.1|3430462_3432448_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	5.7e-21
AUU96497.1|3432444_3433428_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.3	9.6e-38
AUU96498.1|3433429_3434569_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.3	9.4e-29
>prophage 236
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3440671	3441463	5403218		Bacillus_virus(100.0%)	1	NA	NA
AUU96505.1|3440671_3441463_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	28.2	2.3e-13
>prophage 237
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3451834	3453877	5403218		Indivirus(100.0%)	1	NA	NA
AUU96514.1|3451834_3453877_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.8	3.8e-44
>prophage 238
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3497616	3503590	5403218		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
AUU96543.1|3497616_3499728_-	cellulose synthase catalytic subunit (UDP-forming)	NA	M1I277	Paramecium_bursaria_Chlorella_virus	34.2	4.6e-37
AUU96544.1|3499747_3500551_-	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
AUU96545.1|3500541_3501081_-	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
AUU96546.1|3501398_3501578_-	hypothetical protein	NA	NA	NA	NA	NA
AUU96547.1|3501596_3502610_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	7.4e-17
AUU96548.1|3502606_3503590_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	2.3e-15
>prophage 239
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3514648	3517388	5403218		Streptococcus_phage(50.0%)	2	NA	NA
AUU96557.1|3514648_3515089_+	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	33.6	1.3e-15
AUU96558.1|3515057_3517388_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.3	4.4e-65
>prophage 240
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3522547	3523519	5403218		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AUU96564.1|3522547_3523519_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.5	6.4e-18
>prophage 241
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3526922	3530427	5403218	transposase	Morganella_phage(33.33%)	4	NA	NA
AUU96569.1|3526922_3527135_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
AUU96570.1|3527233_3528853_-	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	24.9	8.1e-26
AUU96571.1|3529154_3529307_-	small toxic polypeptide	NA	NA	NA	NA	NA
AUU96572.1|3529380_3530427_+|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
>prophage 242
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3534330	3535326	5403218		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AUU96576.1|3534330_3535326_+	O-acetyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.3	2.1e-08
>prophage 243
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3540795	3542337	5403218		Staphylococcus_phage(100.0%)	1	NA	NA
AUU96582.1|3540795_3542337_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	2.5e-16
>prophage 244
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3550311	3552153	5403218	tRNA	Tupanvirus(100.0%)	1	NA	NA
AUU96591.1|3550311_3552153_-|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	24.7	1.2e-12
>prophage 245
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3566804	3575953	5403218		Rhizobium_phage(20.0%)	9	NA	NA
AUU96606.1|3566804_3567056_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	52.1	9.9e-16
AUU96607.1|3567159_3567591_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AUU96608.1|3567836_3569381_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AUU96609.1|3569390_3570662_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	3.5e-08
AUU96610.1|3570665_3571613_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AUU96611.1|3571618_3572407_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AUU96612.1|3572575_3573601_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	3.6e-19
AUU96613.1|3573613_3574807_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.5	1.7e-36
AUU96614.1|3575020_3575953_+	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	2.2e-36
>prophage 246
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3580385	3581369	5403218		Catovirus(100.0%)	1	NA	NA
AUU96619.1|3580385_3581369_+	glycosyl transferase	NA	A0A1V0SAH6	Catovirus	39.0	1.9e-09
>prophage 247
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3588889	3593631	5403218		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
AUU96627.1|3588889_3589369_+	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.3	2.8e-27
AUU96628.1|3589556_3590366_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.1	2.9e-24
AUU96629.1|3590501_3590669_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AUU96630.1|3590689_3590926_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AUU96631.1|3591142_3591808_-	JAB domain-containing protein	NA	NA	NA	NA	NA
AUU98431.1|3591980_3593195_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.7	1.1e-43
AUU98430.1|3593175_3593631_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	4.7e-48
>prophage 248
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3599695	3601629	5403218	transposase	Salmonella_phage(50.0%)	2	NA	NA
AUU96637.1|3599695_3600664_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.1	8.8e-177
AUU96638.1|3600711_3601629_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	2.1e-23
>prophage 249
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3605930	3614813	5403218	holin,integrase	Morganella_phage(50.0%)	12	3596637:3596652	3618571:3618586
3596637:3596652	attL	GCCAGCGCCACGCAGG	NA	NA	NA	NA
AUU98434.1|3605930_3607190_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	79.4	2.6e-197
AUU96642.1|3607304_3608228_+	hypothetical protein	NA	NA	NA	NA	NA
AUU96643.1|3608339_3608558_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AUU96644.1|3608557_3608995_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	52.9	6.6e-31
AUU96645.1|3609008_3609818_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	41.3	2.6e-25
AUU96646.1|3609810_3609984_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AUU96647.1|3610064_3610667_+	Ash-like/host cell division inhibitor Icd-like protein	NA	A0A1C9IHV9	Salmonella_phage	54.3	4.5e-14
AUU96648.1|3610659_3610839_+	hypothetical protein	NA	NA	NA	NA	NA
AUU96649.1|3610835_3611150_+	ubiquinol-cytochrome C reductase	NA	NA	NA	NA	NA
AUU96650.1|3611146_3611410_+|holin	nicotinic acetylcholine receptor subunit beta	holin	NA	NA	NA	NA
AUU96651.1|3611406_3612033_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	35.2	2.2e-24
AUU96652.1|3612047_3614813_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.7	9.5e-293
3618571:3618586	attR	GCCAGCGCCACGCAGG	NA	NA	NA	NA
>prophage 250
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3620150	3628441	5403218		Acanthamoeba_polyphaga_mimivirus(25.0%)	7	NA	NA
AUU96661.1|3620150_3621209_+	XRE family transcriptional regulator	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	47.5	1.4e-18
AUU96662.1|3621264_3622515_-	chloride channel protein	NA	NA	NA	NA	NA
AUU96663.1|3622790_3623408_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
AUU96664.1|3623413_3625090_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	24.0	3.0e-23
AUU96665.1|3625348_3625972_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	1.7e-19
AUU96666.1|3626026_3626302_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AUU96667.1|3626320_3628441_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 251
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3639422	3640274	5403218		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AUU96679.1|3639422_3640274_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.2	2.2e-14
>prophage 252
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3643408	3644800	5403218		environmental_Halophage(100.0%)	1	NA	NA
AUU96682.1|3643408_3644800_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	95.2	1.4e-66
>prophage 253
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3658059	3659109	5403218		Tupanvirus(100.0%)	1	NA	NA
AUU96693.1|3658059_3659109_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	43.9	3.4e-73
>prophage 254
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3676244	3677408	5403218		Salmonella_phage(100.0%)	1	NA	NA
AUU96710.1|3676244_3677408_+	MFS transporter	NA	S4TR35	Salmonella_phage	26.9	4.5e-26
>prophage 255
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3695661	3696774	5403218		Bacillus_virus(100.0%)	1	NA	NA
AUU96728.1|3695661_3696774_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.5	1.5e-26
>prophage 256
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3708952	3716301	5403218		Micromonas_sp._RCC1109_virus(33.33%)	9	NA	NA
AUU96743.1|3708952_3710641_-	acetolactate synthase, large subunit, biosynthetic type	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	2.9e-58
AUU96744.1|3710745_3710841_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AUU96745.1|3711202_3712687_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AUU96746.1|3712686_3712938_-	hypothetical protein	NA	NA	NA	NA	NA
AUU96747.1|3712986_3713175_+	hypothetical protein	NA	NA	NA	NA	NA
AUU96748.1|3713412_3713502_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AUU96749.1|3713592_3714039_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUU96750.1|3714107_3714941_+	EamA family transporter	NA	NA	NA	NA	NA
AUU96751.1|3715116_3716301_+	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	25.2	1.1e-11
>prophage 257
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3727311	3729231	5403218		Morganella_phage(33.33%)	3	NA	NA
AUU96762.1|3727311_3728136_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	5.3e-90
AUU96763.1|3728272_3728701_-	heat shock chaperone IbpB	NA	A0A2H4N7P1	Lake_Baikal_phage	41.1	2.6e-16
AUU96764.1|3728817_3729231_-	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 258
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3732672	3733821	5403218		Oenococcus_phage(100.0%)	1	NA	NA
AUU96768.1|3732672_3733821_-	D-galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.7	4.7e-52
>prophage 259
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3739588	3747179	5403218		Bacillus_virus(33.33%)	7	NA	NA
AUU96775.1|3739588_3742003_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.3	8.2e-115
AUU96776.1|3742031_3743105_-	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
AUU96777.1|3743312_3744413_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.2	1.8e-53
AUU96778.1|3744417_3745821_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AUU96779.1|3746442_3746583_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
AUU96780.1|3746598_3746958_+	ribonuclease P protein component	NA	NA	NA	NA	NA
AUU96781.1|3746921_3747179_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	9.2e-17
>prophage 260
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3754599	3755937	5403218		Moraxella_phage(100.0%)	1	NA	NA
AUU96789.1|3754599_3755937_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.6	1.1e-63
>prophage 261
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3761713	3769273	5403218		Bacillus_phage(25.0%)	6	NA	NA
AUU96796.1|3761713_3762487_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.2	2.0e-14
AUU96797.1|3762534_3763425_-	phosphate ABC transporter, permease protein PstA	NA	NA	NA	NA	NA
AUU96798.1|3763424_3764384_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AUU96799.1|3764512_3765553_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.1	3.4e-49
AUU96800.1|3765889_3767719_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	41.4	1.9e-124
AUU96801.1|3767902_3769273_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.6	2.8e-35
>prophage 262
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3785781	3791660	5403218		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
AUU96817.1|3785781_3787650_+	low affinity potassium transport system protein kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	8.4e-67
AUU96818.1|3787835_3788255_+	D-ribose pyranase	NA	NA	NA	NA	NA
AUU96819.1|3788265_3789771_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.5	1.4e-19
AUU96820.1|3789776_3790742_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
AUU96821.1|3790769_3791660_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	3.3e-05
>prophage 263
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3806120	3808913	5403218		uncultured_virus(100.0%)	1	NA	NA
AUU96832.1|3806120_3808913_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.5	6.4e-71
>prophage 264
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3812801	3815269	5403218		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
AUU96837.1|3812801_3814211_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
AUU96838.1|3814219_3815269_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.0e-08
>prophage 265
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3822091	3823009	5403218		Pandoravirus(100.0%)	1	NA	NA
AUU96845.1|3822091_3823009_-	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	29.6	5.1e-17
>prophage 266
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3845980	3847492	5403218		Staphylococcus_phage(100.0%)	1	NA	NA
AUU96871.1|3845980_3847492_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	7.6e-18
>prophage 267
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3855791	3863238	5403218	transposase	Escherichia_phage(40.0%)	7	NA	NA
AUU96880.1|3855791_3856412_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	3.5e-62
AUU96881.1|3856484_3857159_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AUU96882.1|3857226_3858600_-	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
AUU96883.1|3858596_3859295_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
AUU96884.1|3859444_3859948_+	stress adaptor protein CpxP	NA	NA	NA	NA	NA
AUU96885.1|3861275_3862256_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
AUU96886.1|3863019_3863238_+	transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	93.1	8.3e-35
>prophage 268
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3867172	3868507	5403218		Erwinia_phage(100.0%)	1	NA	NA
AUU96890.1|3867172_3868507_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.5	2.1e-43
>prophage 269
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3885899	3886562	5403218		Cyanophage(100.0%)	1	NA	NA
AUU96906.1|3885899_3886562_-	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	6.0e-28
>prophage 270
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3901192	3903031	5403218		Acinetobacter_phage(100.0%)	1	NA	NA
AUU96919.1|3901192_3903031_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.2	1.7e-08
>prophage 271
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3913094	3914741	5403218		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AUU96925.1|3913094_3914741_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	3.1e-65
>prophage 272
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3922844	3924866	5403218		Bacillus_phage(100.0%)	1	NA	NA
AUU96934.1|3922844_3924866_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	1.4e-112
>prophage 273
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3929357	3931294	5403218		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
AUU96940.1|3929357_3930623_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.3	1.8e-41
AUU96941.1|3930964_3931294_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	39.6	2.5e-14
>prophage 274
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3935344	3941486	5403218		Catovirus(20.0%)	6	NA	NA
AUU96946.1|3935344_3936475_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.2	9.7e-26
AUU96947.1|3936471_3937734_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	25.9	3.8e-23
AUU96948.1|3937730_3938798_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	2.4e-98
AUU96949.1|3938816_3939698_+	glucose-1-phosphate thymidylyltransferase	NA	A0A291LA53	Escherichia_phage	67.4	4.6e-108
AUU96950.1|3939675_3940350_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AUU96951.1|3940355_3941486_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
>prophage 275
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3957768	3961613	5403218		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
AUU96966.1|3957768_3958671_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.4	5.9e-18
AUU96967.1|3958670_3959387_+	flavin mononucleotide phosphatase	NA	NA	NA	NA	NA
AUU96968.1|3959450_3961613_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	6.0e-117
>prophage 276
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3965449	3968911	5403218	transposase	Catovirus(50.0%)	3	NA	NA
AUU96974.1|3965449_3967276_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.6	1.3e-83
AUU96975.1|3967337_3967958_+	threonine export protein RhtC	NA	NA	NA	NA	NA
AUU96976.1|3968002_3968911_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	53.4	8.2e-68
>prophage 277
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3980912	3984256	5403218		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
AUU96988.1|3980912_3982553_+	ubiquinone biosynthesis protein UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	2.2e-39
AUU96989.1|3982682_3982934_+	Sec-independent protein translocase protein TatA	NA	NA	NA	NA	NA
AUU96990.1|3982937_3983474_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AUU96991.1|3983476_3984256_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.7	7.4e-25
>prophage 278
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3992973	3993588	5403218		Streptococcus_phage(100.0%)	1	NA	NA
AUU97000.1|3992973_3993588_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.5	2.8e-19
>prophage 279
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4003451	4006572	5403218		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AUU97006.1|4003451_4004402_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	2.7e-29
AUU97007.1|4005387_4006572_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
>prophage 280
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4010799	4023180	5403218		Chrysochromulina_ericina_virus(33.33%)	6	NA	NA
AUU97016.1|4010799_4014828_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.6	2.3e-21
AUU97017.1|4014904_4019128_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	9.1e-69
AUU97018.1|4019528_4020869_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
AUU97019.1|4020911_4021229_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AUU97020.1|4021232_4021538_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AUU98443.1|4021710_4023180_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.1	2.1e-12
>prophage 281
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4031668	4033432	5403218		Klosneuvirus(50.0%)	3	NA	NA
AUU97031.1|4031668_4032340_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.9	3.4e-18
AUU97032.1|4032382_4032973_+	DUF416 domain-containing protein	NA	NA	NA	NA	NA
AUU97033.1|4033159_4033432_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	9.4e-20
>prophage 282
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4038853	4040443	5403218		Prochlorococcus_phage(100.0%)	1	NA	NA
AUU97038.1|4038853_4040443_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.0	5.3e-70
>prophage 283
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4054154	4057838	5403218		Dickeya_phage(100.0%)	1	NA	NA
AUU97044.1|4054154_4057838_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 284
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4076552	4077662	5403218		Mycoplasma_phage(100.0%)	1	NA	NA
AUU97064.1|4076552_4077662_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	3.6e-17
>prophage 285
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4084728	4085337	5403218		Lactococcus_phage(100.0%)	1	NA	NA
AUU97071.1|4084728_4085337_+	LexA repressor	NA	Q9G0C2	Lactococcus_phage	40.7	4.6e-14
>prophage 286
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4091331	4093858	5403218		Escherichia_phage(50.0%)	2	NA	NA
AUU97079.1|4091331_4092747_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.8	5.7e-201
AUU97080.1|4092778_4093858_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	2.4e-26
>prophage 287
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4097039	4102346	5403218		uncultured_Mediterranean_phage(33.33%)	3	NA	NA
AUU97085.1|4097039_4099865_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
AUU97086.1|4100116_4100641_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	95.4	5.1e-54
AUU97087.1|4100765_4102346_-	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	6.3e-07
>prophage 288
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4105895	4106927	5403218		Bacillus_virus(100.0%)	1	NA	NA
AUU98448.1|4105895_4106927_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	2.3e-26
>prophage 289
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4114456	4115806	5403218		Moraxella_phage(100.0%)	1	NA	NA
AUU97100.1|4114456_4115806_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.1	1.5e-158
>prophage 290
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4119723	4120692	5403218	transposase	Salmonella_phage(100.0%)	1	NA	NA
AUU97104.1|4119723_4120692_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.9	4.5e-173
>prophage 291
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4127111	4129070	5403218		Staphylococcus_phage(100.0%)	1	NA	NA
AUU97110.1|4127111_4129070_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.3	2.3e-91
>prophage 292
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4134918	4137066	5403218		Escherichia_phage(100.0%)	1	NA	NA
AUU97115.1|4134918_4137066_-	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	24.3	2.0e-32
>prophage 293
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4143007	4144528	5403218		Staphylococcus_phage(100.0%)	1	NA	NA
AUU97122.1|4143007_4144528_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	2.2e-17
>prophage 294
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4149849	4151396	5403218		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
AUU97127.1|4149849_4150530_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.0	6.7e-06
AUU97128.1|4150637_4151396_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.7	6.7e-15
>prophage 295
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4156756	4158259	5403218		Burkholderia_virus(100.0%)	1	NA	NA
AUU97137.1|4156756_4158259_+	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.7	1.1e-56
>prophage 296
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4162623	4264271	5403218	plate,transposase,tRNA,tail,head	Vibrio_phage(54.17%)	108	NA	NA
AUU97142.1|4162623_4163580_+	recombinase	NA	A0A222YXF2	Escherichia_phage	78.0	1.6e-143
AUU97143.1|4163589_4163961_+	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	51.2	2.3e-21
AUU97144.1|4165501_4166584_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUU97145.1|4167532_4167838_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
AUU97146.1|4167837_4168755_-	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	42.2	2.8e-07
AUU97147.1|4168900_4169584_-	hypothetical protein	NA	W8EBD0	Pseudomonas_phage	42.2	3.9e-30
AUU98450.1|4169547_4169778_-	hypothetical protein	NA	NA	NA	NA	NA
AUU97148.1|4169809_4170595_+	DsbA family protein	NA	NA	NA	NA	NA
AUU97149.1|4170640_4171090_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
AUU97150.1|4171089_4172418_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
AUU98451.1|4172410_4174426_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
AUU97151.1|4176300_4176933_-	hypothetical protein	NA	A0A2I7S9A5	Vibrio_phage	30.1	3.6e-06
AUU97152.1|4177114_4177342_+	transcriptional regulator	NA	M1PVU4	Vibrio_phage	53.5	2.6e-15
AUU97153.1|4177344_4179423_+|transposase	transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	48.4	3.7e-172
AUU97154.1|4179458_4180406_+	DNA transposition protein	NA	A0A0C4UQR3	Shigella_phage	65.0	2.4e-110
AUU97155.1|4180411_4180747_+	hypothetical protein	NA	NA	NA	NA	NA
AUU97156.1|4180724_4180964_+	hypothetical protein	NA	NA	NA	NA	NA
AUU97157.1|4180966_4181254_+	HTH domain-containing protein	NA	C9DGL7	Escherichia_phage	48.3	3.5e-17
AUU97158.1|4181269_4181887_+	DUF3164 domain-containing protein	NA	A0A2I7S9B0	Vibrio_phage	59.4	5.8e-65
AUU98452.1|4181967_4182462_+	hypothetical protein	NA	NA	NA	NA	NA
AUU97159.1|4182454_4182754_+	hypothetical protein	NA	NA	NA	NA	NA
AUU97160.1|4182750_4182975_-	hypothetical protein	NA	NA	NA	NA	NA
AUU97161.1|4183044_4183599_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	47.8	1.3e-39
AUU97162.1|4183595_4183991_+	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	62.5	7.7e-39
AUU97163.1|4183994_4184507_+	hypothetical protein	NA	NA	NA	NA	NA
AUU97164.1|4184601_4185180_+	peptidoglycan-binding protein	NA	A0A2I7S9B9	Vibrio_phage	47.6	4.6e-40
AUU97165.1|4185182_4185401_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	70.8	1.3e-24
AUU97166.1|4185393_4185801_+	hypothetical protein	NA	NA	NA	NA	NA
AUU97167.1|4185788_4186394_+	hypothetical protein	NA	M4MB79	Vibrio_phage	40.3	6.3e-24
AUU97168.1|4186390_4186621_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AUU97169.1|4186601_4186904_+	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	42.6	4.3e-13
AUU97170.1|4186913_4187201_+	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	64.5	8.4e-27
AUU97171.1|4187203_4187479_+	hypothetical protein	NA	NA	NA	NA	NA
AUU97172.1|4187468_4188047_+	hypothetical protein	NA	M4MCR3	Vibrio_phage	57.9	4.4e-51
AUU97173.1|4188043_4189633_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	68.5	2.7e-199
AUU97174.1|4189632_4191204_+	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.2	6.0e-159
AUU97175.1|4191196_4192039_+	hypothetical protein	NA	M1PVV7	Vibrio_phage	56.9	1.7e-88
AUU97176.1|4192227_4193244_+	peptidase	NA	M1Q578	Vibrio_phage	49.7	8.6e-74
AUU97177.1|4193246_4194149_+|head	phage head protein	head	M4MB71	Vibrio_phage	60.9	3.0e-102
AUU97178.1|4194371_4194851_+	hypothetical protein	NA	NA	NA	NA	NA
AUU97179.1|4194850_4195291_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.3	4.1e-33
AUU97180.1|4195290_4195833_+	phage morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	64.2	1.7e-60
AUU97181.1|4195829_4196441_+	hypothetical protein	NA	M1PJ94	Vibrio_phage	39.3	5.0e-37
AUU97182.1|4196443_4196653_+	hypothetical protein	NA	NA	NA	NA	NA
AUU97183.1|4196654_4198136_+|tail	phage tail protein	tail	M1Q565	Vibrio_phage	59.8	2.4e-165
AUU97184.1|4198145_4198499_+|tail	phage tail protein	tail	NA	NA	NA	NA
AUU97185.1|4198502_4198886_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	46.2	5.1e-11
AUU97186.1|4198984_4200856_+|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	51.9	1.4e-122
AUU97187.1|4200852_4202112_+	multidrug DMT transporter	NA	M4M9N2	Vibrio_phage	42.2	1.7e-87
AUU97188.1|4202104_4203184_+|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	50.0	3.0e-93
AUU97189.1|4203174_4203714_+|plate	phage baseplate protein	plate	A0A2I7S9F6	Vibrio_phage	47.8	5.1e-33
AUU97190.1|4203710_4204163_+	hypothetical protein	NA	A0A2I7S9F0	Vibrio_phage	43.4	6.6e-26
AUU97191.1|4204149_4205226_+|plate	phage baseplate protein	plate	A0A2I7S9E5	Vibrio_phage	52.8	1.4e-103
AUU97192.1|4205210_4205795_+	hypothetical protein	NA	M4M9M8	Vibrio_phage	48.2	2.2e-45
AUU97193.1|4205797_4206550_+|tail	phage tail protein	tail	A9DEM1	Yersinia_phage	46.5	2.5e-30
AUU97194.1|4206549_4207425_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	43.1	2.2e-25
AUU97195.1|4209285_4209594_+	hypothetical protein	NA	NA	NA	NA	NA
AUU97196.1|4211157_4211724_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AUU97197.1|4212035_4212326_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AUU97198.1|4212288_4212477_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98453.1|4212697_4212919_+	hypothetical protein	NA	NA	NA	NA	NA
AUU97199.1|4213110_4215198_-	DUF1176 domain-containing protein	NA	NA	NA	NA	NA
AUU98454.1|4215265_4215841_-	transcriptional regulator	NA	NA	NA	NA	NA
AUU97200.1|4215876_4217673_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
AUU97201.1|4217648_4217972_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
AUU97202.1|4218096_4219398_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
AUU97203.1|4219513_4220950_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
AUU98455.1|4220974_4221133_+	peptidase	NA	NA	NA	NA	NA
AUU97204.1|4221272_4221764_+	membrane protein FxsA	NA	NA	NA	NA	NA
AUU97205.1|4221815_4223066_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
AUU97206.1|4223298_4223592_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	42.3	3.5e-12
AUU97207.1|4223629_4225276_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	9.0e-190
AUU97208.1|4225536_4225890_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
AUU97209.1|4226758_4227739_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
AUU97210.1|4228910_4230197_-	HlyD family secretion protein	NA	NA	NA	NA	NA
AUU97211.1|4230301_4230670_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98456.1|4230972_4231995_-	fimbrial protein	NA	NA	NA	NA	NA
AUU97212.1|4232020_4233001_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
AUU97213.1|4233229_4235773_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AUU97214.1|4235808_4236495_-	molecular chaperone	NA	NA	NA	NA	NA
AUU97215.1|4236553_4237117_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AUU97216.1|4237291_4238272_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
AUU97217.1|4238797_4239442_+	transcriptional regulator	NA	NA	NA	NA	NA
AUU97218.1|4239563_4240592_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
AUU97219.1|4240633_4241200_+	elongation factor P	NA	NA	NA	NA	NA
AUU97220.1|4241273_4241405_+	entericidin A	NA	NA	NA	NA	NA
AUU98457.1|4241564_4241711_+	entericidin EcnA/B family protein	NA	NA	NA	NA	NA
AUU97221.1|4241854_4242172_+	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
AUU97222.1|4242168_4242702_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	50.0	5.0e-41
AUU97223.1|4242815_4243175_-	fumarate reductase subunit D	NA	NA	NA	NA	NA
AUU97224.1|4243185_4243581_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
AUU97225.1|4243591_4244326_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AUU97226.1|4244318_4246109_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.2	3.8e-16
AUU97227.1|4246384_4247362_+	elongation factor P lysine(34) lysyltransferase	NA	A0A2K9KZX5	Tupanvirus	29.7	2.1e-29
AUU97228.1|4247545_4249048_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
AUU97229.1|4249085_4252415_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
AUU97230.1|4252438_4253401_-	phosphatidylserine decarboxylase proenzyme	NA	NA	NA	NA	NA
AUU97231.1|4253561_4254623_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
AUU97232.1|4254569_4254686_+	hypothetical protein	NA	NA	NA	NA	NA
AUU97233.1|4254717_4255263_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	42.1	1.2e-29
AUU97234.1|4255306_4256038_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUU97235.1|4256062_4256263_+	hypothetical protein	NA	NA	NA	NA	NA
AUU97236.1|4256970_4258110_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AUU97237.1|4258108_4259635_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AUU97238.1|4259627_4260089_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AUU97239.1|4260105_4261458_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	3.1e-18
AUU97240.1|4261468_4263328_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.8	2.2e-59
AUU97241.1|4263320_4264271_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 297
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4269259	4273603	5403218		Pithovirus(50.0%)	3	NA	NA
AUU97247.1|4269259_4270558_+	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
AUU97248.1|4270708_4271134_+	transcriptional regulator	NA	NA	NA	NA	NA
AUU97249.1|4271170_4273603_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.7	1.9e-66
>prophage 298
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4293200	4294025	5403218		Bordetella_phage(100.0%)	1	NA	NA
AUU97274.1|4293200_4294025_-	AraC family transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	42.0	1.9e-07
>prophage 299
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4308282	4314795	5403218		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
AUU97287.1|4308282_4308813_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	2.7e-55
AUU97288.1|4309216_4310173_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUU97289.1|4310296_4311799_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	7.6e-10
AUU97290.1|4311809_4312769_+	ABC transporter permease	NA	NA	NA	NA	NA
AUU97291.1|4312755_4313754_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
AUU97292.1|4313796_4314795_-	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	1.3e-69
>prophage 300
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4330924	4334145	5403218		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
AUU97310.1|4330924_4331209_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	58.5	3.5e-25
AUU97311.1|4331212_4331677_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	59.5	5.0e-53
AUU97312.1|4332006_4334145_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.0	9.1e-267
>prophage 301
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4341902	4347960	5403218		Enterobacteria_phage(33.33%)	6	NA	NA
AUU97318.1|4341902_4342850_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.6	8.7e-12
AUU98460.1|4342886_4343084_+	hypothetical protein	NA	NA	NA	NA	NA
AUU97319.1|4343229_4345938_+	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	26.5	5.3e-46
AUU97320.1|4346010_4346397_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
AUU97321.1|4346549_4347011_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AUU97322.1|4347024_4347960_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	1.3e-52
>prophage 302
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4352119	4361169	5403218	tRNA	Klosneuvirus(33.33%)	7	NA	NA
AUU97329.1|4352119_4354975_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.5	6.0e-141
AUU97330.1|4354974_4355418_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AUU97331.1|4355537_4357049_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	9.2e-48
AUU97332.1|4357329_4357449_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AUU97333.1|4357438_4358536_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AUU97334.1|4358535_4359618_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AUU97335.1|4359666_4361169_-	ATP-binding protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	1.8e-83
>prophage 303
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4375513	4380336	5403218		Bacillus_virus(50.0%)	5	NA	NA
AUU97347.1|4375513_4376584_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	4.0e-29
AUU97348.1|4376589_4377414_-	phosphodiesterase	NA	NA	NA	NA	NA
AUU97349.1|4377424_4378312_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AUU98461.1|4378301_4379174_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUU97350.1|4379316_4380336_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.7	1.9e-44
>prophage 304
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4383486	4384758	5403218		Enterobacteria_phage(100.0%)	1	NA	NA
AUU97353.1|4383486_4384758_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	39.1	6.3e-82
>prophage 305
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4388599	4390240	5403218		Acidithiobacillus_phage(100.0%)	1	NA	NA
AUU97359.1|4388599_4390240_-	restriction endonuclease	NA	K4I1H4	Acidithiobacillus_phage	28.7	2.1e-21
>prophage 306
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4394904	4397741	5403218		Staphylococcus_phage(100.0%)	2	NA	NA
AUU97363.1|4394904_4396134_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	26.1	7.1e-22
AUU97364.1|4396133_4397741_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	55.4	4.0e-158
>prophage 307
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4409456	4409927	5403218		Pseudomonas_phage(100.0%)	1	NA	NA
AUU97374.1|4409456_4409927_+	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	34.6	3.6e-11
>prophage 308
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4414357	4415468	5403218	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
AUU98465.1|4414357_4415468_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	30.4	3.4e-07
>prophage 309
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4441933	4446891	5403218		Enterobacteria_phage(33.33%)	4	NA	NA
AUU97403.1|4441933_4442662_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	47.4	1.4e-46
AUU97404.1|4442778_4443312_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	59.6	8.2e-52
AUU97405.1|4443321_4443669_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
AUU97406.1|4443741_4446891_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.6	3.7e-59
>prophage 310
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4450129	4452236	5403218		Bacillus_phage(50.0%)	2	NA	NA
AUU97411.1|4450129_4450813_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	7.9e-31
AUU97412.1|4450802_4452236_+	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.2	2.7e-12
>prophage 311
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4461993	4464738	5403218		Staphylococcus_phage(100.0%)	1	NA	NA
AUU97418.1|4461993_4464738_-	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	6.0e-21
>prophage 312
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4468653	4470138	5403218		Bacillus_virus(100.0%)	1	NA	NA
AUU97421.1|4468653_4470138_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	1.1e-13
>prophage 313
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4485724	4486651	5403218	transposase	Sodalis_phage(100.0%)	1	NA	NA
AUU97440.1|4485724_4486651_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	51.2	3.9e-73
>prophage 314
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4493144	4494125	5403218	transposase	Escherichia_phage(100.0%)	1	NA	NA
AUU97446.1|4493144_4494125_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
>prophage 315
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4519112	4525913	5403218	transposase	Escherichia_phage(33.33%)	8	NA	NA
AUU97471.1|4519112_4520093_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
AUU97472.1|4520206_4520623_+	PTS sugar transporter	NA	NA	NA	NA	NA
AUU97473.1|4520637_4521108_+	PTS mannose/fructose/sorbose transporter subunit IIB	NA	NA	NA	NA	NA
AUU97474.1|4521124_4521904_+	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
AUU98469.1|4521893_4522733_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AUU97475.1|4522745_4523807_+	SIS domain-containing protein	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	23.1	1.5e-07
AUU97476.1|4523803_4524835_+	SIS domain-containing protein	NA	NA	NA	NA	NA
AUU98470.1|4524974_4525913_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	53.4	3.4e-69
>prophage 316
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4529073	4530353	5403218		Shigella_phage(50.0%)	2	NA	NA
AUU97479.1|4529073_4529811_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.7	1.2e-64
AUU97480.1|4529813_4530353_-	primosomal protein 1	NA	T1SA92	Salmonella_phage	62.8	2.4e-27
>prophage 317
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4543576	4546297	5403218		Streptococcus_phage(50.0%)	3	NA	NA
AUU97496.1|4543576_4545166_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.9	5.3e-30
AUU97497.1|4545385_4546006_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
AUU97498.1|4546135_4546297_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	67.9	1.2e-11
>prophage 318
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4551032	4552355	5403218		Geobacillus_virus(100.0%)	1	NA	NA
AUU97502.1|4551032_4552355_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.9	2.0e-78
>prophage 319
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4558686	4563846	5403218		Enterococcus_phage(33.33%)	3	NA	NA
AUU97509.1|4558686_4559919_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.3	1.3e-87
AUU97510.1|4560012_4561680_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.8	2.9e-42
AUU98473.1|4561908_4563846_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	2.7e-12
>prophage 320
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4581002	4581956	5403218		Cyanophage(100.0%)	1	NA	NA
AUU97528.1|4581002_4581956_+	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	1.3e-10
>prophage 321
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4586351	4596305	5403218	tRNA	Chrysochromulina_ericina_virus(25.0%)	8	NA	NA
AUU97534.1|4586351_4588268_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
AUU97535.1|4588355_4589489_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	1.2e-28
AUU98476.1|4589667_4590843_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.4	3.8e-89
AUU97536.1|4590897_4591794_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
AUU97537.1|4591913_4592177_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUU98477.1|4592296_4592491_-	hypothetical protein	NA	NA	NA	NA	NA
AUU97538.1|4592506_4593445_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
AUU98478.1|4593488_4596305_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 322
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4602871	4604020	5403218		Halovirus(100.0%)	1	NA	NA
AUU97548.1|4602871_4604020_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.1	9.1e-48
>prophage 323
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4610503	4612422	5403218		Bacillus_phage(50.0%)	3	NA	NA
AUU97553.1|4610503_4610983_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.2e-28
AUU97554.1|4611082_4611337_+	hypothetical protein	NA	NA	NA	NA	NA
AUU97555.1|4611573_4612422_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	48.4	3.4e-07
>prophage 324
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4624880	4630332	5403218		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AUU97568.1|4624880_4627787_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.9	4.9e-21
AUU97569.1|4627974_4630332_-	DNA polymerase II	NA	X5FTI3	Fish_lymphocystis_disease_virus	23.7	2.3e-13
>prophage 325
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4636628	4637330	5403218		Bacillus_virus(100.0%)	1	NA	NA
AUU97575.1|4636628_4637330_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	36.2	8.1e-23
>prophage 326
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4646029	4646785	5403218		Streptococcus_phage(100.0%)	1	NA	NA
AUU97583.1|4646029_4646785_-	3-dehydroquinase	NA	W6LP76	Streptococcus_phage	36.5	4.2e-25
>prophage 327
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4656462	4659715	5403218	transposase	Escherichia_phage(50.0%)	4	NA	NA
AUU97592.1|4656462_4657443_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
AUU97593.1|4657441_4657645_+	hypothetical protein	NA	NA	NA	NA	NA
AUU97594.1|4657800_4657992_-	hypothetical protein	NA	NA	NA	NA	NA
AUU97595.1|4657990_4659715_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.8	3.3e-33
>prophage 328
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4685908	4686952	5403218		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AUU97621.1|4685908_4686952_+	guanosine monophosphate reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.9	4.1e-103
>prophage 329
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4691219	4691783	5403218		Sphingobium_phage(100.0%)	1	NA	NA
AUU97626.1|4691219_4691783_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.4	4.1e-09
>prophage 330
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4703123	4704548	5403218		Erysipelothrix_phage(100.0%)	1	NA	NA
AUU97634.1|4703123_4704548_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	2.1e-41
>prophage 331
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4716122	4722781	5403218		Mamastrovirus(33.33%)	5	NA	NA
AUU97646.1|4716122_4717733_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	51.1	7.6e-16
AUU97647.1|4717816_4720207_-	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
AUU97648.1|4720411_4720948_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.8	3.9e-17
AUU97649.1|4721007_4721670_-	carbonate dehydratase	NA	NA	NA	NA	NA
AUU97650.1|4721854_4722781_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.4	1.8e-22
>prophage 332
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4728183	4734954	5403218	tRNA	unidentified_phage(50.0%)	6	NA	NA
AUU97658.1|4728183_4729578_-	polynucleotide adenylyltransferase	NA	H7BUW3	unidentified_phage	36.9	1.6e-25
AUU97659.1|4729640_4730522_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AUU97660.1|4730581_4731037_-	RNA polymerase-binding transcription factor	NA	NA	NA	NA	NA
AUU97661.1|4731199_4731916_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AUU97662.1|4731915_4732452_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AUU97663.1|4732524_4734954_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	1.5e-39
>prophage 333
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4759911	4760709	5403218		Planktothrix_phage(100.0%)	1	NA	NA
AUU97682.1|4759911_4760709_+	iron-hydroxamate transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	27.4	9.2e-15
>prophage 334
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4766675	4767020	5403218		Lake_Baikal_phage(100.0%)	1	NA	NA
AUU97687.1|4766675_4767020_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.2e-27
>prophage 335
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4770975	4772409	5403218	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AUU97692.1|4770975_4772409_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	3.9e-24
>prophage 336
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4783986	4784745	5403218		Flavobacterium_phage(100.0%)	1	NA	NA
AUU97703.1|4783986_4784745_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	6.1e-24
>prophage 337
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4793576	4797676	5403218		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
AUU97712.1|4793576_4794176_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.6	1.6e-27
AUU97713.1|4794193_4797676_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.5	3.1e-208
>prophage 338
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4810659	4811691	5403218		Planktothrix_phage(100.0%)	1	NA	NA
AUU97726.1|4810659_4811691_-	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	9.4e-36
>prophage 339
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4818270	4819074	5403218		Indivirus(100.0%)	1	NA	NA
AUU97728.1|4818270_4819074_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	9.2e-39
>prophage 340
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4823139	4827349	5403218		Lactobacillus_phage(33.33%)	5	NA	NA
AUU97732.1|4823139_4824507_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	29.1	4.0e-10
AUU97733.1|4824578_4825334_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AUU97734.1|4825366_4826089_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUU97735.1|4826085_4826553_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	56.6	8.0e-51
AUU97736.1|4826617_4827349_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	36.9	7.1e-38
>prophage 341
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4832857	4833439	5403218		Caulobacter_phage(100.0%)	1	NA	NA
AUU97741.1|4832857_4833439_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	29.8	2.2e-13
>prophage 342
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4850612	4851896	5403218		Klosneuvirus(100.0%)	1	NA	NA
AUU97760.1|4850612_4851896_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.6	2.2e-34
>prophage 343
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4859429	4860425	5403218		Catovirus(100.0%)	1	NA	NA
AUU97767.1|4859429_4860425_-	oxidoreductase	NA	A0A1V0SBV6	Catovirus	29.9	4.1e-28
>prophage 344
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4865075	4866473	5403218		Erysipelothrix_phage(100.0%)	1	NA	NA
AUU97774.1|4865075_4866473_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.5	2.2e-43
>prophage 345
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4879681	4885466	5403218		Streptococcus_phage(50.0%)	4	NA	NA
AUU97782.1|4879681_4881052_-	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	33.8	5.1e-05
AUU97783.1|4881756_4883010_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.4	2.6e-96
AUU97784.1|4883020_4884124_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
AUU97785.1|4884413_4885466_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	57.9	1.4e-111
>prophage 346
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4891743	4892586	5403218		Planktothrix_phage(100.0%)	1	NA	NA
AUU97794.1|4891743_4892586_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.2	4.7e-17
>prophage 347
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4901660	4905382	5403218		Planktothrix_phage(66.67%)	5	NA	NA
AUU97802.1|4901660_4902479_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	3.1e-34
AUU97803.1|4902480_4903290_-	cysteine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUU97804.1|4903624_4903795_+	hypothetical protein	NA	NA	NA	NA	NA
AUU97805.1|4903911_4904607_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.7	3.2e-11
AUU97806.1|4904599_4905382_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	8.8e-10
>prophage 348
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4916368	4917136	5403218		Planktothrix_phage(100.0%)	1	NA	NA
AUU97816.1|4916368_4917136_+	taurine transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	4.3e-25
>prophage 349
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4938227	4946747	5403218		Bacillus_phage(60.0%)	6	NA	NA
AUU97838.1|4938227_4939139_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	5.5e-104
AUU97839.1|4939230_4940145_+	fructokinase	NA	NA	NA	NA	NA
AUU97840.1|4940218_4943356_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	24.9	1.0e-08
AUU97841.1|4943352_4944558_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	35.5	1.8e-06
AUU97842.1|4944740_4945430_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.6	3.7e-36
AUU97843.1|4945451_4946747_+	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.0	2.2e-26
>prophage 350
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4959589	4960570	5403218	transposase	Escherichia_phage(100.0%)	1	NA	NA
AUU97853.1|4959589_4960570_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
>prophage 351
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4964180	4968519	5403218	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
AUU97858.1|4964180_4965308_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	1.6e-89
AUU97859.1|4965330_4965663_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	4.9e-10
AUU97860.1|4965689_4967537_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
AUU97861.1|4967547_4968519_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.1	3.6e-45
>prophage 352
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4972118	4976778	5403218		Indivirus(33.33%)	6	NA	NA
AUU97867.1|4972118_4973222_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	1.1e-50
AUU97868.1|4973309_4973780_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
AUU97869.1|4973799_4974219_+	N utilization substance protein B	NA	NA	NA	NA	NA
AUU97870.1|4974290_4975262_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
AUU97871.1|4975254_4975758_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
AUU97872.1|4975803_4976778_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	21.2	7.1e-09
>prophage 353
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4989581	4991261	5403218		Lactobacillus_phage(100.0%)	1	NA	NA
AUU97885.1|4989581_4991261_-	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	25.4	1.2e-16
>prophage 354
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5005567	5010736	5403218	protease	Agrobacterium_phage(25.0%)	4	NA	NA
AUU97901.1|5005567_5006191_+	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	3.8e-64
AUU97902.1|5006441_5007716_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	7.3e-131
AUU97903.1|5007899_5010254_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	2.7e-224
AUU97904.1|5010463_5010736_+	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
>prophage 355
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5013966	5014668	5403218		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AUU97908.1|5013966_5014668_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.1e-88
>prophage 356
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5019095	5022639	5403218		Bacillus_phage(100.0%)	2	NA	NA
AUU97913.1|5019095_5020868_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	3.7e-48
AUU97914.1|5020860_5022639_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	6.0e-38
>prophage 357
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5028708	5034363	5403218		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
AUU97922.1|5028708_5029662_+	hypothetical protein	NA	A0A1B1ITH5	uncultured_Mediterranean_phage	28.3	4.8e-26
AUU97923.1|5029913_5031041_-	hypothetical protein	NA	NA	NA	NA	NA
AUU97924.1|5031061_5032270_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0ZCT8	Stx2-converting_phage	45.6	1.2e-21
AUU97925.1|5032259_5032538_-	hypothetical protein	NA	NA	NA	NA	NA
AUU97926.1|5032890_5033472_+	hypothetical protein	NA	NA	NA	NA	NA
AUU97927.1|5033799_5034363_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.2	2.2e-23
>prophage 358
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5044307	5045417	5403218		Planktothrix_phage(100.0%)	1	NA	NA
AUU97938.1|5044307_5045417_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.5	1.1e-26
>prophage 359
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5054591	5063982	5403218		Enterobacteria_phage(33.33%)	10	NA	NA
AUU97946.1|5054591_5055662_+	lac repressor	NA	C6ZCU4	Enterobacteria_phage	42.8	6.1e-70
AUU97947.1|5055777_5056041_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
AUU97948.1|5056040_5056181_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
AUU97949.1|5056177_5056876_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUU97950.1|5056976_5058428_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	4.6e-12
AUU97951.1|5058402_5058873_-	hypothetical protein	NA	NA	NA	NA	NA
AUU97952.1|5059005_5059572_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
AUU97953.1|5059730_5059949_-	transcriptional regulator	NA	NA	NA	NA	NA
AUU97954.1|5059975_5060350_-	Hha toxicity attenuator	NA	NA	NA	NA	NA
AUU97955.1|5060835_5063982_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.7	1.1e-47
>prophage 360
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5071791	5077320	5403218		Klosneuvirus(33.33%)	5	NA	NA
AUU97962.1|5071791_5072343_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	3.9e-28
AUU97963.1|5072435_5074343_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	37.4	3.0e-43
AUU97964.1|5074396_5074729_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AUU97965.1|5074728_5075334_+	recombination protein RecR	NA	NA	NA	NA	NA
AUU97966.1|5075445_5077320_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	3.7e-115
>prophage 361
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5087440	5158368	5403218	holin,integrase,protease,terminase,transposase,tRNA,tail,head	Cronobacter_phage(19.67%)	94	5103365:5103424	5157368:5158416
AUU98493.1|5087440_5089942_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	3.6e-113
AUU97975.1|5090048_5090459_+	HTH-type transcriptional regulator CueR	NA	NA	NA	NA	NA
AUU97976.1|5090455_5090914_-	NfeD family protein	NA	NA	NA	NA	NA
AUU97977.1|5090910_5091828_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
AUU97978.1|5091968_5092646_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.0	1.3e-22
AUU97979.1|5092632_5093415_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AUU97980.1|5093522_5094377_-	co-chaperone YbbN	NA	NA	NA	NA	NA
AUU97981.1|5094435_5095206_-	oxidoreductase	NA	NA	NA	NA	NA
AUU97982.1|5095234_5095861_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
AUU97983.1|5095828_5096515_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.6e-31
AUU97984.1|5096511_5098926_+	ABC transporter permease	NA	NA	NA	NA	NA
AUU97985.1|5099107_5100253_+	porin	NA	NA	NA	NA	NA
AUU97986.1|5100360_5101437_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AUU97987.1|5101548_5102616_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AUU97988.1|5102612_5103122_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AUU97989.1|5103054_5103222_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
5103365:5103424	attL	GGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATCACGTATCCTCCCG	NA	NA	NA	NA
AUU97990.1|5103396_5104365_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.1	8.8e-177
AUU97991.1|5104683_5105709_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUU97992.1|5106104_5106827_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AUU97993.1|5106830_5107325_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUU97994.1|5107500_5108886_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
AUU97995.1|5108931_5109144_-	ribosome-associated protein	NA	NA	NA	NA	NA
AUU97996.1|5109145_5110012_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
AUU97997.1|5110050_5110374_+	hypothetical protein	NA	NA	NA	NA	NA
AUU97998.1|5110443_5111607_-|integrase	integrase	integrase	G8C7S0	Escherichia_phage	86.8	2.5e-202
AUU97999.1|5111483_5111819_-	DNA-binding protein	NA	NA	NA	NA	NA
AUU98000.1|5111820_5112039_-	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	50.7	3.8e-11
AUU98001.1|5112035_5112227_-	hypothetical protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	6.0e-13
AUU98002.1|5112223_5112448_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	73.2	1.6e-20
AUU98003.1|5112663_5113320_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.0	3.5e-113
AUU98004.1|5113316_5113745_-	regulator	NA	M9NYX4	Enterobacteria_phage	80.3	1.3e-63
AUU98005.1|5113741_5114422_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	92.9	1.8e-123
AUU98006.1|5114418_5115264_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	9.0e-69
AUU98007.1|5115279_5115564_-	hypothetical protein	NA	G8C7T1	Escherichia_phage	79.8	3.8e-40
AUU98008.1|5115571_5116540_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	77.7	1.7e-39
AUU98009.1|5116543_5117062_-	hypothetical protein	NA	A0A1W6DY33	Salmonella_phage	44.7	3.7e-33
AUU98010.1|5117120_5117327_-	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	2.4e-31
AUU98011.1|5117950_5118583_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	39.5	4.6e-33
AUU98012.1|5118682_5118898_+	XRE family transcriptional regulator	NA	Q716D6	Shigella_phage	60.9	4.2e-15
AUU98013.1|5118947_5119268_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	67.9	4.2e-35
AUU98494.1|5119417_5120374_+	phage replication protein	NA	H6WRX7	Salmonella_phage	64.0	4.3e-59
AUU98014.1|5120373_5120964_+	phosphohydrolase	NA	I3PUZ9	Vibrio_phage	40.5	9.2e-36
AUU98015.1|5120963_5121257_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
AUU98016.1|5121253_5121760_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	34.5	2.4e-08
AUU98017.1|5121756_5122017_+	DUF4752 domain-containing protein	NA	T1S9K2	Salmonella_phage	76.8	7.4e-30
AUU98018.1|5122123_5122624_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98019.1|5122620_5122800_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98495.1|5123060_5123699_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.6	3.8e-51
AUU98020.1|5123691_5123997_+	hypothetical protein	NA	Q7Y3Y0	Yersinia_phage	43.4	5.1e-14
AUU98021.1|5124154_5124751_+	hypothetical protein	NA	A0A0U2RT94	Escherichia_phage	54.3	1.2e-56
AUU98022.1|5124959_5125250_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	89.6	1.8e-45
AUU98023.1|5125246_5125609_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	82.4	9.5e-52
AUU98024.1|5125742_5126432_+	antiterminator	NA	I6PDF8	Cronobacter_phage	57.1	5.5e-64
AUU98025.1|5127159_5127471_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.5e-48
AUU98026.1|5127467_5128007_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	99.4	6.7e-102
AUU98027.1|5128003_5128348_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	79.8	4.4e-38
AUU98028.1|5128344_5128620_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
AUU98029.1|5128570_5128765_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	98.4	5.5e-30
AUU98030.1|5129575_5129812_-	ATP-dependent RNA helicase HrpA	NA	NA	NA	NA	NA
AUU98031.1|5129859_5130069_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AUU98032.1|5130096_5130612_+|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	74.7	7.4e-66
AUU98033.1|5130611_5132084_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.3	3.4e-249
AUU98034.1|5132096_5133518_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	5.6e-148
AUU98035.1|5133492_5134497_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.8	1.2e-112
AUU98036.1|5134538_5135015_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98037.1|5135087_5136467_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	52.7	3.0e-130
AUU98038.1|5136466_5136901_+	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	47.8	2.2e-26
AUU98039.1|5136912_5137944_+	encapsulating for peroxidase	NA	A0A0M3LQZ1	Mannheimia_phage	52.6	6.2e-96
AUU98040.1|5137983_5138271_+	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	75.6	1.4e-13
AUU98041.1|5138273_5138654_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	4.1e-29
AUU98042.1|5138653_5138824_+	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	50.0	3.4e-12
AUU98043.1|5138827_5139211_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98044.1|5139207_5139570_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	47.5	3.7e-19
AUU98045.1|5139572_5139998_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
AUU98046.1|5139994_5140387_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.9	3.3e-34
AUU98047.1|5140455_5141208_+	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	41.8	1.3e-42
AUU98048.1|5141260_5141938_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.5	1.8e-72
AUU98049.1|5142113_5142869_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	52.2	9.5e-62
AUU98050.1|5142871_5143126_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	69.7	3.9e-20
AUU98496.1|5143200_5143539_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98497.1|5143546_5143867_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98051.1|5143918_5144107_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98498.1|5144330_5144543_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98052.1|5144660_5145164_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98053.1|5145256_5148697_+	hypothetical protein	NA	Q5G8W8	Enterobacteria_phage	44.3	5.2e-147
AUU98499.1|5148796_5149216_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.8	1.8e-30
AUU98054.1|5149215_5149686_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	37.0	1.3e-24
AUU98055.1|5149682_5150078_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	53.6	1.4e-35
AUU98056.1|5150064_5152536_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	45.2	9.7e-204
AUU98057.1|5152622_5154878_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	45.3	1.9e-97
AUU98500.1|5155024_5155645_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98058.1|5155832_5157053_+|transposase	ISL3-like element ISCfr12 family transposase	transposase	NA	NA	NA	NA
AUU98059.1|5157113_5157398_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98060.1|5157399_5158368_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.1	8.8e-177
5157368:5158416	attR	GGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATCACGTATCCTCCCGACAACACAGACCATTCCGTGGCAAAGCAAAAGTTCAGAATCACCAACTGGTCCACCTACAACAAAGCTCTCATCAACCGTGGCTCCCTCACTTTCTGGCTGGATGATGAGGCGATTCAGGCCTGGTATGAGTCGGCAACGCCTTCATCACGAGGAAGGCCCCAGCGCTATTCTGATCTCGCCATCACCACCGTTCTGGTGATTAAACGCGTATTCCGGCTGACCCTGCGGGCTGCGCAGGGTTTTATTGATTCCATTTTTGCCCTGATGAACGTTCCGTTGCGCTGCCCGGATTACACCAGTGTCAGTAAGCGGGCAAAGTCGGTTAATGTCAGTTTCAAAACGTCCACCCGGGGTGAAATCGCACACCTGGTGATTGATTCCACCGGGCTGAAGGTCTTTGGTGAAGGCGAATGGAAAGTCAGAAAGCACGGCAAAGAGCGCCGTCGTATCTGGCGAAAGTTGCATCTTGCTGTTGACAGCAACACACATGAAGTTGTCTGTGCAGACCTGTCGCTGAATAACGTCACGGACTCAGAAGCCTTCCCGGGTCTTATCCGGCAGACTCACAGAAAAATCAGGGCAGCATCGGCAGACGGCGCTTACGACACCCGGCTCTGTCACGATGAACTGCGGCGTAAGAAAATCAGCGCGCTTATCCCTCCCCGAAAAGGTGCGGGTTACTGGCCCGGTGAATATGCAGACCGTAACCGTGCAGTGGCTAATCAGCGAATGACCGGGAGTAATGCGCGGTGGAAATGGACAACAGATTACAACCGTCGCTCGATAGCGGAAACGGCGATGTACCGGGTAAAACAGCTGTTCGGGGGTTCACTGACGCTGCGTGACTACGATGGTCAGGTTGCGGAGGCTATGGCCCTGGTACGAGCGCTGAACAAAATGACGAAAGCAGGTATGCCTGAAAGCGTGCGTATTGCCTGAAAACACAACCCGCTACGGGGGAGACTTACCCGAAATCTGATTTATTCA	NA	NA	NA	NA
>prophage 362
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5164163	5165084	5403218		Morganella_phage(100.0%)	1	NA	NA
AUU98067.1|5164163_5165084_+	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
>prophage 363
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5171307	5174632	5403218	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
AUU98072.1|5171307_5172783_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
AUU98073.1|5173114_5174632_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
>prophage 364
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5183152	5188954	5403218		Staphylococcus_phage(50.0%)	5	NA	NA
AUU98082.1|5183152_5184637_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.7e-14
AUU98083.1|5184647_5185679_+	ABC transporter permease	NA	NA	NA	NA	NA
AUU98084.1|5185862_5186504_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98501.1|5186519_5187524_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUU98085.1|5187553_5188954_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	24.7	8.6e-16
>prophage 365
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5195579	5196377	5403218		Bacillus_virus(100.0%)	1	NA	NA
AUU98091.1|5195579_5196377_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	3.5e-14
>prophage 366
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5215122	5216987	5403218		Tupanvirus(33.33%)	3	NA	NA
AUU98107.1|5215122_5216238_+	class II histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	32.7	1.5e-39
AUU98108.1|5216321_5216624_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	44.0	2.2e-17
AUU98503.1|5216627_5216987_+	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	90.7	1.2e-57
>prophage 367
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5243839	5246554	5403218		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AUU98134.1|5243839_5246554_+	carbonate dehydratase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.0	1.0e-65
>prophage 368
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5255507	5264180	5403218		Planktothrix_phage(75.0%)	9	NA	NA
AUU98141.1|5255507_5256971_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	6.2e-17
AUU98142.1|5257212_5258064_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUU98143.1|5258111_5258753_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUU98144.1|5258767_5259433_+	ABC transporter permease	NA	NA	NA	NA	NA
AUU98145.1|5259425_5260187_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	1.3e-29
AUU98146.1|5260240_5261005_-	KR domain-containing protein	NA	NA	NA	NA	NA
AUU98147.1|5261185_5262523_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AUU98148.1|5262652_5263357_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	2.3e-25
AUU98149.1|5263343_5264180_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	9.1e-13
>prophage 369
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5268737	5274651	5403218	holin	Catovirus(50.0%)	5	NA	NA
AUU98154.1|5268737_5270402_-|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	6.1e-61
AUU98155.1|5270415_5271888_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUU98156.1|5271901_5272489_-	transcriptional regulator	NA	NA	NA	NA	NA
AUU98505.1|5272405_5272621_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98157.1|5272617_5274651_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.7	5.8e-21
>prophage 370
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5281354	5282899	5403218		Staphylococcus_phage(100.0%)	1	NA	NA
AUU98165.1|5281354_5282899_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	4.6e-18
>prophage 371
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5294293	5299034	5403218		Tupanvirus(50.0%)	2	NA	NA
AUU98176.1|5294293_5298175_+	enterobactin synthase subunit F	NA	A0A2K9KZV5	Tupanvirus	27.8	1.5e-54
AUU98177.1|5298239_5299034_-	iron-enterobactin transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	25.7	1.5e-09
>prophage 372
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5311491	5315912	5403218		Burkholderia_phage(50.0%)	5	NA	NA
AUU98187.1|5311491_5311896_-	XRE family transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	33.3	1.0e-06
AUU98188.1|5311870_5312173_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUU98189.1|5312356_5313100_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
AUU98190.1|5313157_5314246_-	oxidoreductase	NA	NA	NA	NA	NA
AUU98191.1|5314409_5315912_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	8.4e-17
>prophage 373
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5332988	5346703	5403218	tRNA	Cedratvirus(20.0%)	12	NA	NA
AUU98205.1|5332988_5334017_+	dihydrofolate reductase	NA	A0A2R8FCS0	Cedratvirus	34.0	7.2e-28
AUU98206.1|5334059_5335001_-	sugar kinase	NA	NA	NA	NA	NA
AUU98207.1|5335012_5336017_-	ABC transporter permease	NA	NA	NA	NA	NA
AUU98208.1|5336013_5337003_-	ABC transporter permease	NA	NA	NA	NA	NA
AUU98209.1|5336999_5338550_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	1.5e-16
AUU98210.1|5338546_5339527_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUU98211.1|5339935_5342245_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit C	tRNA	A0A077SK27	Escherichia_phage	33.6	1.0e-82
AUU98212.1|5342352_5342895_-	acireductone dioxygenase	NA	NA	NA	NA	NA
AUU98213.1|5342891_5343581_-	acireductone synthase	NA	NA	NA	NA	NA
AUU98214.1|5343707_5344868_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AUU98215.1|5344868_5345495_-	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	48.2	1.1e-52
AUU98216.1|5345479_5346703_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.1	2.4e-62
>prophage 374
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5349838	5351909	5403218		Bacillus_virus(50.0%)	2	NA	NA
AUU98220.1|5349838_5351404_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	6.4e-44
AUU98221.1|5351480_5351909_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.0	7.4e-19
>prophage 375
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5355999	5356660	5403218		Morganella_phage(50.0%)	2	NA	NA
AUU98226.1|5355999_5356209_+	cold-shock protein CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	1.2e-22
AUU98227.1|5356276_5356660_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	8.9e-24
>prophage 376
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5361538	5364025	5403218		Stx2-converting_phage(50.0%)	2	NA	NA
AUU98234.1|5361538_5362738_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.0	6.5e-105
AUU98235.1|5362876_5364025_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.1e-08
>prophage 377
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5371069	5377050	5403218	tRNA,transposase	Staphylococcus_phage(33.33%)	4	NA	NA
AUU98244.1|5371069_5373652_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	1.0e-184
AUU98511.1|5373878_5374361_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98245.1|5375066_5376047_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
AUU98246.1|5376324_5377050_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	1.2e-29
>prophage 378
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5383054	5384101	5403218		Pseudomonas_phage(100.0%)	1	NA	NA
AUU98252.1|5383054_5384101_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	3.2e-47
>prophage 379
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5388141	5389806	5403218		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AUU98256.1|5388141_5389806_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.7	7.2e-86
>prophage 380
CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5394559	5398361	5403218	tRNA	Vibrio_phage(50.0%)	2	NA	NA
AUU98262.1|5394559_5396515_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	6.4e-09
AUU98263.1|5396693_5398361_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	93.5	0.0e+00
>prophage 1
CP026179	Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence	237571	0	44104	237571	transposase	uncultured_Caudovirales_phage(33.33%)	43	NA	NA
AUU98513.1|2631_2922_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AUU98514.1|2918_3320_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AUU98515.1|3309_3666_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AUU98516.1|3920_4247_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98517.1|4243_4744_+|transposase	transposase	transposase	NA	NA	NA	NA
AUU98518.1|4740_5112_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98519.1|5105_5663_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
AUU98520.1|5741_6746_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AUU98521.1|7409_7838_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
AUU98522.1|7887_9171_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
AUU98523.1|9266_9620_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
AUU98524.1|10103_11582_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
AUU98525.1|11600_12428_+	universal stress protein	NA	NA	NA	NA	NA
AUU98526.1|12499_13696_-	MFS transporter	NA	NA	NA	NA	NA
AUU98527.1|14224_14599_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
AUU98528.1|14873_16022_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
AUU98529.1|16674_17379_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUU98530.1|17610_18168_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
AUU98744.1|18401_18956_+	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
AUU98531.1|19025_19814_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AUU98532.1|19873_20698_+	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
AUU98533.1|21397_22258_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AUU98534.1|23730_24186_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUU98535.1|24257_24608_+	mercuric transporter	NA	NA	NA	NA	NA
AUU98536.1|24623_24899_+	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AUU98537.1|24926_25334_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AUU98538.1|25372_27055_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-38
AUU98539.1|27072_27438_+	transcriptional regulator	NA	NA	NA	NA	NA
AUU98540.1|27434_27671_+	mercury resistance protein	NA	NA	NA	NA	NA
AUU98745.1|27654_27774_-	mercury resistance protein	NA	NA	NA	NA	NA
AUU98541.1|27736_27949_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AUU98542.1|28078_28636_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AUU98543.1|28638_31611_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AUU98544.1|32159_32375_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98545.1|32293_33130_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AUU98546.1|33129_33933_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AUU98547.1|33993_34809_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AUU98548.1|35138_35315_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AUU98549.1|35496_36501_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AUU98550.1|38044_38749_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUU98551.1|39225_39930_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUU98552.1|40502_40868_-	FipA	NA	NA	NA	NA	NA
AUU98553.1|40867_44104_-	conjugative relaxase	NA	U5J9B0	Bacillus_phage	27.3	2.4e-05
>prophage 2
CP026179	Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence	237571	55818	122721	237571	integrase,transposase	Escherichia_phage(18.52%)	59	57165:57179	104876:104890
AUU98568.1|55818_56259_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
AUU98569.1|56246_57512_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	53.8	2.2e-119
57165:57179	attL	GCAACCGAAAAACTG	NA	NA	NA	NA
AUU98748.1|57662_58454_+	sprT domain-containing protein	NA	NA	NA	NA	NA
AUU98570.1|58468_58810_-	ArdK family transcriptional regulator	NA	NA	NA	NA	NA
AUU98571.1|59369_60089_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
AUU98572.1|60695_61694_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98573.1|62045_62615_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
AUU98574.1|62754_63069_-|transposase	transposase	transposase	NA	NA	NA	NA
AUU98575.1|63007_64021_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUU98576.1|64167_64650_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	6.6e-16
AUU98577.1|64870_65137_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AUU98578.1|65279_66044_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AUU98579.1|66085_66298_+	resolvase	NA	NA	NA	NA	NA
AUU98580.1|66310_67519_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AUU98749.1|67552_68968_-	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	6.9e-106
AUU98581.1|69003_71901_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AUU98582.1|71995_72601_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AUU98583.1|72914_74234_+|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AUU98584.1|74483_75365_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AUU98585.1|75889_76594_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUU98586.1|77271_77916_+	quinolone resistance pentapeptide repeat protein QnrB19	NA	NA	NA	NA	NA
AUU98587.1|77924_78242_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98588.1|78405_79668_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AUU98589.1|81453_82215_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AUU98590.1|82235_83096_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AUU98591.1|83059_83242_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98592.1|83232_83937_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUU98593.1|84225_84783_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	47.2	8.4e-39
AUU98594.1|89038_89239_-	glycogen synthesis protein GlgS	NA	NA	NA	NA	NA
AUU98595.1|89539_90508_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
AUU98596.1|90880_93073_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
AUU98597.1|93202_94486_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
AUU98598.1|94574_96008_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
AUU98599.1|96026_98474_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	69.2	6.1e-25
AUU98600.1|98587_100231_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	25.0	1.5e-22
AUU98601.1|100355_100922_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AUU98602.1|101256_101535_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98603.1|101774_103172_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUU98604.1|103360_103756_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUU98750.1|103804_105151_-|transposase	transposase	transposase	NA	NA	NA	NA
104876:104890	attR	CAGTTTTTCGGTTGC	NA	NA	NA	NA
AUU98605.1|105376_106009_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98606.1|106037_107441_-|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
AUU98607.1|107552_109085_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
AUU98608.1|109243_109726_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUU98609.1|109713_109980_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AUU98610.1|110424_110655_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98611.1|110668_110872_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AUU98612.1|110932_111424_-	DNA-binding protein	NA	NA	NA	NA	NA
AUU98613.1|111557_112769_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98614.1|112765_113014_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98615.1|113371_113722_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.1e-23
AUU98616.1|113773_114136_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AUU98617.1|114153_115905_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AUU98618.1|115952_117242_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.8	3.3e-171
AUU98619.1|117254_117680_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.1	6.6e-52
AUU98620.1|117712_118141_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUU98621.1|118262_119261_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98622.1|119579_120656_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUU98623.1|121197_122721_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
>prophage 3
CP026179	Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence	237571	128472	129021	237571		Wolbachia_phage(100.0%)	1	NA	NA
AUU98632.1|128472_129021_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	30.8	6.6e-20
>prophage 4
CP026179	Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence	237571	158054	164355	237571		Hokovirus(25.0%)	8	NA	NA
AUU98658.1|158054_159773_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	24.5	7.6e-22
AUU98752.1|159801_160062_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98753.1|160645_161086_+	lytic transglycosylase	NA	A0A0K2QQJ4	Ralstonia_phage	37.5	4.6e-08
AUU98659.1|161128_161446_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98660.1|161506_161815_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98661.1|161874_162696_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.4	3.0e-45
AUU98662.1|162798_163017_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98663.1|163521_164355_-	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	34.7	5.3e-21
>prophage 5
CP026179	Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence	237571	170242	175016	237571		Emiliania_huxleyi_virus(33.33%)	6	NA	NA
AUU98674.1|170242_172252_-	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	27.7	2.0e-26
AUU98675.1|172320_172563_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AUU98676.1|172610_173123_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	84.7	8.5e-54
AUU98755.1|173360_173621_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98677.1|174052_174265_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98678.1|174452_175016_-	SAM-dependent methyltransferase	NA	A0A2I7RHK4	Vibrio_phage	34.3	9.7e-19
>prophage 6
CP026179	Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence	237571	181393	193241	237571	integrase	Macacine_betaherpesvirus(33.33%)	12	180676:180689	194663:194676
180676:180689	attL	TTCATTTTTCATCG	NA	NA	NA	NA
AUU98687.1|181393_182095_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	1.2e-26
AUU98688.1|183006_183261_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98689.1|183263_185303_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	25.3	1.3e-25
AUU98690.1|185299_186286_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98691.1|187169_187562_-	plasmid stability protein	NA	NA	NA	NA	NA
AUU98692.1|187565_188540_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	44.2	1.5e-70
AUU98693.1|188779_189154_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98694.1|189153_189786_-	hypothetical protein	NA	A0A0K1LMB9	Rhodobacter_phage	39.6	1.8e-29
AUU98695.1|190211_190448_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98696.1|190778_191534_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	2.0e-136
AUU98697.1|192075_192438_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98698.1|192455_193241_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.4	1.9e-52
194663:194676	attR	TTCATTTTTCATCG	NA	NA	NA	NA
>prophage 7
CP026179	Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence	237571	198814	200923	237571		Bacillus_phage(100.0%)	1	NA	NA
AUU98705.1|198814_200923_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.1	3.2e-38
>prophage 8
CP026179	Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence	237571	207118	214119	237571	transposase	Bacillus_phage(50.0%)	7	NA	NA
AUU98712.1|207118_208087_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.1	8.8e-177
AUU98713.1|208130_209153_+	DNA helicase UvrD	NA	NA	NA	NA	NA
AUU98757.1|209696_210605_+	HNH endonuclease	NA	NA	NA	NA	NA
AUU98714.1|210790_211141_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	6.0e-19
AUU98715.1|211288_211720_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AUU98716.1|211970_213446_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AUU98717.1|213438_214119_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
>prophage 9
CP026179	Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence	237571	217492	224749	237571		Leptospira_phage(33.33%)	5	NA	NA
AUU98721.1|217492_220639_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
AUU98722.1|220725_221166_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98723.1|221292_223740_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	4.4e-84
AUU98724.1|223780_223978_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AUU98725.1|224011_224749_-	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
>prophage 10
CP026179	Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence	237571	229842	231920	237571		Bacillus_phage(100.0%)	2	NA	NA
AUU98731.1|229842_230523_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AUU98732.1|230519_231920_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	2.4e-18
>prophage 1
CP026182	Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-0c4e, complete sequence	61178	6287	15916	61178	integrase	Escherichia_phage(42.86%)	10	1163:1176	11923:11936
1163:1176	attL	TTCTTCAGGCGTTA	NA	NA	NA	NA
AUU98977.1|6287_7070_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
AUU98978.1|7127_7385_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98979.1|8152_9019_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AUU98980.1|9375_9645_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98981.1|10059_11265_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
AUU98982.1|11261_12239_+	chromosome partitioning protein ParB	NA	Q38420	Escherichia_phage	54.4	2.6e-88
11923:11936	attR	TAACGCCTGAAGAA	NA	NA	NA	NA
AUU98983.1|12320_13592_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
AUU98984.1|13591_14023_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
AUU98985.1|14180_14432_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98986.1|14431_15916_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	9.1e-32
>prophage 1
CP026186	Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence	373179	12301	41150	373179	protease,transposase	Cronobacter_phage(33.33%)	22	NA	NA
AUU99161.1|12301_15163_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	41.3	1.2e-128
AUU99162.1|15260_15833_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AUU99163.1|16248_16512_-	hypothetical protein	NA	NA	NA	NA	NA
AUU99164.1|17068_18691_-|transposase	transposase	transposase	NA	NA	NA	NA
AUU99165.1|20187_21798_-	ATP-binding protein	NA	NA	NA	NA	NA
AUU99480.1|21790_23851_-|transposase	transposase	transposase	NA	NA	NA	NA
AUU99166.1|23864_24692_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
AUU99481.1|26640_26775_-	pilus assembly protein	NA	A0A2L1IV26	Escherichia_phage	100.0	2.6e-07
AUU99167.1|26750_27089_+	hypothetical protein	NA	NA	NA	NA	NA
AUU99168.1|27185_27446_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AUU99169.1|27502_29566_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
AUU99170.1|29648_30068_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AUU99171.1|30434_31457_+|transposase	IS110 family transposase IS5708	transposase	NA	NA	NA	NA
AUU99172.1|31791_32796_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AUU99173.1|33142_33421_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AUU99174.1|33514_33727_-	hypothetical protein	NA	NA	NA	NA	NA
AUU99175.1|34468_34672_+	hypothetical protein	NA	NA	NA	NA	NA
AUU99176.1|34701_35016_+	hypothetical protein	NA	NA	NA	NA	NA
AUU99177.1|35258_35711_-	hypothetical protein	NA	NA	NA	NA	NA
AUU99178.1|36212_37148_-|protease	outer membrane protease PgtE	protease	NA	NA	NA	NA
AUU99179.1|38902_39241_-	hypothetical protein	NA	NA	NA	NA	NA
AUU99180.1|40029_41150_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	3.9e-51
>prophage 2
CP026186	Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence	373179	104454	131357	373179	transposase	Salmonella_phage(28.57%)	24	NA	NA
AUU99239.1|104454_105423_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	6.5e-172
AUU99240.1|105541_106093_+	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
AUU99241.1|106089_107049_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AUU99242.1|107179_108562_-	carbohydrate porin	NA	NA	NA	NA	NA
AUU99243.1|108793_108976_-	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
AUU99244.1|109032_110286_-	MFS transporter	NA	NA	NA	NA	NA
AUU99245.1|110337_113412_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
AUU99246.1|113533_114616_-	lac repressor	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
AUU99247.1|114838_115054_+	hypothetical protein	NA	NA	NA	NA	NA
AUU99248.1|115076_116087_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AUU99249.1|116496_117519_+|transposase	IS110 family transposase IS5708	transposase	NA	NA	NA	NA
AUU99250.1|117853_118858_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AUU99483.1|119155_119398_+	hypothetical protein	NA	NA	NA	NA	NA
AUU99251.1|119728_120022_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
AUU99252.1|120120_120888_-	ferric citrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
AUU99253.1|120888_121845_-	iron-dicitrate transporter subunit FecD	NA	NA	NA	NA	NA
AUU99254.1|121841_122840_-	iron-dicitrate transporter permease subunit	NA	NA	NA	NA	NA
AUU99255.1|122836_123739_-	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AUU99256.1|123783_126108_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUU99257.1|126193_127147_-	FecR family protein	NA	NA	NA	NA	NA
AUU99258.1|127143_127665_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUU99259.1|128222_129044_+|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	94.7	3.6e-147
AUU99260.1|129045_130014_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	3.8e-172
AUU99261.1|130331_131357_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP026186	Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence	373179	167613	174805	373179		Burkholderia_phage(33.33%)	11	NA	NA
AUU99292.1|167613_168192_+	HNH endonuclease	NA	W0LI46	Edwardsiella_phage	57.6	1.2e-40
AUU99293.1|168182_168497_-	hypothetical protein	NA	NA	NA	NA	NA
AUU99487.1|168621_169032_+	DNA-binding protein	NA	Q71TH9	Escherichia_phage	60.0	1.0e-41
AUU99294.1|169216_169576_-	hypothetical protein	NA	NA	NA	NA	NA
AUU99295.1|169806_170250_+	hypothetical protein	NA	NA	NA	NA	NA
AUU99296.1|170291_170495_+	hypothetical protein	NA	NA	NA	NA	NA
AUU99488.1|170503_170764_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	41.0	5.9e-11
AUU99297.1|170796_171231_+	hypothetical protein	NA	NA	NA	NA	NA
AUU99298.1|171227_171971_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	49.6	1.8e-60
AUU99299.1|172097_173513_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	4.1e-106
AUU99300.1|173602_174805_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.1	1.1e-35
>prophage 4
CP026186	Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence	373179	197571	239354	373179	tail,transposase,bacteriocin	Salmonella_phage(20.0%)	51	NA	NA
AUU99322.1|197571_197892_+	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.2e-28
AUU99323.1|197972_198287_+	hypothetical protein	NA	NA	NA	NA	NA
AUU99324.1|198407_198659_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
AUU99325.1|198824_199043_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
AUU99326.1|199135_199633_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	67.1	2.0e-23
AUU99327.1|199629_199818_+	hypothetical protein	NA	NA	NA	NA	NA
AUU99328.1|199810_200032_+	hypothetical protein	NA	NA	NA	NA	NA
AUU99329.1|200296_200524_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.5e-10
AUU99330.1|200520_201165_+	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	39.8	2.4e-05
AUU99331.1|201165_201489_+	hypothetical protein	NA	E5AGF3	Erwinia_phage	46.9	1.6e-13
AUU99332.1|201581_201968_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
AUU99333.1|202247_202463_+	hypothetical protein	NA	NA	NA	NA	NA
AUU99492.1|204118_204313_+	hypothetical protein	NA	NA	NA	NA	NA
AUU99334.1|204904_205177_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	48.9	1.5e-12
AUU99335.1|205457_205745_+	hypothetical protein	NA	NA	NA	NA	NA
AUU99336.1|206198_206723_+	hypothetical protein	NA	NA	NA	NA	NA
AUU99337.1|206786_207554_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	62.7	3.5e-43
AUU99338.1|207810_207996_+	hypothetical protein	NA	A0A1V0E5M0	Salmonella_phage	67.4	1.6e-10
AUU99339.1|208005_208455_+|tail	phage tail protein	tail	A0A1I9KFG8	Aeromonas_phage	34.5	1.1e-12
AUU99340.1|208524_209133_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	42.2	1.5e-25
AUU99341.1|209420_209876_+	hypothetical protein	NA	NA	NA	NA	NA
AUU99342.1|210759_212001_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	28.9	6.7e-12
AUU99343.1|212075_212258_+	hypothetical protein	NA	NA	NA	NA	NA
AUU99344.1|212448_212844_+	hypothetical protein	NA	NA	NA	NA	NA
AUU99345.1|212853_213261_+	hypothetical protein	NA	NA	NA	NA	NA
AUU99346.1|213290_213701_+	hypothetical protein	NA	NA	NA	NA	NA
AUU99347.1|214071_215076_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AUU99348.1|215652_216066_+	NB-ARC domain protein	NA	NA	NA	NA	NA
AUU99349.1|216128_216920_+	hypothetical protein	NA	NA	NA	NA	NA
AUU99350.1|216922_217489_+	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
AUU99351.1|217491_219366_+	helicase	NA	A0A127AW80	Bacillus_phage	27.1	5.2e-08
AUU99352.1|219359_220067_+	hypothetical protein	NA	NA	NA	NA	NA
AUU99353.1|220311_221103_+	CRISPR-associated protein Csf2	NA	NA	NA	NA	NA
AUU99354.1|221303_221600_+	hypothetical protein	NA	NA	NA	NA	NA
AUU99355.1|221813_223298_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AUU99356.1|223297_223549_-	hypothetical protein	NA	NA	NA	NA	NA
AUU99357.1|223708_224131_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	49.3	6.3e-31
AUU99358.1|224361_224910_+	3'-5' exonuclease	NA	A0A2K9L1H6	Tupanvirus	27.8	1.9e-06
AUU99359.1|225980_226541_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
AUU99360.1|226544_227273_-	protein McbF	NA	A0A2H4PQG7	Staphylococcus_phage	25.8	6.3e-10
AUU99361.1|227269_227995_-	protein mcbE	NA	NA	NA	NA	NA
AUU99362.1|228004_229192_-	microcin B17 processing protein McbC	NA	NA	NA	NA	NA
AUU99363.1|229184_229991_-	microcin B17-processing protein McbC	NA	NA	NA	NA	NA
AUU99364.1|229992_230847_-	McbB family protein	NA	NA	NA	NA	NA
AUU99365.1|230905_231115_-|bacteriocin	bacteriocin microcin	bacteriocin	NA	NA	NA	NA
AUU99366.1|233242_233686_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
AUU99367.1|233682_234153_+	RES domain-containing protein	NA	NA	NA	NA	NA
AUU99368.1|234262_234523_-	hypothetical protein	NA	NA	NA	NA	NA
AUU99369.1|235084_236266_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUU99370.1|236406_237939_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
AUU99371.1|238013_239354_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
CP026181	Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence	94405	0	11791	94405	transposase	Morganella_phage(14.29%)	16	NA	NA
AUU98850.1|791_1217_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	54.7	4.9e-31
AUU98851.1|1313_2534_+|transposase	ISL3-like element ISCfr12 family transposase	transposase	NA	NA	NA	NA
AUU98852.1|2748_2979_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98853.1|3415_4117_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	34.3	2.6e-21
AUU98854.1|4116_4338_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98855.1|4383_4794_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AUU98955.1|4840_5605_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98954.1|6037_6466_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.9	2.2e-10
AUU98956.1|6510_7017_+	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.9	6.9e-08
AUU98856.1|7057_7249_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98857.1|7449_7713_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	53.8	3.4e-14
AUU98858.1|7737_8058_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98859.1|8006_8213_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98860.1|8866_9424_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.0	1.1e-49
AUU98861.1|9473_9722_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AUU98862.1|9790_11791_+	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	28.4	3.3e-21
>prophage 2
CP026181	Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence	94405	16422	18365	94405		Klebsiella_phage(50.0%)	4	NA	NA
AUU98870.1|16422_16761_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	54.1	1.6e-21
AUU98871.1|16816_17164_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98872.1|17254_17485_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98873.1|17531_18365_+	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	34.8	3.7e-22
>prophage 3
CP026181	Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence	94405	43179	86584	94405	tail,transposase,head	Salmonella_phage(23.08%)	38	NA	NA
AUU98911.1|43179_44256_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUU98958.1|44543_47195_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AUU98959.1|48434_48821_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98912.1|48939_51252_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
AUU98913.1|52997_53189_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AUU98914.1|53322_53496_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AUU98915.1|53492_53810_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98916.1|53793_54129_+	hypothetical protein	NA	M4MCT3	Vibrio_phage	38.3	9.6e-06
AUU98960.1|54273_54462_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98917.1|54442_55171_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98918.1|55170_55584_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98919.1|55695_56514_+	hypothetical protein	NA	A0A219VH76	Ochrobactrum_phage	49.4	1.3e-35
AUU98920.1|56506_57406_+|head	head protein	head	A0A0A1IWZ9	Pseudomonas_phage	38.6	1.3e-62
AUU98921.1|57454_59251_+|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	29.8	6.0e-62
AUU98961.1|60113_63332_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
AUU98922.1|63412_64138_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.3	1.2e-05
AUU98923.1|64209_64803_+	conjugal transfer protein	NA	NA	NA	NA	NA
AUU98924.1|64969_65566_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98925.1|65615_66260_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98926.1|66315_66966_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AUU98927.1|66962_67271_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.9e-08
AUU98962.1|67374_67917_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	34.6	9.4e-19
AUU98963.1|68343_68421_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
AUU98928.1|68413_69433_+	replication initiation protein	NA	NA	NA	NA	NA
AUU98929.1|70675_71239_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98930.1|71222_71834_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98931.1|72401_75299_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
AUU98932.1|75393_75999_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	7.2e-20
AUU98933.1|76216_76852_+	peptidase	NA	NA	NA	NA	NA
AUU98934.1|76987_77983_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.9	4.1e-20
AUU98935.1|78711_79410_+	NYN domain-containing protein	NA	NA	NA	NA	NA
AUU98936.1|80345_83318_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AUU98937.1|83320_83878_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AUU98938.1|84007_84220_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AUU98964.1|84182_84302_+	mercury resistance protein	NA	NA	NA	NA	NA
AUU98939.1|84285_84522_-	mercury resistance protein	NA	NA	NA	NA	NA
AUU98940.1|84518_84884_-	transcriptional regulator	NA	NA	NA	NA	NA
AUU98941.1|84901_86584_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-38
>prophage 4
CP026181	Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence	94405	89629	93288	94405	transposase	Sodalis_phage(33.33%)	4	NA	NA
AUU98948.1|89629_90583_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	57.1	9.5e-75
AUU98949.1|90703_90970_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98950.1|90989_91610_-	serine recombinase	NA	A0A219Y912	Aeromonas_phage	31.0	1.0e-08
AUU98951.1|92646_93288_+	ParA family protein	NA	A4JWV7	Burkholderia_virus	25.5	1.1e-05
>prophage 1
CP026180	Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence	97198	0	67412	97198	transposase	Salmonella_phage(22.73%)	56	NA	NA
AUU98758.1|848_1079_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98759.1|1141_1813_-	Mediator of plasmid stability	NA	NA	NA	NA	NA
AUU98760.1|1815_2787_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AUU98761.1|3035_4520_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
AUU98762.1|4519_4771_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98763.1|4925_5351_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
AUU98764.1|5350_6622_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.0	8.6e-156
AUU98765.1|6700_6952_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AUU98766.1|7005_7311_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98767.1|7336_7594_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98768.1|8464_9436_-	plasmid-partitioning protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	9.2e-150
AUU98769.1|9435_10602_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
AUU98770.1|11352_12363_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
AUU98771.1|13060_13801_-	recombinase	NA	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AUU98772.1|13867_15088_-|transposase	ISL3-like element ISCfr12 family transposase	transposase	NA	NA	NA	NA
AUU98773.1|16080_17157_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUU98774.1|17698_19222_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AUU98775.1|19515_19953_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98776.1|20536_20800_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98777.1|20921_21170_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AUU98778.1|22258_22924_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUU98779.1|23150_24176_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUU98780.1|24536_25358_+|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	94.7	3.6e-147
AUU98781.1|25359_26328_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	3.8e-172
AUU98782.1|26854_27292_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98783.1|27585_29109_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AUU98784.1|29650_30727_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUU98785.1|31314_32151_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AUU98786.1|32215_32614_-	VOC family protein	NA	NA	NA	NA	NA
AUU98787.1|32657_33767_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.3	4.9e-30
AUU98788.1|33801_34077_-	regulator protein FrmR	NA	NA	NA	NA	NA
AUU98789.1|35498_36068_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
AUU98790.1|36313_37522_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AUU98791.1|38852_39833_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
AUU98792.1|39979_40621_-	restriction endonuclease	NA	NA	NA	NA	NA
AUU98793.1|40676_40988_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98794.1|41023_41338_-	IncN plasmid KikA protein	NA	NA	NA	NA	NA
AUU98795.1|41681_42287_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AUU98796.1|42381_45279_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
AUU98797.1|45616_46354_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AUU98798.1|46627_47596_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	5.0e-180
AUU98799.1|47958_48981_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUU98800.1|50326_50743_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98801.1|50883_51807_+|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.1	2.4e-171
AUU98802.1|51954_52782_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98803.1|52783_54265_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98804.1|55179_55368_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98805.1|55671_56529_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AUU98846.1|56521_56599_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
AUU98806.1|56814_57093_-	replication protein	NA	NA	NA	NA	NA
AUU98847.1|57413_57965_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	6.2e-18
AUU98807.1|59197_61240_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AUU98808.1|61232_62684_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AUU98809.1|63543_64299_-	M48 family peptidase	NA	NA	NA	NA	NA
AUU98810.1|65123_66149_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUU98811.1|66443_67412_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.8	3.1e-182
>prophage 2
CP026180	Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence	97198	72831	90065	97198	transposase	Bacillus_phage(25.0%)	17	NA	NA
AUU98818.1|72831_74364_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
AUU98819.1|74493_75567_+|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
AUU98820.1|75645_76626_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
AUU98848.1|77097_79221_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98821.1|79585_80626_-	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	35.2	9.5e-20
AUU98822.1|81105_82188_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUU98823.1|82392_82983_-	hypothetical protein	NA	A0A1B1P773	Bacillus_phage	45.9	3.3e-41
AUU98824.1|83039_83549_-|transposase	IS3 family transposase	transposase	A0A2I6AZV8	Macacine_betaherpesvirus	58.7	6.9e-48
AUU98825.1|83749_84124_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98826.1|84179_84506_-	theronine dehydrogenase	NA	NA	NA	NA	NA
AUU98827.1|84502_85231_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AUU98828.1|85227_85659_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AUU98829.1|85703_87761_-	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	2.6e-21
AUU98830.1|87830_88079_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AUU98831.1|88127_88670_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	4.6e-50
AUU98849.1|88907_89168_+	hypothetical protein	NA	NA	NA	NA	NA
AUU98832.1|89501_90065_-	SAM-dependent methyltransferase	NA	A0A2I7RHK4	Vibrio_phage	34.3	4.4e-19
>prophage 3
CP026180	Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence	97198	93103	94286	97198		Pectobacterium_phage(50.0%)	3	NA	NA
AUU98838.1|93103_93358_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.8	4.0e-12
AUU98839.1|93545_93737_-	hypothetical protein	NA	NA	NA	NA	NA
AUU98840.1|93779_94286_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	32.2	5.3e-08
