The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	122495	133382	5616605		Escherichia_phage(87.5%)	9	NA	NA
AUV36033.1|122495_125603_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AUV36034.1|125657_126923_+	MFS transporter	NA	NA	NA	NA	NA
AUV36035.1|126953_128042_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AUV36036.1|128128_128389_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
AUV36037.1|128686_129547_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
AUV36038.1|129567_130329_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AUV36039.1|130589_131492_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	100.0	5.3e-160
AUV36040.1|131503_132769_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	100.0	2.7e-234
AUV36041.1|132761_133382_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 2
CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	336985	435535	5616605	plate,tail,capsid,protease,portal,transposase,holin,terminase,head,tRNA	Klebsiella_phage(58.82%)	104	NA	NA
AUV36227.1|336985_337921_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
AUV36228.1|337966_339340_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	6.6e-53
AUV36229.1|339354_339549_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36230.1|339865_340849_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AUV41146.1|341127_341871_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	7.8e-16
AUV36231.1|341887_342952_+	oxidoreductase	NA	NA	NA	NA	NA
AUV36232.1|343188_343383_+	hypothetical protein	NA	NA	NA	NA	NA
AUV36233.1|343495_344242_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36234.1|344492_345872_-	amino acid permease	NA	NA	NA	NA	NA
AUV36235.1|346206_346686_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUV36236.1|346937_347552_+	YitT family protein	NA	NA	NA	NA	NA
AUV36237.1|347590_348790_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AUV36238.1|348818_349487_-	ABC transporter permease	NA	NA	NA	NA	NA
AUV41147.1|349479_350493_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	1.7e-29
AUV36239.1|350501_351308_-	methionine-binding protein	NA	NA	NA	NA	NA
AUV36240.1|351528_352704_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AUV36241.1|352750_353785_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AUV36242.1|354477_355389_-	NmrA/HSCARG family protein	NA	NA	NA	NA	NA
AUV36243.1|355381_356248_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AUV36244.1|356338_357262_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUV36245.1|357281_358187_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUV36246.1|358326_359256_+	aromatic alcohol reductase	NA	NA	NA	NA	NA
AUV36247.1|359281_359488_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AUV36248.1|359538_360417_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUV36249.1|360575_361331_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUV36250.1|361335_361929_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUV36251.1|362002_362716_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUV36252.1|362782_363277_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36253.1|363403_363946_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AUV36254.1|363923_365009_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AUV36255.1|364972_366727_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AUV36256.1|366803_367274_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36257.1|367270_368326_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36258.1|368356_369955_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AUV36259.1|369954_373410_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AUV36260.1|373406_374615_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36261.1|374954_375179_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36262.1|376063_377162_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	7.4e-47
AUV36263.1|377354_377876_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36264.1|380865_381228_-	hypothetical protein	NA	NA	NA	NA	NA
AUV41148.1|381622_381898_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36265.1|382031_383243_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36266.1|383235_385755_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.8	1.1e-16
AUV36267.1|388665_389157_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUV36268.1|389161_390868_-	OmpA family protein	NA	NA	NA	NA	NA
AUV36269.1|390864_391554_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AUV41149.1|391550_392891_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AUV36270.1|392903_394448_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AUV36271.1|394490_394982_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AUV36272.1|395827_396076_+	damage-inducible protein DinI	NA	S5MQI1	Escherichia_phage	70.4	1.0e-25
AUV36273.1|396483_396906_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
AUV36274.1|396983_397166_-	Hin recombinase	NA	A0A286S1P7	Klebsiella_phage	87.0	2.6e-18
AUV36275.1|397177_397978_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36276.1|400027_403096_-	kinase	NA	A0A286S259	Klebsiella_phage	97.1	0.0e+00
AUV36277.1|403092_403473_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	98.4	6.7e-72
AUV36278.1|403482_403965_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	98.8	6.0e-86
AUV36279.1|403951_404431_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
AUV36280.1|404430_406878_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	66.5	5.9e-278
AUV36281.1|406922_407390_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36282.1|407455_407719_-|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	98.8	5.9e-43
AUV36283.1|407751_408105_-|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
AUV36284.1|408148_408640_-|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
AUV36285.1|408695_409061_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
AUV36286.1|409057_409597_-	hypothetical protein	NA	A0A286S249	Klebsiella_phage	99.4	3.0e-94
AUV36287.1|409589_409922_-|head,tail	head-tail adaptor protein	head,tail	A0A286S2A2	Klebsiella_phage	100.0	3.1e-57
AUV36288.1|409923_410121_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
AUV36289.1|410181_410508_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	100.0	7.5e-56
AUV36290.1|410734_411898_-|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.5	2.9e-211
AUV36291.1|411909_412590_-|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
AUV36292.1|412595_413873_-|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
AUV36293.1|413875_415408_-|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
AUV36294.1|415417_415852_-	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
AUV36295.1|415973_416183_-	serine acetyltransferase	NA	A0A286N2R4	Klebsiella_phage	84.1	2.4e-23
AUV36296.1|416195_416486_-	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	2.9e-51
AUV36297.1|416556_416763_-	DUF551 domain-containing protein	NA	A0A286N2R2	Klebsiella_phage	97.1	1.1e-33
AUV36298.1|416843_417080_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	94.9	1.6e-31
AUV36299.1|417211_417472_+	hypothetical protein	NA	NA	NA	NA	NA
AUV36300.1|417404_417677_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36301.1|417809_418094_+	hypothetical protein	NA	NA	NA	NA	NA
AUV36302.1|418184_418379_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	85.9	1.5e-24
AUV36303.1|418329_418605_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	41.6	9.9e-09
AUV36304.1|418612_419242_-	endolysin	NA	G8C7W0	Escherichia_phage	90.9	6.9e-106
AUV36305.1|419241_419523_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
AUV36306.1|419509_419905_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
AUV36307.1|420467_420914_+	hypothetical protein	NA	NA	NA	NA	NA
AUV36308.1|421228_422011_-	antitermination protein	NA	F1C595	Cronobacter_phage	79.1	6.5e-114
AUV36309.1|422007_422970_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	98.8	3.1e-182
AUV36310.1|422971_424630_-	ATP-dependent helicase	NA	A0A286N2P9	Klebsiella_phage	97.5	0.0e+00
AUV36311.1|424671_425040_-	hypothetical protein	NA	A0A286S263	Klebsiella_phage	82.8	6.7e-53
AUV36312.1|425301_425586_-	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	70.2	1.1e-31
AUV36313.1|425710_425944_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	63.9	4.9e-17
AUV36314.1|426084_426759_+	helix-turn-helix transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	78.6	8.7e-99
AUV36315.1|426922_427336_+	hypothetical protein	NA	NA	NA	NA	NA
AUV36316.1|427518_427743_+	hypothetical protein	NA	NA	NA	NA	NA
AUV36317.1|427743_428109_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
AUV36318.1|428101_428356_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	91.7	6.1e-37
AUV36319.1|428542_428968_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.2	7.8e-53
AUV36320.1|428964_429159_+	hypothetical protein	NA	NA	NA	NA	NA
AUV36321.1|429155_429983_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.4	3.2e-111
AUV36322.1|430727_430919_+	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	75.4	2.3e-20
AUV36323.1|430899_432081_-	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	84.5	7.4e-202
AUV36324.1|432313_432826_+|protease	protease	protease	NA	NA	NA	NA
AUV36325.1|433024_434557_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	29.5	1.5e-21
AUV36326.1|434773_435535_-	KR domain-containing protein	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.3e-21
>prophage 3
CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	468469	526199	5616605	tail,holin,terminase,integrase	Salmonella_phage(21.31%)	78	468251:468266	523505:523520
468251:468266	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
AUV36356.1|468469_468706_+	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	67.5	3.4e-26
AUV36357.1|468724_468910_+	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	66.0	1.9e-16
AUV36358.1|469080_470175_-	hsdR	NA	NA	NA	NA	NA
AUV36359.1|470424_471690_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.7	3.7e-207
AUV36360.1|471691_472111_-	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
AUV36361.1|472190_473675_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AUV36362.1|473674_473926_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36363.1|474568_474991_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
AUV36364.1|475068_475251_-	Hin recombinase	NA	A0A286S1P7	Klebsiella_phage	87.0	2.6e-18
AUV36365.1|475262_476063_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36366.1|478112_481181_-	kinase	NA	A0A286S259	Klebsiella_phage	95.8	0.0e+00
AUV36367.1|481177_481558_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	95.2	3.1e-69
AUV36368.1|481567_482050_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
AUV36369.1|482230_482695_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	69.1	3.6e-59
AUV36370.1|483005_483341_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36371.1|483424_486079_-|tail	phage tail protein	tail	A0A2D1GPC9	Escherichia_phage	34.4	3.0e-86
AUV41152.1|486152_486521_-	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	42.9	2.5e-15
AUV36372.1|486631_486988_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
AUV36373.1|487064_487241_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36374.1|487408_487891_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36375.1|487944_489117_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.3	5.5e-24
AUV36376.1|489140_489533_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AUV36377.1|489529_490081_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	7.8e-29
AUV36378.1|490082_490466_-	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
AUV36379.1|490452_490686_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
AUV36380.1|490695_490950_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
AUV36381.1|490951_491347_-	protein singed	NA	A0A1B1P9F2	Acinetobacter_phage	39.3	3.3e-13
AUV36382.1|491668_492622_-	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
AUV36383.1|492632_493418_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	6.0e-67
AUV36384.1|493948_495061_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	2.1e-110
AUV36385.1|495044_496445_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	2.4e-127
AUV36386.1|496444_497752_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.1	1.6e-149
AUV36387.1|497729_498734_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.0	1.3e-37
AUV36388.1|498780_499116_+	hypothetical protein	NA	NA	NA	NA	NA
AUV36389.1|499165_499582_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
AUV36390.1|499655_499901_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	92.6	9.7e-32
AUV36391.1|500714_500909_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	1.4e-25
AUV36392.1|500859_501135_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
AUV36393.1|501131_501476_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
AUV36394.1|501472_502012_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
AUV36395.1|502008_502320_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.5	1.1e-40
AUV36396.1|502451_502676_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36397.1|503065_503887_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	60.6	5.1e-85
AUV36398.1|503883_504024_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36399.1|504020_504602_-	protein NinG	NA	E7C9S3	Salmonella_phage	44.8	2.7e-40
AUV36400.1|504604_504811_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	71.2	2.4e-23
AUV36401.1|504810_505407_-	DUF1367 domain-containing protein	NA	K7PKS6	Enterobacteria_phage	80.1	3.8e-90
AUV36402.1|505441_505690_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	67.9	5.0e-28
AUV41153.1|505796_506030_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
AUV36403.1|506178_508173_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	54.0	1.7e-198
AUV36404.1|508148_508406_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36405.1|508405_508705_-	hypothetical protein	NA	K7PJS3	Enterobacterial_phage	61.2	3.0e-27
AUV36406.1|509357_509876_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	92.7	7.9e-92
AUV36407.1|509875_510250_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36408.1|510242_510479_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.0	1.5e-13
AUV36409.1|510475_510730_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.7	5.3e-09
AUV36410.1|510722_510926_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	86.4	1.3e-26
AUV36411.1|510922_511291_-	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	43.0	4.9e-11
AUV36412.1|511298_512048_-	DNA replication protein DnaC	NA	H6WRX8	Salmonella_phage	83.1	1.3e-119
AUV36413.1|512050_512959_-	DNA-binding protein	NA	V5URT9	Shigella_phage	54.1	3.4e-90
AUV36414.1|512973_513162_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36415.1|513249_513786_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	70.4	2.1e-63
AUV36416.1|513788_514007_-	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	64.8	8.9e-21
AUV36417.1|514105_514489_+	transcriptional regulator	NA	K7PHG0	Enterobacteria_phage	82.7	5.9e-52
AUV36418.1|515049_515253_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	1.1e-20
AUV36419.1|515738_515930_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUV36420.1|515938_516094_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	75.0	1.2e-14
AUV36421.1|516231_519270_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.1	1.5e-291
AUV36422.1|519282_520392_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	85.9	9.4e-183
AUV36423.1|520426_520765_+	hypothetical protein	NA	NA	NA	NA	NA
AUV36424.1|520757_521369_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	75.3	4.9e-40
AUV36425.1|521365_521674_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	55.9	4.6e-23
AUV41154.1|521681_521921_+	DUF4060 domain-containing protein	NA	M9P0E0	Enterobacteria_phage	70.1	8.0e-23
AUV36426.1|521930_522245_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
AUV36427.1|522141_523329_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.2	4.2e-120
AUV36428.1|523505_524396_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
523505:523520	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
AUV36429.1|524395_525388_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AUV36430.1|525389_526199_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 4
CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	990577	1036932	5616605	tail,holin,terminase	Salmonella_phage(28.0%)	63	NA	NA
AUV36854.1|990577_990847_-	hypothetical protein	NA	H2DE47	Erwinia_phage	40.4	6.1e-11
AUV36855.1|993188_996257_-	kinase	NA	A0A286S259	Klebsiella_phage	90.7	0.0e+00
AUV36856.1|996253_996634_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	93.7	7.6e-68
AUV36857.1|996762_997131_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36858.1|997140_997623_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	90.6	7.2e-79
AUV36859.1|997619_998084_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	59.5	7.9e-51
AUV36860.1|998141_998369_+	hypothetical protein	NA	NA	NA	NA	NA
AUV36861.1|998398_1002025_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	29.8	1.1e-78
AUV36862.1|1002120_1002486_-	hypothetical protein	NA	S4TR42	Salmonella_phage	48.3	1.0e-05
AUV36863.1|1002533_1002890_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
AUV36864.1|1002966_1003143_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36865.1|1003310_1003793_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36866.1|1003847_1005020_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.0e-22
AUV36867.1|1005043_1005436_-	electron transfer flavoprotein subunit beta	NA	A0A059VK45	Pseudomonas_phage	31.5	1.5e-13
AUV36868.1|1005432_1005984_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	42.8	5.0e-28
AUV36869.1|1005985_1006369_-	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	5.4e-21
AUV36870.1|1006355_1006589_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
AUV36871.1|1006598_1006853_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
AUV36872.1|1006854_1007250_-	protein singed	NA	A0A0S2SYB7	Pseudomonas_phage	42.5	2.1e-12
AUV36873.1|1007571_1008525_-	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.0	1.1e-131
AUV36874.1|1008535_1009321_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	64.8	3.8e-69
AUV36875.1|1009405_1010518_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.7	4.8e-110
AUV36876.1|1010501_1011902_-	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	6.4e-128
AUV36877.1|1011901_1013209_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.1	1.5e-150
AUV36878.1|1013186_1014191_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	43.1	3.8e-34
AUV36879.1|1014194_1014383_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36880.1|1014440_1014677_-	hypothetical protein	NA	A0A286N2R1	Klebsiella_phage	60.3	6.5e-17
AUV36881.1|1015065_1015254_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	91.5	4.3e-24
AUV36882.1|1015204_1015480_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	93.4	7.1e-07
AUV36883.1|1015482_1016112_-	endolysin	NA	F1C591	Cronobacter_phage	75.4	4.2e-87
AUV36884.1|1016111_1016393_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	4.8e-19
AUV36885.1|1016379_1016766_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	89.8	1.6e-57
AUV36886.1|1017010_1017832_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	66.1	2.9e-96
AUV36887.1|1017947_1018304_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	65.8	1.4e-42
AUV41170.1|1018300_1018597_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	9.2e-37
AUV36888.1|1018804_1019401_-	DUF1367 domain-containing protein	NA	K7PKS6	Enterobacteria_phage	80.1	1.3e-90
AUV36889.1|1019435_1019684_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	67.9	5.0e-28
AUV36890.1|1019788_1020022_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	70.1	5.8e-26
AUV36891.1|1020397_1020625_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36892.1|1020959_1021244_-	hypothetical protein	NA	A0A0S1S1U7	Klebsiella_phage	94.7	3.8e-48
AUV36893.1|1022021_1022651_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36894.1|1022647_1023052_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36895.1|1023048_1023552_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36896.1|1023679_1024465_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	9.6e-65
AUV36897.1|1024457_1024793_-	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	43.0	5.8e-11
AUV36898.1|1024800_1025550_-	DNA replication protein DnaC	NA	H6WRX8	Salmonella_phage	83.1	1.3e-119
AUV36899.1|1025552_1026461_-	DNA-binding protein	NA	V5URT9	Shigella_phage	53.9	8.4e-89
AUV36900.1|1026475_1026664_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36901.1|1027008_1027572_-	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	44.1	3.6e-29
AUV36902.1|1027574_1027805_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	85.9	3.2e-29
AUV36903.1|1027908_1028295_+	transcriptional regulator	NA	A0A0M4R5D1	Salmonella_phage	92.9	1.0e-56
AUV36904.1|1028421_1028832_+	hypothetical protein	NA	NA	NA	NA	NA
AUV41171.1|1028860_1029064_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	76.1	1.1e-20
AUV41172.1|1029324_1029423_+	hypothetical protein	NA	NA	NA	NA	NA
AUV36905.1|1029529_1029721_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUV36906.1|1029729_1029885_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	74.5	2.6e-14
AUV36907.1|1030022_1033121_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.6	4.3e-294
AUV36908.1|1033133_1034222_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	56.5	4.4e-108
AUV36909.1|1034256_1034859_+	hypothetical protein	NA	R9VWB9	Serratia_phage	51.4	1.7e-53
AUV36910.1|1034855_1035164_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	3.2e-24
AUV41173.1|1035171_1035411_+	DUF4060 domain-containing protein	NA	M9P0E0	Enterobacteria_phage	71.8	3.2e-24
AUV36911.1|1035449_1035725_+	excisionase	NA	H6WRW8	Salmonella_phage	72.7	9.2e-31
AUV36912.1|1035702_1036932_-	DUF4102 domain-containing protein	NA	H6WRW7	Salmonella_phage	96.3	1.3e-238
>prophage 5
CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	1042078	1140831	5616605	tail,capsid,protease,portal,transposase,holin,terminase,head,tRNA	Klebsiella_phage(50.0%)	111	NA	NA
AUV36918.1|1042078_1042816_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AUV36919.1|1042947_1044279_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
AUV36920.1|1044324_1044708_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
AUV36921.1|1045020_1045710_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
AUV36922.1|1045767_1046853_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AUV36923.1|1047056_1047482_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
AUV36924.1|1047551_1048250_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AUV36925.1|1048284_1050936_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AUV36926.1|1051056_1052412_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AUV36927.1|1052453_1052777_+	hypothetical protein	NA	NA	NA	NA	NA
AUV36928.1|1052780_1054079_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.9	4.1e-44
AUV36929.1|1059955_1062529_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
AUV36930.1|1062658_1063390_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AUV36931.1|1063386_1064367_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AUV36932.1|1064498_1065236_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AUV36933.1|1065506_1065842_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AUV41174.1|1065948_1065996_+	hypothetical protein	NA	NA	NA	NA	NA
AUV36934.1|1066096_1067257_+	prephenate dehydratase	NA	NA	NA	NA	NA
AUV36935.1|1067253_1068126_-	gluconolactonase	NA	NA	NA	NA	NA
AUV36936.1|1068188_1069310_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AUV36937.1|1069319_1070390_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
AUV36938.1|1070732_1071242_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AUV36939.1|1071234_1072458_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUV36940.1|1072471_1072954_+	hypothetical protein	NA	NA	NA	NA	NA
AUV36941.1|1072962_1074333_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
AUV36942.1|1074389_1074848_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AUV36943.1|1074967_1075315_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AUV36944.1|1075354_1076122_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AUV36945.1|1076153_1076702_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUV36946.1|1076720_1076969_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUV36947.1|1077228_1078593_-	signal recognition particle protein	NA	NA	NA	NA	NA
AUV36948.1|1078756_1079548_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AUV36949.1|1079567_1080854_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AUV36950.1|1080973_1081564_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUV36951.1|1081688_1082567_+	NAD(+) kinase	NA	NA	NA	NA	NA
AUV36952.1|1082653_1084315_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AUV36953.1|1084462_1084804_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AUV36954.1|1084870_1085161_-	RnfH family protein	NA	NA	NA	NA	NA
AUV36955.1|1085150_1085627_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AUV36956.1|1085737_1086220_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
AUV36957.1|1086996_1087245_+	DinI family protein	NA	S5MQI1	Escherichia_phage	69.5	8.0e-26
AUV36958.1|1087329_1087878_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	95.0	2.7e-90
AUV41175.1|1088764_1090057_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	37.0	3.1e-68
AUV36959.1|1090057_1090807_+	hypothetical protein	NA	NA	NA	NA	NA
AUV36960.1|1090938_1091751_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36961.1|1093830_1096899_-	kinase	NA	A0A286S259	Klebsiella_phage	97.3	0.0e+00
AUV36962.1|1096895_1097276_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
AUV36963.1|1097285_1097768_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	98.1	1.1e-84
AUV36964.1|1097754_1098234_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	97.5	5.6e-92
AUV36965.1|1098233_1100534_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	51.1	5.3e-180
AUV36966.1|1101278_1101542_-|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	86.0	8.2e-37
AUV36967.1|1101574_1101928_-|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	79.5	1.3e-48
AUV36968.1|1101971_1102463_-|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	99.4	2.5e-87
AUV36969.1|1102519_1102885_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	95.9	8.4e-64
AUV36970.1|1102881_1103421_-	hypothetical protein	NA	A0A286S249	Klebsiella_phage	93.3	8.5e-89
AUV36971.1|1103413_1103746_-|head,tail	head-tail adaptor protein	head,tail	A0A286S2A2	Klebsiella_phage	98.2	6.5e-55
AUV36972.1|1103747_1103945_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	96.9	2.4e-25
AUV36973.1|1104014_1104332_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.0	1.2e-21
AUV36974.1|1104409_1105648_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	6.8e-158
AUV36975.1|1105657_1106257_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
AUV36976.1|1106249_1107476_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	3.2e-208
AUV36977.1|1107623_1109375_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.5	4.0e-252
AUV36978.1|1109378_1109876_-|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	73.9	5.7e-63
AUV36979.1|1110031_1110382_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	79.1	1.0e-50
AUV36980.1|1110369_1110603_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36981.1|1110659_1110956_-	hypothetical protein	NA	NA	NA	NA	NA
AUV41176.1|1111065_1111278_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36982.1|1111374_1111620_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	63.0	4.7e-18
AUV36983.1|1112016_1112217_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	1.3e-18
AUV36984.1|1112353_1112638_+	hypothetical protein	NA	NA	NA	NA	NA
AUV36985.1|1112728_1112923_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	87.5	3.1e-25
AUV36986.1|1112873_1113149_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	73.0	8.9e-26
AUV36987.1|1113156_1113786_-	endolysin	NA	G8C7W0	Escherichia_phage	90.4	1.5e-105
AUV36988.1|1113785_1114064_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	75.0	5.3e-34
AUV36989.1|1114053_1114446_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	72.2	4.6e-44
AUV36990.1|1114697_1115246_-	hypothetical protein	NA	NA	NA	NA	NA
AUV36991.1|1115465_1116248_-	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	100.0	9.0e-148
AUV36992.1|1116244_1116721_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
AUV36993.1|1116717_1117680_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
AUV36994.1|1117681_1119340_-	helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
AUV36995.1|1119648_1119942_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
AUV36996.1|1119916_1120138_-	XRE family transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
AUV36997.1|1120235_1120904_+	LexA family transcriptional repressor	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
AUV36998.1|1121074_1121389_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
AUV36999.1|1121381_1121570_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
AUV37000.1|1121739_1122105_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
AUV37001.1|1122097_1122352_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
AUV37002.1|1122538_1122964_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
AUV37003.1|1122960_1123155_+	hypothetical protein	NA	NA	NA	NA	NA
AUV37004.1|1123151_1123979_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.0	5.5e-111
AUV37005.1|1124083_1124602_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
AUV37006.1|1124607_1125333_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	98.3	2.7e-130
AUV37007.1|1125322_1125547_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	90.5	2.4e-29
AUV37008.1|1125543_1125756_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
AUV37009.1|1125813_1126026_+	excisionase	NA	I6PBM8	Cronobacter_phage	74.2	8.4e-24
AUV37010.1|1125980_1127156_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	93.8	7.3e-210
AUV37011.1|1127643_1128552_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	97.0	2.4e-168
AUV37012.1|1128882_1130073_+	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	50.0	3.4e-106
AUV37013.1|1130227_1131145_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
AUV37014.1|1131146_1132532_+	hypothetical protein	NA	NA	NA	NA	NA
AUV37015.1|1132577_1133558_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
AUV37016.1|1133596_1133719_-	ABC transporter	NA	NA	NA	NA	NA
AUV37017.1|1133813_1134506_+	hypothetical protein	NA	NA	NA	NA	NA
AUV37018.1|1135027_1135594_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.1e-59
AUV37019.1|1135611_1135857_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	59.3	5.0e-20
AUV37020.1|1135853_1136591_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.7	7.1e-70
AUV37021.1|1137395_1137662_+	ash family protein	NA	NA	NA	NA	NA
AUV37022.1|1137615_1137945_+	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	68.5	1.6e-29
AUV37023.1|1137941_1138169_+	hypothetical protein	NA	NA	NA	NA	NA
AUV37024.1|1138165_1138486_+	hypothetical protein	NA	NA	NA	NA	NA
AUV37025.1|1138497_1140831_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	81.7	0.0e+00
>prophage 6
CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	3690203	3748178	5616605	protease,transposase,holin,terminase,head,tRNA,integrase	Enterobacteria_phage(20.0%)	77	3705353:3705399	3754503:3754549
AUV39361.1|3690203_3690830_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
AUV39362.1|3690797_3691484_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.6e-31
AUV39363.1|3691480_3693895_+	ABC transporter permease	NA	NA	NA	NA	NA
AUV39364.1|3694076_3695222_+	porin	NA	NA	NA	NA	NA
AUV39365.1|3695329_3696406_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AUV39366.1|3696517_3697585_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AUV39367.1|3697581_3698091_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AUV39368.1|3698023_3698191_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUV39369.1|3698365_3699334_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.1	8.8e-177
AUV39370.1|3699652_3700678_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUV39371.1|3701073_3701796_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AUV39372.1|3701799_3702294_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUV39373.1|3702469_3703855_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
AUV39374.1|3703900_3704113_-	ribosome-associated protein	NA	NA	NA	NA	NA
AUV39375.1|3704114_3704981_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
AUV39376.1|3705019_3705343_+	hypothetical protein	NA	NA	NA	NA	NA
3705353:3705399	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
AUV39377.1|3705412_3706576_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	2.9e-203
AUV39378.1|3706452_3706788_-	excisionase	NA	NA	NA	NA	NA
AUV39379.1|3706789_3707008_-	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	52.2	2.6e-12
AUV39380.1|3707004_3707490_-	hypothetical protein	NA	A0A076G835	Escherichia_phage	61.9	1.2e-30
AUV39381.1|3707486_3707711_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	73.2	9.2e-21
AUV39382.1|3707707_3707926_-	hypothetical protein	NA	NA	NA	NA	NA
AUV39383.1|3707922_3708579_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
AUV39384.1|3708575_3709004_-	regulator	NA	M9NYX4	Enterobacteria_phage	81.0	7.5e-64
AUV39385.1|3709000_3709681_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	92.0	1.1e-122
AUV39386.1|3709677_3710523_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	2.0e-68
AUV39387.1|3710538_3710823_-	hypothetical protein	NA	G8C7T1	Escherichia_phage	78.7	3.3e-39
AUV39388.1|3710911_3711106_-	hypothetical protein	NA	NA	NA	NA	NA
AUV39389.1|3711567_3712002_-	hypothetical protein	NA	NA	NA	NA	NA
AUV39390.1|3712021_3712717_-	phage repressor protein C	NA	K7P7I4	Enterobacteria_phage	62.4	8.2e-76
AUV39391.1|3712819_3713041_+	transcriptional regulator	NA	Q716D6	Shigella_phage	55.1	1.8e-13
AUV39392.1|3713080_3713302_+	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AUV39393.1|3713388_3714249_+	replication protein	NA	K7PGT1	Enterobacteria_phage	53.6	3.5e-60
AUV39394.1|3714245_3715094_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.8	1.2e-89
AUV39395.1|3715090_3715384_+	protein ren	NA	M1FPD5	Enterobacteria_phage	62.4	2.1e-25
AUV41275.1|3715620_3716184_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	42.9	8.2e-10
AUV39396.1|3716180_3716450_+	antitoxin	NA	NA	NA	NA	NA
AUV39397.1|3716446_3717121_+	hypothetical protein	NA	A0A2H4FRZ0	Salmonella_phage	49.7	1.6e-28
AUV39398.1|3717120_3717633_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	76.6	4.8e-73
AUV39399.1|3718593_3718791_+	hypothetical protein	NA	NA	NA	NA	NA
AUV39400.1|3718790_3718979_+	hypothetical protein	NA	R9TNE4	Aeromonas_phage	71.7	2.7e-18
AUV39401.1|3718971_3719211_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	2.3e-09
AUV39402.1|3719374_3719971_+	hypothetical protein	NA	A0A0U2RT94	Escherichia_phage	53.8	4.3e-57
AUV41276.1|3719976_3720147_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
AUV39403.1|3720139_3720748_+	protein NinG	NA	A0A0M4RU10	Salmonella_phage	62.7	2.3e-50
AUV39404.1|3720744_3720975_+	hypothetical protein	NA	NA	NA	NA	NA
AUV39405.1|3721108_3721918_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	77.0	4.8e-120
AUV39406.1|3722633_3722903_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	77.2	7.4e-33
AUV41277.1|3722880_3723378_+	lysozyme	NA	K7P7Q3	Enterobacteria_phage	84.2	9.6e-79
AUV39407.1|3723374_3723764_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	45.2	1.1e-21
AUV39408.1|3724222_3724855_+|terminase	terminase small subunit	terminase	A0A2I7RHH8	Vibrio_phage	48.0	1.6e-41
AUV39409.1|3724856_3726533_+|terminase	terminase	terminase	H9C191	Pectobacterium_phage	74.3	3.9e-249
AUV39410.1|3726533_3728054_+	hypothetical protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	45.2	5.7e-106
AUV39411.1|3728106_3728796_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	54.9	2.9e-65
AUV39412.1|3728858_3730646_+	hypothetical protein	NA	A0A219YCD3	Aeromonas_phage	38.1	3.7e-56
AUV39413.1|3730793_3732056_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AUV39414.1|3732338_3732821_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	51.0	1.2e-33
AUV39415.1|3732820_3733858_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.0	4.2e-84
AUV39416.1|3733859_3734186_+	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	42.6	2.1e-10
AUV39417.1|3734185_3734629_+	DUF4054 domain-containing protein	NA	A0A1X9SF97	Acinetobacter_phage	38.2	1.1e-12
AUV39418.1|3734631_3735195_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	32.9	4.8e-18
AUV41278.1|3735191_3735560_+	hypothetical protein	NA	Q6UJ26	Burkholderia_virus	30.6	1.5e-07
AUV39419.1|3735541_3736093_+	hypothetical protein	NA	NA	NA	NA	NA
AUV39420.1|3736096_3737578_+	hypothetical protein	NA	Q2NPD0	Xanthomonas_phage	34.4	6.7e-59
AUV39421.1|3737577_3738021_+	hypothetical protein	NA	NA	NA	NA	NA
AUV39422.1|3738201_3738957_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.8	2.8e-61
AUV39423.1|3738959_3739214_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	76.2	1.4e-20
AUV39424.1|3739266_3739743_+	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	29.8	3.2e-07
AUV39425.1|3739947_3741906_+	transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	37.2	9.8e-42
AUV39426.1|3741909_3742749_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	31.7	3.8e-27
AUV39427.1|3742750_3743056_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.5	3.6e-20
AUV39428.1|3743052_3743922_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	29.5	2.0e-26
AUV39429.1|3743911_3744502_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	23.4	7.6e-06
AUV39430.1|3744956_3745313_+	hypothetical protein	NA	NA	NA	NA	NA
AUV39431.1|3745320_3746553_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	50.5	1.1e-104
AUV39432.1|3746545_3747133_+	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	42.9	3.2e-33
AUV39433.1|3747134_3748178_+	hypothetical protein	NA	A0A077KC23	Edwardsiella_phage	41.5	4.4e-17
3754503:3754549	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 7
CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	4154314	4162889	5616605	transposase	Cronobacter_phage(33.33%)	9	NA	NA
AUV39792.1|4154314_4155295_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
AUV41298.1|4155339_4155918_+	hypothetical protein	NA	NA	NA	NA	NA
AUV39793.1|4156187_4156802_-	serine recombinase	NA	A0A0A8WJD4	Clostridium_phage	28.1	8.4e-08
AUV39794.1|4157062_4157803_-	serine/threonine-protein phosphatase	NA	I6PCV8	Cronobacter_phage	46.3	2.3e-60
AUV39795.1|4157799_4158555_-	serine/threonine protein kinase	NA	I6PD73	Cronobacter_phage	46.9	1.2e-59
AUV39796.1|4158958_4159567_-	hypothetical protein	NA	NA	NA	NA	NA
AUV39797.1|4159568_4159919_-	hypothetical protein	NA	E5DSD7	Aeromonas_virus	35.2	9.0e-07
AUV41299.1|4159908_4160742_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AUV39798.1|4161401_4162889_-	recombinase family protein	NA	A0A288WFZ3	Bacillus_phage	24.9	1.6e-15
>prophage 8
CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	4234265	4243728	5616605	protease,tRNA	Dickeya_phage(16.67%)	9	NA	NA
AUV39855.1|4234265_4235381_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AUV39856.1|4235377_4237318_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AUV39857.1|4237257_4237440_+	hypothetical protein	NA	NA	NA	NA	NA
AUV39858.1|4237394_4237616_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AUV39859.1|4237941_4238259_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AUV39860.1|4238289_4240569_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	5.6e-166
AUV39861.1|4240688_4240907_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AUV39862.1|4241260_4241962_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUV39863.1|4242006_4243728_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.6	1.2e-14
>prophage 9
CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	4360748	4384567	5616605	head,tail,integrase	Pectobacterium_phage(45.0%)	33	4362674:4362687	4370155:4370168
AUV39946.1|4360748_4361408_-	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
AUV39947.1|4361677_4363330_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
4362674:4362687	attL	CTTGGCCAGGGCCA	NA	NA	NA	NA
AUV39948.1|4363596_4364634_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	54.4	4.0e-95
AUV39949.1|4364637_4364862_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	68.1	4.5e-20
AUV39950.1|4364827_4365022_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	66.1	4.4e-11
AUV39951.1|4365071_4365257_-	hypothetical protein	NA	H9C155	Pectobacterium_phage	44.3	8.1e-07
AUV39952.1|4365258_4365825_-	hypothetical protein	NA	H9C156	Pectobacterium_phage	61.5	2.5e-51
AUV39953.1|4365824_4367954_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.6	8.0e-98
AUV41313.1|4367998_4368232_-	hypothetical protein	NA	NA	NA	NA	NA
AUV39954.1|4369162_4369570_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	50.8	3.7e-28
AUV39955.1|4369652_4369853_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	48.3	1.4e-09
AUV39956.1|4369913_4370360_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	53.2	1.2e-27
4370155:4370168	attR	TGGCCCTGGCCAAG	NA	NA	NA	NA
AUV41314.1|4370443_4370602_+	adenylate cyclase	NA	NA	NA	NA	NA
AUV41315.1|4370619_4371588_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.5	5.5e-38
AUV39957.1|4371584_4372973_+	replicative DNA helicase	NA	Q8HA30	Enterobacteria_phage	47.3	2.0e-105
AUV39958.1|4373011_4373662_+	hypothetical protein	NA	NA	NA	NA	NA
AUV39959.1|4373665_4373899_+	hypothetical protein	NA	NA	NA	NA	NA
AUV39960.1|4374139_4374832_+	hypothetical protein	NA	NA	NA	NA	NA
AUV39961.1|4375045_4375525_+	hypothetical protein	NA	NA	NA	NA	NA
AUV39962.1|4375521_4376049_+	hypothetical protein	NA	A0A0P0HSM0	Acinetobacter_phage	28.7	9.1e-11
AUV39963.1|4376424_4376616_+	hypothetical protein	NA	NA	NA	NA	NA
AUV39964.1|4376684_4377278_+	hypothetical protein	NA	H9C173	Pectobacterium_phage	71.6	4.7e-80
AUV39965.1|4377267_4377591_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	55.8	1.8e-25
AUV39966.1|4377578_4377935_+	enterotoxin	NA	NA	NA	NA	NA
AUV39967.1|4377931_4378165_+	hypothetical protein	NA	NA	NA	NA	NA
AUV39968.1|4378148_4378409_+	hypothetical protein	NA	NA	NA	NA	NA
AUV39969.1|4378415_4378868_+	DNA-packaging protein	NA	A3EYX3	Salmonella_phage	66.4	1.5e-49
AUV39970.1|4378952_4380347_+	hypothetical protein	NA	A0A0E3JIA1	Rhodoferax_phage	36.9	2.4e-58
AUV39971.1|4380346_4382011_+|head,tail	phage head-tail adapter protein	head,tail	A0A221SAN2	Ralstonia_phage	39.2	4.5e-104
AUV39972.1|4382013_4382337_+	GTP-binding protein	NA	NA	NA	NA	NA
AUV39973.1|4382323_4383049_+	hypothetical protein	NA	NA	NA	NA	NA
AUV39974.1|4383059_4384055_+	hypothetical protein	NA	W6MW28	Pseudomonas_phage	60.2	2.7e-104
AUV39975.1|4384093_4384567_+	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	46.3	3.1e-26
>prophage 10
CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	4389603	4399772	5616605		Pseudomonas_phage(33.33%)	9	NA	NA
AUV39981.1|4389603_4392318_+	transglycosylase	NA	K4NWI2	Pseudomonas_phage	24.0	3.7e-23
AUV41318.1|4392625_4394008_+	hypothetical protein	NA	NA	NA	NA	NA
AUV39982.1|4394007_4396932_+	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	41.3	3.9e-196
AUV39983.1|4396932_4397145_-	hypothetical protein	NA	NA	NA	NA	NA
AUV39984.1|4397208_4397862_-	hypothetical protein	NA	NA	NA	NA	NA
AUV39985.1|4398006_4398159_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	79.6	2.1e-13
AUV39986.1|4398488_4398704_+	hypothetical protein	NA	A5LH82	Enterobacteria_phage	61.0	1.1e-12
AUV39987.1|4398705_4399245_+	lysozyme	NA	H6WRZ4	Salmonella_phage	78.7	4.5e-82
AUV39988.1|4399241_4399772_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	48.9	2.4e-35
>prophage 11
CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	4539263	4624794	5616605	tail,capsid,protease,portal,transposase,holin,terminase,head,tRNA,integrase	Salmonella_phage(16.13%)	101	4605502:4605518	4624987:4625003
AUV40119.1|4539263_4539755_+|transposase	transposase	transposase	NA	NA	NA	NA
AUV40120.1|4540058_4540238_-	hypothetical protein	NA	NA	NA	NA	NA
AUV40121.1|4540256_4541620_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
AUV40122.1|4541695_4542817_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AUV40123.1|4542902_4544369_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
AUV40124.1|4544368_4545040_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AUV40125.1|4545322_4546129_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUV40126.1|4546212_4546575_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AUV40127.1|4546629_4548000_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.5	1.4e-108
AUV40128.1|4548003_4548645_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AUV41324.1|4548699_4549806_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUV40129.1|4549862_4550321_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AUV40130.1|4550338_4550989_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AUV40131.1|4551229_4552480_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
AUV40132.1|4552592_4553735_-|integrase	integrase	integrase	Q77Z02	Phage_21	81.9	1.2e-172
AUV40133.1|4553724_4553961_-	excisionase	NA	NA	NA	NA	NA
AUV40134.1|4553989_4554265_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	40.4	1.5e-09
AUV40135.1|4554261_4554498_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	2.9e-09
AUV40136.1|4554490_4555042_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	46.0	7.0e-30
AUV40137.1|4555038_4555266_-	hypothetical protein	NA	NA	NA	NA	NA
AUV40138.1|4555693_4556038_-	hypothetical protein	NA	NA	NA	NA	NA
AUV40139.1|4556165_4556951_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.5	6.9e-63
AUV40140.1|4556943_4557144_-	hypothetical protein	NA	NA	NA	NA	NA
AUV41325.1|4557143_4557671_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	70.3	6.0e-63
AUV40141.1|4557806_4558637_-	DUF2303 domain-containing protein	NA	Q8HAA2	Salmonella_phage	82.4	9.3e-127
AUV40142.1|4558689_4559061_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	80.5	4.8e-51
AUV40143.1|4559135_4559321_+	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	65.0	1.2e-05
AUV40144.1|4559877_4560393_+	hypothetical protein	NA	NA	NA	NA	NA
AUV40145.1|4560665_4561298_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.0	6.0e-33
AUV40146.1|4561395_4561626_+	XRE family transcriptional regulator	NA	Q716D6	Shigella_phage	51.6	2.7e-12
AUV40147.1|4561859_4562327_-	hypothetical protein	NA	NA	NA	NA	NA
AUV40148.1|4562407_4562956_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	66.9	3.0e-65
AUV40149.1|4563128_4563308_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	5.6e-13
AUV40150.1|4563297_4564209_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	73.8	4.4e-53
AUV40151.1|4564205_4564664_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AUV40152.1|4566026_4567877_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.2	1.5e-196
AUV40153.1|4567873_4568350_+|protease	SOS-response repressor and protease LexA	protease	U5P451	Shigella_phage	61.8	1.4e-15
AUV40154.1|4568346_4568745_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	69.7	6.2e-44
AUV40155.1|4568834_4569656_+	DNA-binding protein	NA	A0A0P0ZCS0	Stx2-converting_phage	65.8	4.0e-90
AUV41326.1|4569737_4570724_+	DUF968 domain-containing protein	NA	Q8SBE5	Shigella_phage	48.6	1.1e-89
AUV40156.1|4570742_4571573_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	46.9	2.9e-59
AUV40157.1|4571782_4571974_+	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	81.0	1.6e-21
AUV40158.1|4572123_4573173_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	76.4	8.9e-167
AUV40159.1|4573867_4574257_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	79.1	2.6e-47
AUV40160.1|4574246_4574525_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	73.9	1.7e-32
AUV40161.1|4574524_4575151_+	endolysin	NA	F1C591	Cronobacter_phage	76.8	1.5e-89
AUV40162.1|4575356_4575539_-	hypothetical protein	NA	NA	NA	NA	NA
AUV40163.1|4575624_4575909_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	75.5	1.1e-31
AUV41327.1|4576477_4576810_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	62.7	4.4e-35
AUV40164.1|4576938_4577184_+	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	61.7	3.0e-17
AUV40165.1|4577258_4577720_-	hypothetical protein	NA	NA	NA	NA	NA
AUV40166.1|4577918_4578272_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	72.7	9.0e-47
AUV40167.1|4578455_4578920_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	4.8e-48
AUV40168.1|4578873_4580610_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.3	1.3e-138
AUV40169.1|4580616_4581936_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	58.9	1.7e-138
AUV40170.1|4581911_4582619_+|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.5	2.2e-68
AUV40171.1|4582628_4583849_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.0	8.3e-140
AUV40172.1|4583894_4584149_+	hypothetical protein	NA	NA	NA	NA	NA
AUV41328.1|4584154_4584487_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	31.6	8.8e-12
AUV40173.1|4584499_4584838_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	66.1	8.1e-37
AUV40174.1|4584834_4585284_+	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	83.9	1.3e-63
AUV40175.1|4585280_4585628_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	1.8e-31
AUV40176.1|4585684_4586389_+|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	66.9	1.6e-79
AUV40177.1|4586419_4586824_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	56.9	8.5e-33
AUV40178.1|4586826_4587132_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	65.0	3.6e-28
AUV40179.1|4587324_4587855_+	hypothetical protein	NA	A0A2H4FQV0	Salmonella_phage	68.4	2.1e-63
AUV40180.1|4588051_4588435_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	53.9	3.1e-32
AUV40181.1|4588502_4591910_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	43.1	5.6e-194
AUV40182.1|4591931_4592405_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
AUV40183.1|4592391_4592868_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	65.2	2.4e-50
AUV40184.1|4592880_4593261_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.6e-57
AUV40185.1|4593257_4596335_+	kinase	NA	A0A286S259	Klebsiella_phage	61.9	0.0e+00
AUV40186.1|4598383_4599184_+	hypothetical protein	NA	NA	NA	NA	NA
AUV40187.1|4599194_4599377_+	Hin recombinase	NA	A0A286S1P7	Klebsiella_phage	85.2	1.5e-18
AUV40188.1|4599734_4599986_+	hypothetical protein	NA	NA	NA	NA	NA
AUV40189.1|4599985_4601470_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AUV40190.1|4601549_4601969_+	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	57.5	9.4e-35
AUV40191.1|4601970_4603236_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	83.6	2.3e-209
AUV40192.1|4603361_4604351_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
AUV40193.1|4604640_4605318_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	4.7e-76
4605502:4605518	attL	TTTGGTCGGCACGAGAG	NA	NA	NA	NA
AUV40194.1|4605973_4606687_+	DUF1353 domain-containing protein	NA	A0A088C4U2	Shewanella_sp._phage	40.5	5.7e-08
AUV40195.1|4606777_4608526_+	hypothetical protein	NA	NA	NA	NA	NA
AUV40196.1|4608518_4609154_+	hypothetical protein	NA	NA	NA	NA	NA
AUV40197.1|4609156_4611076_+	hypothetical protein	NA	NA	NA	NA	NA
AUV40198.1|4611559_4612030_-	hypothetical protein	NA	NA	NA	NA	NA
AUV40199.1|4612264_4612462_-	hypothetical protein	NA	NA	NA	NA	NA
AUV40200.1|4612838_4613177_-	hypothetical protein	NA	NA	NA	NA	NA
AUV41329.1|4613548_4613767_-	hypothetical protein	NA	NA	NA	NA	NA
AUV40201.1|4614045_4614402_-	hypothetical protein	NA	NA	NA	NA	NA
AUV40202.1|4614535_4614760_-	hypothetical protein	NA	NA	NA	NA	NA
AUV40203.1|4615418_4616423_-	hypothetical protein	NA	A0A1P8DIG7	Virus_Rctr197k	37.7	2.8e-08
AUV40204.1|4616435_4616786_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUV40205.1|4617079_4617334_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUV40206.1|4617531_4617852_-	hypothetical protein	NA	NA	NA	NA	NA
AUV40207.1|4617844_4618114_-	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	43.5	3.1e-07
AUV40208.1|4618812_4620660_-	hypothetical protein	NA	NA	NA	NA	NA
AUV40209.1|4620643_4621687_-	topoisomerase	NA	A0A1B0VML8	Pseudomonas_phage	50.8	2.4e-39
AUV40210.1|4621679_4621913_-	hypothetical protein	NA	NA	NA	NA	NA
AUV40211.1|4622012_4622210_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AUV40212.1|4622340_4623408_-	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	32.3	6.8e-05
AUV40213.1|4623534_4624794_-|integrase	integrase	integrase	A0A1V0E8G8	Vibrio_phage	45.2	2.6e-96
4624987:4625003	attR	TTTGGTCGGCACGAGAG	NA	NA	NA	NA
>prophage 12
CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	4729771	4736676	5616605		Planktothrix_phage(33.33%)	6	NA	NA
AUV41337.1|4729771_4730635_+	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AUV40300.1|4730645_4731419_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AUV41338.1|4731659_4732553_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	30.2	2.1e-15
AUV40301.1|4732798_4734160_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AUV40302.1|4734478_4735201_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
AUV40303.1|4735197_4736676_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.3	1.4e-29
>prophage 13
CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	4778053	4786431	5616605		Enterobacteria_phage(28.57%)	7	NA	NA
AUV40330.1|4778053_4779460_+	NADP-dependent phosphogluconate dehydrogenase	NA	E3SPS4	Prochlorococcus_phage	28.8	2.9e-27
AUV40331.1|4779683_4780748_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	1.9e-103
AUV40332.1|4780774_4781644_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.4	1.5e-111
AUV40333.1|4781675_4782566_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
AUV40334.1|4782580_4783135_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
AUV40335.1|4783314_4784481_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
AUV40336.1|4785426_4786431_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
>prophage 14
CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	4895639	4954242	5616605	coat,tail,holin,terminase,head,tRNA,integrase	Escherichia_phage(20.97%)	78	4902035:4902057	4948050:4948072
AUV40439.1|4895639_4897373_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
AUV40440.1|4897608_4898178_+	VOC family protein	NA	NA	NA	NA	NA
AUV40441.1|4898254_4898998_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AUV40442.1|4899079_4900084_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AUV40443.1|4900080_4900824_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
AUV40444.1|4900863_4901259_-	hypothetical protein	NA	NA	NA	NA	NA
AUV40445.1|4901311_4902085_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
4902035:4902057	attL	CACGCAGTTAAAGTGGCGGGCGT	NA	NA	NA	NA
AUV40446.1|4902087_4903347_-|integrase	integrase	integrase	A0A286S1S8	Klebsiella_phage	90.2	8.1e-223
AUV40447.1|4903389_4903635_-	excisionase	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
AUV40448.1|4903638_4903857_-	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	50.0	3.3e-07
AUV40449.1|4903853_4904045_-	hypothetical protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	6.0e-13
AUV40450.1|4904041_4904266_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	73.2	1.6e-20
AUV40451.1|4904588_4905062_-	hypothetical protein	NA	A0A2P0PAG0	Pectobacterium_phage	47.5	5.1e-21
AUV40452.1|4905058_4905217_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
AUV40453.1|4905213_4905837_-	YqaJ-like viral recombinase	NA	S0A2A9	Cellulophaga_phage	49.0	4.6e-46
AUV40454.1|4905833_4906337_-	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	30.1	9.3e-13
AUV40455.1|4906348_4906633_-	hypothetical protein	NA	G8C7T1	Escherichia_phage	80.9	5.0e-40
AUV40456.1|4906640_4907612_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	89.3	7.4e-67
AUV40457.1|4907699_4907894_-	hypothetical protein	NA	NA	NA	NA	NA
AUV40458.1|4907993_4908263_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	42.9	6.9e-07
AUV40459.1|4908622_4909312_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.7	5.1e-62
AUV40460.1|4909439_4909673_+	transcriptional regulator	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
AUV40461.1|4909713_4909935_+	transcriptional regulator	NA	NA	NA	NA	NA
AUV40462.1|4910020_4910818_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	72.8	3.5e-91
AUV41347.1|4910877_4911843_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	79.3	3.1e-65
AUV40463.1|4911839_4912577_+	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	55.6	3.1e-65
AUV40464.1|4912573_4912876_+	hypothetical protein	NA	NA	NA	NA	NA
AUV40465.1|4913309_4913705_+	hypothetical protein	NA	G8C7U4	Escherichia_phage	80.6	8.8e-59
AUV41348.1|4914511_4915072_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	30.3	2.7e-05
AUV40466.1|4915071_4915320_+	hypothetical protein	NA	NA	NA	NA	NA
AUV40467.1|4915485_4915806_+	hypothetical protein	NA	NA	NA	NA	NA
AUV40468.1|4916160_4916628_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	5.7e-33
AUV40469.1|4916608_4916779_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	3.3e-15
AUV40470.1|4916771_4917380_+	protein NinG	NA	A0A0M4RU10	Salmonella_phage	62.7	2.3e-50
AUV40471.1|4917376_4917760_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	43.8	1.0e-19
AUV40472.1|4917893_4918703_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	77.0	4.8e-120
AUV40473.1|4919739_4920009_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	77.2	7.4e-33
AUV41349.1|4919986_4920484_+	lysozyme	NA	K7P7Q3	Enterobacteria_phage	84.2	9.6e-79
AUV40474.1|4920480_4920870_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	45.2	1.1e-21
AUV40475.1|4921328_4921976_+	hypothetical protein	NA	I6S676	Salmonella_phage	79.6	2.0e-100
AUV40476.1|4922006_4922495_+	hypothetical protein	NA	I6S1P9	Salmonella_phage	72.9	1.5e-47
AUV40477.1|4922491_4924060_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	86.8	6.2e-289
AUV40478.1|4924071_4925523_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	52.1	5.4e-122
AUV41350.1|4925458_4926451_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.8	5.5e-118
AUV40479.1|4926590_4927109_+	Fis family transcriptional regulator	NA	Q4TZV0	Escherichia_virus	39.9	9.2e-24
AUV40480.1|4927182_4928538_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	53.1	8.6e-130
AUV40481.1|4928537_4928999_+	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
AUV40482.1|4928995_4930051_+|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.2	3.8e-101
AUV40483.1|4930083_4930323_+	hypothetical protein	NA	NA	NA	NA	NA
AUV40484.1|4930325_4930706_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.4e-29
AUV40485.1|4930705_4930879_+	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	56.1	2.4e-13
AUV40486.1|4930878_4931241_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	1.6e-19
AUV40487.1|4931243_4931669_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
AUV40488.1|4931665_4932058_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.2	9.7e-34
AUV40489.1|4932126_4932879_+	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	42.1	4.4e-43
AUV40490.1|4932931_4933609_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.5	1.8e-72
AUV40491.1|4933784_4934540_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	1.8e-60
AUV40492.1|4934542_4934797_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	71.4	4.4e-19
AUV40493.1|4934793_4935306_+	hypothetical protein	NA	NA	NA	NA	NA
AUV41351.1|4935346_4935700_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AUV41352.1|4935825_4935993_+	Arc family DNA-binding protein	NA	G9L6D7	Escherichia_phage	69.8	7.3e-15
AUV40494.1|4935979_4936684_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	43.9	9.0e-38
AUV40495.1|4936749_4937535_+	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.3	3.2e-84
AUV40496.1|4937625_4941066_+	hypothetical protein	NA	Q5G8W8	Enterobacteria_phage	47.3	1.7e-153
AUV41353.1|4941165_4941585_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
AUV40497.1|4941584_4942055_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
AUV40498.1|4942051_4942447_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	2.3e-35
AUV40499.1|4942433_4944911_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	45.2	1.1e-196
AUV40500.1|4944999_4947279_+	hypothetical protein	NA	A0A0H5ARL8	Pseudomonas_phage	38.7	4.2e-12
AUV40501.1|4947378_4947558_+	hypothetical protein	NA	H2DE47	Erwinia_phage	50.0	9.3e-08
AUV40502.1|4947573_4947762_+	hypothetical protein	NA	A0A248SL22	Klebsiella_phage	67.3	3.8e-12
AUV40503.1|4948141_4948708_-	hydrolase	NA	NA	NA	NA	NA
4948050:4948072	attR	CACGCAGTTAAAGTGGCGGGCGT	NA	NA	NA	NA
AUV40504.1|4948975_4950763_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
AUV40505.1|4950764_4951208_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AUV40506.1|4951235_4951976_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUV40507.1|4952010_4952532_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	3.4e-10
AUV40508.1|4952611_4953223_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AUV40509.1|4953231_4954242_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	1.4e-07
>prophage 1
CP026175	Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence	172259	3592	12508	172259		Macacine_betaherpesvirus(33.33%)	10	NA	NA
AUV35690.1|3592_4759_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
AUV35691.1|4758_5730_+	plasmid-partitioning protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	9.2e-150
AUV35692.1|6729_6987_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35693.1|7012_7318_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35694.1|7371_7623_-	plasmid stabilization protein	NA	NA	NA	NA	NA
AUV35695.1|7701_8973_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.0	8.6e-156
AUV35696.1|8972_9398_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
AUV35697.1|9552_9804_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35698.1|9803_11288_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AUV35699.1|11536_12508_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
>prophage 2
CP026175	Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence	172259	82213	156752	172259	transposase,protease	Salmonella_phage(27.27%)	81	NA	NA
AUV35788.1|82213_83182_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	2.5e-184
AUV35789.1|83259_83631_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35884.1|84129_84513_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35790.1|84639_84768_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
AUV35791.1|84767_86951_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
AUV35792.1|90128_91133_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AUV35793.1|91211_94184_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AUV35794.1|94186_94744_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AUV35795.1|94873_95086_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AUV35885.1|95048_95168_+	mercury resistance protein	NA	NA	NA	NA	NA
AUV35796.1|95151_95388_-	mercury resistance protein	NA	NA	NA	NA	NA
AUV35797.1|95384_95750_-	transcriptional regulator	NA	NA	NA	NA	NA
AUV35798.1|95767_97450_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-38
AUV35799.1|97488_97896_-	mercury transport protein MerC	NA	NA	NA	NA	NA
AUV35800.1|97923_98199_-	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AUV35801.1|98214_98565_-	mercuric transporter	NA	NA	NA	NA	NA
AUV35802.1|98636_99092_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUV35803.1|99630_99888_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35804.1|100398_100626_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35805.1|102310_102424_-	replication initiation protein	NA	NA	NA	NA	NA
AUV35886.1|102828_103020_+	Rop family plasmid primer RNA-binding protein	NA	NA	NA	NA	NA
AUV35806.1|103325_106223_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AUV35807.1|106317_106923_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AUV35808.1|106965_107805_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35809.1|108054_108936_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AUV35810.1|109460_110165_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV35811.1|110155_110341_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35812.1|110286_111003_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	2.4e-139
AUV35813.1|111290_111581_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AUV35814.1|111577_111979_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AUV35815.1|111968_112325_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AUV35816.1|112579_112906_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35817.1|112902_113403_+|transposase	transposase	transposase	NA	NA	NA	NA
AUV35818.1|113399_113771_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35819.1|113764_114322_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
AUV35820.1|114400_115405_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AUV35821.1|115928_116561_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35822.1|116589_117993_-|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
AUV35823.1|118193_118676_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUV35824.1|118663_118930_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AUV35825.1|119105_119360_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35826.1|119435_119693_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35827.1|119741_119945_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AUV35828.1|119975_120344_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35829.1|120387_120882_-	DNA-binding protein	NA	NA	NA	NA	NA
AUV35830.1|120912_121479_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35831.1|121475_121739_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35832.1|122028_123567_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	7.4e-295
AUV35833.1|123615_123963_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	3.3e-62
AUV35834.1|123959_124364_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
AUV35835.1|124601_124721_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUV35836.1|125099_125534_-	copper-binding protein	NA	NA	NA	NA	NA
AUV35837.1|125749_127150_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	2.4e-18
AUV35838.1|127146_127827_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.8	3.0e-30
AUV35839.1|127881_128811_-	copper resistance protein D	NA	NA	NA	NA	NA
AUV35840.1|128815_129196_-	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AUV35841.1|129235_130135_-	copper resistance protein B	NA	NA	NA	NA	NA
AUV35842.1|130131_131949_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AUV35843.1|132182_132632_+	copper resistance protein	NA	NA	NA	NA	NA
AUV35844.1|132920_133658_+	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AUV35845.1|133691_133889_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AUV35846.1|133929_136377_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
AUV35847.1|136503_136944_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35848.1|137030_140177_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.3	1.8e-61
AUV35849.1|140187_141480_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUV35850.1|141593_141956_-	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUV35851.1|141984_143370_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35852.1|143559_144240_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
AUV35853.1|144232_145708_+	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	30.1	7.9e-28
AUV35854.1|145953_146385_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AUV35855.1|146549_147518_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	1.7e-180
AUV35856.1|147598_147949_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	6.0e-19
AUV35887.1|148134_149043_-	HNH endonuclease	NA	NA	NA	NA	NA
AUV35857.1|149587_150610_-	DNA helicase UvrD	NA	NA	NA	NA	NA
AUV35858.1|150594_152157_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AUV35859.1|152230_152647_-	PIN domain nuclease	NA	NA	NA	NA	NA
AUV35860.1|152643_152874_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AUV35888.1|153165_153759_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35861.1|153777_154218_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35862.1|155667_156009_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35863.1|156116_156752_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 1
CP026174	Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-0d7f, complete sequence	93680	17714	61602	93680	transposase	Faecalibacterium_phage(11.76%)	57	NA	NA
AUV35603.1|17714_18683_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	2.9e-180
AUV35604.1|18851_19448_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
AUV35605.1|19440_20865_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AUV35606.1|20864_21605_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
AUV35607.1|21591_22158_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
AUV35608.1|22177_22483_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
AUV35609.1|22496_22865_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
AUV35610.1|22933_23134_-	TraY domain-containing protein	NA	NA	NA	NA	NA
AUV35611.1|23218_23920_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35612.1|24154_24547_-	conjugal transfer protein TraM	NA	NA	NA	NA	NA
AUV35613.1|24980_25475_+	lytic transglycosylase	NA	NA	NA	NA	NA
AUV35614.1|25497_26040_-	antirestriction protein	NA	NA	NA	NA	NA
AUV35615.1|26232_26496_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35616.1|26665_27499_-	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	34.8	3.7e-22
AUV35617.1|27545_27776_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35618.1|27866_28214_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35619.1|28269_28608_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	54.1	1.6e-21
AUV35620.1|28604_28787_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35621.1|28870_29056_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35622.1|29429_30104_-	methyltransferase	NA	NA	NA	NA	NA
AUV35679.1|30102_30300_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35623.1|30353_30584_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35680.1|30676_30904_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35624.1|31719_32043_-	theronine dehydrogenase	NA	NA	NA	NA	NA
AUV35625.1|32039_32768_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AUV35626.1|32764_33199_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AUV35627.1|33239_35240_-	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	28.4	3.3e-21
AUV35628.1|35308_35557_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AUV35629.1|35606_36164_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.0	1.1e-49
AUV35630.1|36817_37024_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35631.1|36972_37293_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35632.1|37317_37581_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	53.8	3.4e-14
AUV35633.1|37781_37973_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35681.1|38013_38520_-	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.9	6.9e-08
AUV35682.1|38564_38993_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.9	2.2e-10
AUV35683.1|39425_40190_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35634.1|40236_40647_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AUV35635.1|40692_40914_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35636.1|40913_41615_-	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	34.3	2.6e-21
AUV35637.1|42051_42282_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35638.1|42496_43717_-|transposase	ISL3-like element ISCfr12 family transposase	transposase	NA	NA	NA	NA
AUV35639.1|43813_44239_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	54.7	4.9e-31
AUV35640.1|44238_45510_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	1.6e-157
AUV35641.1|45728_46052_-	molecular chaperone GroEL	NA	NA	NA	NA	NA
AUV35642.1|46147_46789_-	ParA family protein	NA	A4JWV7	Burkholderia_virus	25.5	1.1e-05
AUV35643.1|47826_48447_+	serine recombinase	NA	A0A219Y912	Aeromonas_phage	31.0	1.0e-08
AUV35644.1|48466_48733_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35645.1|48853_49807_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	57.1	9.5e-75
AUV35646.1|49803_50415_-	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
AUV35647.1|50732_51011_-	cytoplasmic protein	NA	NA	NA	NA	NA
AUV35648.1|51048_51780_-	HNH endonuclease	NA	NA	NA	NA	NA
AUV35649.1|52074_52773_-	NYN domain-containing protein	NA	NA	NA	NA	NA
AUV35650.1|53501_54497_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.9	4.1e-20
AUV35651.1|54632_55268_-	peptidase	NA	NA	NA	NA	NA
AUV35652.1|55485_56091_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	7.2e-20
AUV35653.1|57996_58701_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV35654.1|60597_61602_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP026172	Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence	243967	175061	184490	243967	transposase	Burkholderia_phage(25.0%)	14	NA	NA
AUV35400.1|175061_175640_+	HNH endonuclease	NA	W0LI46	Edwardsiella_phage	57.6	1.2e-40
AUV35401.1|175630_175945_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35489.1|176069_176480_+	DNA-binding protein	NA	Q71TH9	Escherichia_phage	60.0	1.3e-41
AUV35402.1|176664_177024_-	hypothetical protein	NA	NA	NA	NA	NA
AUV35403.1|177254_177698_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35404.1|177739_177943_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35490.1|177951_178212_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	41.0	5.9e-11
AUV35405.1|178244_178679_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35406.1|178675_179419_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	49.6	1.8e-60
AUV35407.1|179545_180961_+	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	4.1e-106
AUV35408.1|181050_182253_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.1	1.1e-35
AUV35409.1|182299_183268_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.7	2.1e-186
AUV35410.1|183896_184145_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35411.1|184172_184490_+	DUF3846 domain-containing protein	NA	A0A2H4P7A4	Pseudomonas_phage	46.5	6.0e-10
>prophage 2
CP026172	Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence	243967	204430	218115	243967	tail,transposase	Salmonella_phage(31.25%)	21	NA	NA
AUV35430.1|204430_205399_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.7	2.1e-186
AUV35431.1|205808_206129_+	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.2e-28
AUV35432.1|206209_206524_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35433.1|206644_206896_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
AUV35434.1|207061_207280_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
AUV35435.1|207373_207871_+	hypothetical protein	NA	A0A076G835	Escherichia_phage	57.0	1.5e-23
AUV35436.1|207867_208056_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35437.1|208533_208761_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.9e-10
AUV35438.1|208757_209402_+	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	39.8	1.4e-05
AUV35439.1|209402_209726_+	hypothetical protein	NA	E5AGF3	Erwinia_phage	46.9	1.6e-13
AUV35440.1|209818_210205_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
AUV35441.1|210484_210700_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35442.1|211455_211938_+	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	58.3	4.4e-12
AUV35443.1|211934_212624_+	hypothetical protein	NA	A0A1V0E5M5	Salmonella_phage	31.1	2.4e-19
AUV35444.1|212623_212809_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35445.1|213078_213351_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	48.9	1.5e-12
AUV35446.1|213924_214110_+	hypothetical protein	NA	A0A1V0E5M0	Salmonella_phage	67.4	2.1e-10
AUV35447.1|214119_214569_+|tail	phage tail protein	tail	A0A1I9KFG8	Aeromonas_phage	45.2	2.9e-18
AUV35448.1|214638_215247_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	42.2	1.5e-25
AUV35449.1|215534_215990_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35450.1|216873_218115_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	28.9	6.7e-12
>prophage 1
CP026173	Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-c4ac, complete sequence	64271	17427	38860	64271	protease,transposase	Salmonella_phage(42.86%)	23	NA	NA
AUV35520.1|17427_18132_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV35521.1|20028_21033_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AUV35522.1|21214_21391_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AUV35523.1|21720_22536_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AUV35524.1|22596_23400_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AUV35525.1|23399_24236_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AUV35526.1|25161_26166_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AUV35527.1|26244_29217_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AUV35528.1|29219_29777_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AUV35529.1|29906_30119_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AUV35575.1|30081_30201_+	mercury resistance protein	NA	NA	NA	NA	NA
AUV35530.1|30184_30421_-	mercury resistance protein	NA	NA	NA	NA	NA
AUV35531.1|30417_30783_-	transcriptional regulator	NA	NA	NA	NA	NA
AUV35532.1|30800_32483_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-38
AUV35533.1|32521_32929_-	mercury transport protein MerC	NA	NA	NA	NA	NA
AUV35534.1|32956_33232_-	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AUV35535.1|33247_33598_-	mercuric transporter	NA	NA	NA	NA	NA
AUV35536.1|33669_34125_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUV35537.1|34824_35160_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
AUV35538.1|35332_35614_+	cytoplasmic protein	NA	NA	NA	NA	NA
AUV35539.1|35667_36279_+	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
AUV35540.1|36427_37132_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUV35541.1|37858_38860_-|protease	CAAX protease	protease	NA	NA	NA	NA
>prophage 2
CP026173	Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-c4ac, complete sequence	64271	45467	56182	64271		Enterobacteria_phage(25.0%)	11	NA	NA
AUV35553.1|45467_46442_-	chromosome partitioning protein ParB	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
AUV35554.1|46438_47644_-	chromosome partitioning protein ParA	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
AUV35555.1|47965_48862_-	replication initiation protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
AUV35556.1|49262_50534_-	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
AUV35557.1|50533_50965_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AUV35558.1|51123_51375_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35559.1|51374_52859_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.9e-29
AUV35560.1|53107_54079_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AUV35561.1|54081_54753_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
AUV35562.1|54813_55044_+	hypothetical protein	NA	NA	NA	NA	NA
AUV35563.1|55480_56182_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	2.1e-26
