The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026122	Aeromonas sp. ASNIH5 chromosome, complete genome	4759223	23589	94443	4759223	transposase,tRNA	Burkholderia_phage(23.08%)	60	NA	NA
AUT40269.1|23589_24792_+|transposase	ISL3 family transposase ISAeme19	transposase	A9YX10	Burkholderia_phage	53.2	1.0e-102
AUT40270.1|25452_26001_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
AUT40271.1|26169_28407_+	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AUT40272.1|28424_30074_+	phosphate ABC transporter, permease protein PstA	NA	NA	NA	NA	NA
AUT40273.1|30178_30997_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	27.8	2.8e-14
AUT40274.1|31105_31816_+	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
AUT40275.1|32057_33377_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
AUT44158.1|33401_33938_+	hypothetical protein	NA	NA	NA	NA	NA
AUT40276.1|34233_35136_+	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
AUT40277.1|35145_36555_+	amino acid permease	NA	NA	NA	NA	NA
AUT40278.1|36621_37497_-	sterol desaturase family protein	NA	NA	NA	NA	NA
AUT40279.1|37660_38404_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	5.2e-36
AUT40280.1|38493_39465_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUT44159.1|39537_40389_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUT40281.1|40807_42010_+|transposase	ISL3 family transposase ISAeme19	transposase	A9YX10	Burkholderia_phage	53.2	1.0e-102
AUT40282.1|42099_43227_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUT40283.1|43335_43731_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
AUT40284.1|43964_44738_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUT44160.1|44780_45464_-	hypothetical protein	NA	NA	NA	NA	NA
AUT40285.1|45514_46894_-	alkaline phosphatase	NA	NA	NA	NA	NA
AUT40286.1|46906_48298_-	alkaline phosphatase	NA	NA	NA	NA	NA
AUT40287.1|48639_49590_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
AUT40288.1|49891_51040_+	MFS transporter	NA	NA	NA	NA	NA
AUT40289.1|51129_52026_-	histone deacetylase	NA	A0A2K9L4C2	Tupanvirus	27.4	1.8e-11
AUT40290.1|52096_52756_-	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
AUT40291.1|52876_54949_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.6	9.4e-43
AUT40292.1|55317_56391_+	porin	NA	NA	NA	NA	NA
AUT44161.1|56710_57550_+	hypothetical protein	NA	NA	NA	NA	NA
AUT40293.1|57685_58876_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AUT40294.1|58955_60461_-	ATP-binding protein	NA	A0A248XCZ8	Klebsiella_phage	45.1	4.4e-82
AUT40295.1|60576_61071_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
AUT40296.1|61064_61583_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
AUT40297.1|61593_63840_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
AUT40298.1|63974_65744_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	1.5e-60
AUT40299.1|65743_66739_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AUT40300.1|66850_67048_+	hypothetical protein	NA	NA	NA	NA	NA
AUT40301.1|67044_67824_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AUT40302.1|68034_68679_+	two-component system response regulator UvrY	NA	NA	NA	NA	NA
AUT40303.1|68789_70643_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
AUT40304.1|70856_71411_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AUT40305.1|72649_73576_+	hypothetical protein	NA	NA	NA	NA	NA
AUT40306.1|73568_74036_+	hypothetical protein	NA	NA	NA	NA	NA
AUT40307.1|74182_76069_+	hypothetical protein	NA	NA	NA	NA	NA
AUT40308.1|76337_77711_+	hypothetical protein	NA	C7BGE8	Burkholderia_phage	29.5	7.7e-09
AUT40309.1|77707_78427_+	TIGR02646 family protein	NA	NA	NA	NA	NA
AUT40310.1|78577_79739_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	51.5	2.6e-82
AUT40311.1|80192_81098_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUT40312.1|81243_82641_+	amidohydrolase	NA	NA	NA	NA	NA
AUT40313.1|82655_83129_+	hypothetical protein	NA	NA	NA	NA	NA
AUT40314.1|83291_84275_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUT40315.1|84327_84963_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUT40316.1|85118_85367_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AUT40317.1|85495_86221_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AUT40318.1|86234_86921_-	DUF4269 domain-containing protein	NA	NA	NA	NA	NA
AUT40319.1|86910_87408_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUT40320.1|87599_88976_+|tRNA	cysteine--tRNA ligase	tRNA	H2EDD6	Moumouvirus	29.5	3.9e-45
AUT44162.1|89386_90591_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.1	4.5e-114
AUT40321.1|90679_90925_-	hypothetical protein	NA	NA	NA	NA	NA
AUT40322.1|91850_93411_+|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
AUT44163.1|93432_94443_+|transposase	IS481-like element ISAs19 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	43.2	2.6e-70
>prophage 2
CP026122	Aeromonas sp. ASNIH5 chromosome, complete genome	4759223	274030	281686	4759223		Mycoplasma_phage(33.33%)	8	NA	NA
AUT40458.1|274030_275245_+	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.6	3.0e-33
AUT40459.1|275299_275683_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.0	2.8e-54
AUT40460.1|275698_276022_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	43.9	1.2e-21
AUT40461.1|276212_276731_+	co-chaperone HscB	NA	NA	NA	NA	NA
AUT40462.1|276759_278607_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	2.2e-104
AUT40463.1|278608_278947_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AUT40464.1|279104_280406_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	35.9	1.0e-34
AUT40465.1|280402_281686_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.4	3.3e-30
>prophage 3
CP026122	Aeromonas sp. ASNIH5 chromosome, complete genome	4759223	575306	687262	4759223	transposase,tRNA,protease,integrase	Escherichia_phage(19.23%)	105	642415:642474	650663:650767
AUT40682.1|575306_576215_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	78.9	4.3e-117
AUT40683.1|576282_577230_-	universal stress protein UspE	NA	NA	NA	NA	NA
AUT40684.1|577366_578122_-	transcriptional regulator FNR	NA	NA	NA	NA	NA
AUT44195.1|578190_578877_-	cytochrome biogenesis protein	NA	NA	NA	NA	NA
AUT44196.1|579148_581545_-	ATPase P	NA	A0A218MNH6	uncultured_virus	30.0	8.2e-75
AUT40685.1|581633_582122_-	cytochrome C oxidase Cbb3	NA	NA	NA	NA	NA
AUT40686.1|582235_583225_-	cytochrome-c oxidase, cbb3-type subunit III	NA	NA	NA	NA	NA
AUT40687.1|583224_583404_-	CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone	NA	NA	NA	NA	NA
AUT40688.1|583415_584030_-	cytochrome-c oxidase, cbb3-type subunit II	NA	NA	NA	NA	NA
AUT40689.1|584048_585473_-	cytochrome-c oxidase, cbb3-type subunit I	NA	NA	NA	NA	NA
AUT40690.1|585752_586211_+	hypothetical protein	NA	NA	NA	NA	NA
AUT40691.1|586319_586778_+	GAF domain-containing protein	NA	NA	NA	NA	NA
AUT40692.1|586879_587524_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
AUT40693.1|587532_589548_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.2	3.2e-96
AUT40694.1|589677_592302_+	aminopeptidase N	NA	NA	NA	NA	NA
AUT40695.1|592369_592591_+	DUF2835 domain-containing protein	NA	NA	NA	NA	NA
AUT40696.1|592865_597707_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
AUT40697.1|597754_598765_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AUT40698.1|598850_599387_+	cell division protein ZapC	NA	NA	NA	NA	NA
AUT44197.1|599721_601866_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	W6LLI2	Streptococcus_phage	27.1	1.5e-14
AUT40699.1|601865_602093_+	glutaredoxin family protein	NA	NA	NA	NA	NA
AUT40700.1|602165_604076_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	1.7e-51
AUT40701.1|604084_605734_+	GlyGly-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
AUT44198.1|605894_606071_+	ribosome modulation factor	NA	NA	NA	NA	NA
AUT40702.1|606151_606712_-	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA	NA	NA	NA	NA	NA
AUT40703.1|606790_608770_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
AUT40704.1|608850_609213_-	transcriptional regulator	NA	NA	NA	NA	NA
AUT40705.1|609336_609588_+	hypothetical protein	NA	NA	NA	NA	NA
AUT40706.1|609574_611101_+	phage replication initiation protein	NA	G8IRU5	Vibrio_phage	40.0	4.0e-59
AUT40707.1|611128_611449_+	hypothetical protein	NA	NA	NA	NA	NA
AUT40708.1|611752_611965_+	Flexible pilin	NA	NA	NA	NA	NA
AUT40709.1|613419_613734_+	DUF2523 domain-containing protein	NA	A0A0F6YNQ7	Vibrio_phage	31.5	1.9e-08
AUT40710.1|613737_614952_+	zona occludens toxin	NA	A0A0N9H972	Vibrio_phage	48.6	1.1e-59
AUT40711.1|614938_615211_+	hypothetical protein	NA	NA	NA	NA	NA
AUT40712.1|615592_617014_+|transposase	IS66 family transposase ISKpn15	transposase	NA	NA	NA	NA
AUT40713.1|616968_617835_-	hypothetical protein	NA	NA	NA	NA	NA
AUT40714.1|618014_618425_-	hypothetical protein	NA	NA	NA	NA	NA
AUT40715.1|618537_618888_-	regulator	NA	R9TI53	Vibrio_phage	53.1	1.8e-18
AUT40716.1|619079_620375_-|integrase	integrase	integrase	NA	NA	NA	NA
AUT40717.1|620655_620961_-	multidrug DMT transporter permease	NA	NA	NA	NA	NA
AUT40718.1|621175_621820_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AUT40719.1|621797_622406_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AUT40720.1|622457_625010_+	MCE family protein	NA	NA	NA	NA	NA
AUT44199.1|625139_626570_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AUT44200.1|628565_628958_+	cysteine hydrolase	NA	NA	NA	NA	NA
AUT40721.1|629095_629980_+	EamA family transporter	NA	NA	NA	NA	NA
AUT44201.1|630011_631211_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AUT40722.1|631289_631967_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUT40723.1|631998_632241_-	relaxase	NA	NA	NA	NA	NA
AUT40724.1|632298_635265_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
AUT40725.1|635268_635829_-|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
AUT40726.1|635909_636227_-|transposase	transposase	transposase	NA	NA	NA	NA
AUT40727.1|636165_637179_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
AUT40728.1|637323_637821_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AUT40729.1|638228_639020_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AUT40730.1|639183_639531_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AUT40731.1|639524_640364_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AUT40732.1|640293_640473_-	hypothetical protein	NA	NA	NA	NA	NA
AUT40733.1|640491_640695_+	hypothetical protein	NA	NA	NA	NA	NA
AUT40734.1|640850_642056_+	chromate transporter	NA	NA	NA	NA	NA
AUT40735.1|642066_642372_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AUT40736.1|642387_642570_-	resolvase	NA	NA	NA	NA	NA
642415:642474	attL	TGTCATTTTCAGAAGACGACTGCACCAGTTGATTGGGCGTAATGGCTGTTGTGCAGCCAG	NA	NA	NA	NA
AUT40737.1|642598_643363_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AUT40738.1|643553_643910_-	hypothetical protein	NA	NA	NA	NA	NA
AUT40739.1|643855_644440_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUT40740.1|644439_645678_-	MFS transporter	NA	NA	NA	NA	NA
AUT40741.1|645674_646580_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AUT40742.1|646701_647406_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUT40743.1|647556_648372_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AUT40744.1|648561_649266_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUT40745.1|649312_650617_-|integrase	integrase	integrase	NA	NA	NA	NA
AUT44202.1|650548_650749_+	resolvase	NA	NA	NA	NA	NA
AUT40746.1|650971_651988_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
650663:650767	attR	CTGGCTGCACAACAGCCATTACGCCCAATCAACTGGTGCAGTCGTCTTCTGAAAATGACACTGACGAAGCGGCGCGGCCCTGCCTGACATCAAGTTAGGGTATAG	NA	NA	NA	NA
AUT40747.1|652737_653022_-	hypothetical protein	NA	NA	NA	NA	NA
AUT40748.1|653185_654214_-	recombinase	NA	NA	NA	NA	NA
AUT40749.1|654514_655294_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AUT40750.1|655306_656254_-	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	34.6	2.5e-06
AUT40751.1|656238_656880_-	dTMP kinase	NA	A0A1S6L347	Erwinia_phage	35.3	5.9e-12
AUT40752.1|656879_657881_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
AUT40753.1|657870_658716_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
AUT40754.1|658743_659985_-	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AUT40755.1|660066_660303_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	47.1	1.7e-09
AUT40756.1|660460_661195_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.0	6.3e-18
AUT40757.1|661208_662144_-	[acyl-carrier-protein] S-malonyltransferase	NA	NA	NA	NA	NA
AUT40758.1|662210_663170_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
AUT40759.1|663176_664196_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
AUT40760.1|664205_664373_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
AUT40761.1|664393_664915_-	23S rRNA accumulation protein YceD	NA	NA	NA	NA	NA
AUT44203.1|665111_665615_-	hypothetical protein	NA	NA	NA	NA	NA
AUT40762.1|665924_666506_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AUT40763.1|666558_667542_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
AUT40764.1|667917_671064_+	ribonuclease E	NA	NA	NA	NA	NA
AUT40765.1|671714_673187_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
AUT40766.1|673508_674090_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	40.0	3.1e-28
AUT40767.1|674153_674798_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.0	2.3e-32
AUT40768.1|674906_675989_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
AUT40769.1|676174_678208_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	23.1	7.0e-43
AUT40770.1|678279_679014_-	hypothetical protein	NA	NA	NA	NA	NA
AUT40771.1|679026_679299_-	acylphosphatase	NA	NA	NA	NA	NA
AUT40772.1|679384_680815_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	4.4e-23
AUT40773.1|680999_682193_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AUT40774.1|682660_683305_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUT40775.1|683564_684749_+	acyltransferase	NA	NA	NA	NA	NA
AUT40776.1|685097_686135_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
AUT40777.1|686131_687262_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
>prophage 4
CP026122	Aeromonas sp. ASNIH5 chromosome, complete genome	4759223	774523	908705	4759223	transposase,protease,integrase	Shigella_phage(13.64%)	115	832155:832170	872151:872166
AUT40841.1|774523_775726_+|transposase	ISL3 family transposase ISAeme19	transposase	A9YX10	Burkholderia_phage	53.2	1.0e-102
AUT40842.1|775847_776810_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
AUT40843.1|776806_777085_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
AUT40844.1|777191_777917_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
AUT40845.1|777935_778748_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
AUT40846.1|778750_779020_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
AUT40847.1|779218_779527_+	DUF440 domain-containing protein	NA	NA	NA	NA	NA
AUT44211.1|779580_780288_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AUT40848.1|780256_780484_-	hypothetical protein	NA	NA	NA	NA	NA
AUT40849.1|780572_780896_+	dsDNA-mimic protein	NA	NA	NA	NA	NA
AUT40850.1|780941_781253_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
AUT40851.1|781254_782124_-	nucleotide-binding protein	NA	NA	NA	NA	NA
AUT40852.1|782395_783628_+	hypothetical protein	NA	NA	NA	NA	NA
AUT40853.1|783682_784249_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUT40854.1|784245_784434_+	DUF4250 domain-containing protein	NA	NA	NA	NA	NA
AUT44212.1|784598_784775_+	hypothetical protein	NA	NA	NA	NA	NA
AUT40855.1|784870_785566_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AUT40856.1|785684_786575_+	EamA family transporter	NA	NA	NA	NA	NA
AUT40857.1|786648_787827_+	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
AUT40858.1|787955_788615_+	2-deoxyglucose-6-phosphatase	NA	NA	NA	NA	NA
AUT40859.1|788751_788955_+	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
AUT44213.1|789033_789324_-	hypothetical protein	NA	NA	NA	NA	NA
AUT40860.1|789426_790038_-	riboflavin synthase	NA	NA	NA	NA	NA
AUT40861.1|790171_790378_+	hypothetical protein	NA	NA	NA	NA	NA
AUT44214.1|790529_791909_+	MATE family efflux transporter	NA	NA	NA	NA	NA
AUT40862.1|792807_795210_-	DNA polymerase II	NA	A0A0N7KVW0	Yellowstone_lake_phycodnavirus	25.7	5.1e-32
AUT40863.1|795449_796328_+	pirin family protein	NA	NA	NA	NA	NA
AUT40864.1|796387_797248_-	serine protein kinase RIO	NA	NA	NA	NA	NA
AUT44215.1|797342_798338_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AUT40865.1|798492_799482_-	lipid A biosynthesis (KDO)2-(lauroyl)-lipid IVA acyltransferase	NA	NA	NA	NA	NA
AUT44216.1|799702_800683_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUT40866.1|800786_801671_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUT40867.1|801756_802734_-	oxidoreductase	NA	NA	NA	NA	NA
AUT40868.1|802769_803627_-	deoxyribonuclease IV	NA	A0A1V0SCI4	Indivirus	25.7	2.1e-17
AUT40869.1|803796_805833_-	beta-glucosidase	NA	NA	NA	NA	NA
AUT40870.1|806064_807075_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUT40871.1|807054_807990_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUT40872.1|808120_808879_+	KR domain-containing protein	NA	NA	NA	NA	NA
AUT40873.1|808974_810408_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.9	7.4e-47
AUT40874.1|810571_811489_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUT40875.1|811590_813165_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.7	2.7e-18
AUT40876.1|813247_815545_-	CbbBc protein	NA	NA	NA	NA	NA
AUT40877.1|815528_816314_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
AUT44217.1|816474_817353_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUT40878.1|817415_818267_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
AUT40879.1|818396_819350_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUT40880.1|819633_820593_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUT44218.1|820678_822187_+	sugar ABC transporter ATP-binding protein	NA	M1HRF1	Paramecium_bursaria_Chlorella_virus	30.2	1.7e-09
AUT40881.1|822188_823208_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUT40882.1|823200_824208_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
AUT40883.1|824391_825420_-	hydrolase	NA	NA	NA	NA	NA
AUT40884.1|826248_827411_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	51.9	1.8e-83
AUT44219.1|828933_830138_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.1	4.5e-114
AUT40885.1|830650_831292_-	hypothetical protein	NA	NA	NA	NA	NA
AUT40886.1|831464_833144_+|transposase	transposase	transposase	NA	NA	NA	NA
832155:832170	attL	GTCGGCCTGTGCCTTG	NA	NA	NA	NA
AUT40887.1|833146_834055_+|transposase	transposase	transposase	NA	NA	NA	NA
AUT40888.1|834051_835269_+|transposase	transposase	transposase	NA	NA	NA	NA
AUT44220.1|835330_835954_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	47.6	1.7e-35
AUT40889.1|836180_836576_-	glyoxalase	NA	NA	NA	NA	NA
AUT44221.1|836661_837102_-	ester cyclase	NA	NA	NA	NA	NA
AUT40890.1|837247_838261_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUT40891.1|838199_838499_+|transposase	transposase	transposase	NA	NA	NA	NA
AUT40892.1|838479_839640_-|integrase	integrase	integrase	NA	NA	NA	NA
AUT40893.1|839936_840725_-	hypothetical protein	NA	NA	NA	NA	NA
AUT40894.1|840816_842253_-	arginine-ornithine antiporter	NA	NA	NA	NA	NA
AUT40895.1|842618_843380_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	24.7	3.4e-06
AUT40896.1|843451_844372_-	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
AUT44222.1|844399_845500_-	crotonase	NA	NA	NA	NA	NA
AUT40897.1|845586_846378_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUT40898.1|846496_847654_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUT40899.1|847735_849247_-	methylmalonate-semialdehyde dehydrogenase (CoA acylating)	NA	NA	NA	NA	NA
AUT40900.1|849503_850652_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUT40901.1|850648_852265_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	7.4e-19
AUT40902.1|852274_853123_+	crotonase	NA	NA	NA	NA	NA
AUT40903.1|853232_855203_+	methylcrotonoyl-CoA carboxylase	NA	NA	NA	NA	NA
AUT40904.1|855199_856171_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	35.0	5.4e-41
AUT40905.1|856225_856639_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AUT44223.1|856922_859817_+	hypothetical protein	NA	NA	NA	NA	NA
AUT40906.1|860723_861320_+	hypothetical protein	NA	NA	NA	NA	NA
AUT40907.1|861398_862208_-	hypothetical protein	NA	NA	NA	NA	NA
AUT44224.1|862226_862640_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUT40908.1|862968_864468_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
AUT40909.1|864535_865342_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUT40910.1|865499_867287_+	cyclic nucleotide-binding protein	NA	NA	NA	NA	NA
AUT40911.1|867289_867916_+	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
AUT40912.1|868023_868335_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
AUT40913.1|868331_869987_+	cation acetate symporter	NA	NA	NA	NA	NA
AUT40914.1|870197_871790_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.1	5.5e-59
AUT44225.1|872072_873983_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
872151:872166	attR	GTCGGCCTGTGCCTTG	NA	NA	NA	NA
AUT40915.1|874135_874408_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	61.8	5.0e-21
AUT40916.1|874648_877003_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.7	1.3e-226
AUT40917.1|877142_878417_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.0	1.5e-128
AUT44226.1|878487_879090_-	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	61.5	3.2e-60
AUT40918.1|879197_880508_-	trigger factor	NA	NA	NA	NA	NA
AUT40919.1|880938_881373_+	YccF domain-containing protein	NA	NA	NA	NA	NA
AUT40920.1|881457_882048_+	5'-deoxynucleotidase	NA	NA	NA	NA	NA
AUT40921.1|882178_883420_-	lipoprotein-releasing system transmembrane subunit LolE	NA	NA	NA	NA	NA
AUT40922.1|883419_884166_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	39.7	8.9e-36
AUT40923.1|884158_885394_-	lipoprotein-releasing system transmembrane subunit LolC	NA	NA	NA	NA	NA
AUT40924.1|885470_886046_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
AUT40925.1|886088_889553_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
AUT40926.1|890090_891125_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	46.5	1.2e-75
AUT40927.1|891498_893115_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
AUT40928.1|893165_894086_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AUT40929.1|894271_894487_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
AUT40930.1|894611_895079_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AUT40931.1|895241_898016_+	peptidase M16	NA	A0A1V0SJA4	Klosneuvirus	26.2	9.2e-86
AUT40932.1|898300_898948_-	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
AUT40933.1|899058_900429_-	protein kinase	NA	NA	NA	NA	NA
AUT40934.1|900689_901220_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUT40935.1|901216_901999_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
AUT40936.1|901995_902367_+	hypothetical protein	NA	NA	NA	NA	NA
AUT40937.1|903604_904432_+	6-O-methylguanine DNA methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.8	7.3e-15
AUT40938.1|904574_905843_+|transposase	IS4 family transposase ISApu1	transposase	NA	NA	NA	NA
AUT40939.1|907436_908705_+|transposase	IS4 family transposase ISApu1	transposase	NA	NA	NA	NA
>prophage 5
CP026122	Aeromonas sp. ASNIH5 chromosome, complete genome	4759223	1532961	1569640	4759223	tail,transposase,head,integrase	Vibrio_phage(29.41%)	45	1550197:1550212	1577418:1577433
AUT41438.1|1532961_1535805_-|tail	phage tail protein	tail	A0A2I7S9D9	Vibrio_phage	44.8	2.1e-45
AUT41439.1|1535949_1536699_-	hypothetical protein	NA	NA	NA	NA	NA
AUT41440.1|1536698_1537145_-	hypothetical protein	NA	NA	NA	NA	NA
AUT41441.1|1537141_1537555_-	hypothetical protein	NA	B7SDP4	Haemophilus_phage	36.4	2.1e-15
AUT41442.1|1537556_1538018_-	hypothetical protein	NA	NA	NA	NA	NA
AUT41443.1|1538121_1539030_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	57.6	3.5e-103
AUT41444.1|1539074_1540250_-	hypothetical protein	NA	A0A0C4UQU6	Shigella_phage	48.2	1.5e-74
AUT41445.1|1540369_1540882_-	cytochrome b	NA	NA	NA	NA	NA
AUT41446.1|1541021_1541402_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AUT41447.1|1541425_1543054_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
AUT41448.1|1543414_1543861_-	phage virion morphogenesis protein	NA	NA	NA	NA	NA
AUT41449.1|1543860_1544061_-	hypothetical protein	NA	NA	NA	NA	NA
AUT41450.1|1544096_1545569_-	F protein	NA	A0A2H4IYU7	uncultured_Caudovirales_phage	50.7	2.9e-62
AUT41451.1|1545568_1547146_-	hypothetical protein	NA	J9SVY0	Pseudomonas_phage	47.9	9.4e-120
AUT41452.1|1547145_1548714_-	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	58.7	1.7e-161
AUT41453.1|1548713_1549289_-	DUF3486 domain-containing protein	NA	A0A0C4UQU5	Shigella_phage	68.4	6.1e-61
AUT41454.1|1549291_1549588_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	57.0	6.2e-17
AUT41455.1|1549584_1549899_-	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
AUT41456.1|1549879_1550107_-	molecular chaperone DnaK	NA	NA	NA	NA	NA
AUT41457.1|1550128_1550350_-	hypothetical protein	NA	NA	NA	NA	NA
1550197:1550212	attL	GATCCACCAGGGTGGA	NA	NA	NA	NA
AUT41458.1|1550342_1550660_-	hypothetical protein	NA	NA	NA	NA	NA
AUT41459.1|1550656_1551232_-	secretion activator protein	NA	B0ZSJ3	Halomonas_phage	31.0	4.3e-14
AUT41460.1|1551331_1552378_-	hypothetical protein	NA	NA	NA	NA	NA
AUT41461.1|1552401_1553963_-|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
AUT41462.1|1554339_1554771_-	transcriptional regulator	NA	NA	NA	NA	NA
AUT41463.1|1554760_1555375_-	regulatory protein GemA	NA	A0A2I7S9B8	Vibrio_phage	35.2	2.9e-24
AUT41464.1|1555528_1555765_-	hypothetical protein	NA	NA	NA	NA	NA
AUT41465.1|1555886_1556081_-	hypothetical protein	NA	NA	NA	NA	NA
AUT41466.1|1556093_1556714_-	sulfate transporter	NA	A0A2I7S9B0	Vibrio_phage	57.4	2.5e-60
AUT41467.1|1556724_1556904_-	hypothetical protein	NA	NA	NA	NA	NA
AUT41468.1|1556915_1557158_-	hypothetical protein	NA	NA	NA	NA	NA
AUT41469.1|1557222_1557774_-	transcriptional regulator	NA	NA	NA	NA	NA
AUT41470.1|1557757_1558390_-	hypothetical protein	NA	NA	NA	NA	NA
AUT41471.1|1558438_1559161_-	ATP-binding protein	NA	M4SPU5	Rhodobacter_phage	26.9	1.7e-20
AUT41472.1|1559204_1561418_-|integrase	integrase	integrase	A0A0M4U788	Ralstonia_phage	31.9	1.9e-33
AUT41473.1|1561410_1561656_-	hypothetical protein	NA	NA	NA	NA	NA
AUT44259.1|1561853_1562645_+	transcriptional regulator	NA	A0A2I7S9A5	Vibrio_phage	37.6	8.2e-40
AUT41474.1|1562967_1563687_+	hypothetical protein	NA	NA	NA	NA	NA
AUT41475.1|1563690_1564853_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	51.9	1.8e-83
AUT41476.1|1564916_1565159_-	hypothetical protein	NA	NA	NA	NA	NA
AUT41477.1|1565327_1565819_-	hypothetical protein	NA	NA	NA	NA	NA
AUT41478.1|1565815_1566136_-	hypothetical protein	NA	NA	NA	NA	NA
AUT41479.1|1566275_1566833_-	resolvase	NA	E5FFF9	Burkholderia_phage	35.1	2.3e-20
AUT41480.1|1567093_1567702_+	hypothetical protein	NA	NA	NA	NA	NA
AUT41481.1|1568079_1569640_+|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
1577418:1577433	attR	TCCACCCTGGTGGATC	NA	NA	NA	NA
>prophage 6
CP026122	Aeromonas sp. ASNIH5 chromosome, complete genome	4759223	2264239	2274208	4759223	tRNA	uncultured_Mediterranean_phage(25.0%)	10	NA	NA
AUT42080.1|2264239_2266105_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
AUT42081.1|2266318_2268106_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.1	1.5e-73
AUT42082.1|2268195_2268639_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	47.9	1.3e-26
AUT42083.1|2268654_2268870_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AUT42084.1|2269049_2270063_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	9.1e-108
AUT42085.1|2270136_2271120_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	33.7	3.8e-34
AUT42086.1|2271166_2272237_-	LysM peptidoglycan-binding domain-containing protein	NA	I2E8W3	Clostridium_phage	34.9	1.7e-11
AUT44304.1|2272246_2272822_-	hypothetical protein	NA	NA	NA	NA	NA
AUT42087.1|2272824_2273442_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.4	5.3e-34
AUT42088.1|2273446_2274208_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.6	4.8e-69
>prophage 7
CP026122	Aeromonas sp. ASNIH5 chromosome, complete genome	4759223	3065909	3121224	4759223	transposase,tRNA,integrase	Salmonella_phage(11.11%)	44	3065488:3065503	3105889:3105904
3065488:3065503	attL	GGCGGGATCCAGTTCC	NA	NA	NA	NA
AUT42753.1|3065909_3066923_-|integrase	integrase	integrase	NA	NA	NA	NA
AUT42754.1|3067013_3068282_-|transposase	IS4 family transposase ISApu1	transposase	NA	NA	NA	NA
AUT42755.1|3068599_3068971_-	hypothetical protein	NA	NA	NA	NA	NA
AUT42756.1|3069126_3070401_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
AUT42757.1|3070537_3071515_+	hypothetical protein	NA	NA	NA	NA	NA
AUT42758.1|3071802_3072741_+	chromate resistance protein	NA	NA	NA	NA	NA
AUT44365.1|3072923_3074087_+	chromate transporter	NA	NA	NA	NA	NA
AUT42759.1|3074261_3077222_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	76.6	0.0e+00
AUT42760.1|3077230_3077803_-	hypothetical protein	NA	NA	NA	NA	NA
AUT42761.1|3078725_3080339_+|transposase	IS1634-like element ISAs25 family transposase	transposase	NA	NA	NA	NA
AUT42762.1|3082045_3083026_-	hypothetical protein	NA	NA	NA	NA	NA
AUT42763.1|3083044_3084928_-	hypothetical protein	NA	NA	NA	NA	NA
AUT42764.1|3085025_3086813_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AUT42765.1|3086812_3088300_-	restriction endonuclease subunit M	NA	J7I0U9	Acinetobacter_phage	27.8	3.6e-36
AUT42766.1|3088420_3090886_-	restriction endonuclease subunit R	NA	A0A2I5ARD8	Synechococcus_phage	24.6	2.5e-10
AUT42767.1|3091649_3092273_-	resolvase	NA	NA	NA	NA	NA
AUT42768.1|3092372_3092621_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
AUT42769.1|3092747_3093323_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	52.7	5.6e-46
AUT42770.1|3093756_3094206_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
AUT42771.1|3094198_3094627_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AUT42772.1|3094797_3095052_+	transcriptional regulator	NA	NA	NA	NA	NA
AUT42773.1|3095051_3096371_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
AUT42774.1|3096791_3098774_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
AUT44366.1|3098770_3099673_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUT42775.1|3099704_3100469_-	iron-hydroxamate transporter ATP-binding subunit	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	3.9e-10
AUT42776.1|3100515_3102162_-	multidrug ABC transporter permease/ATP-binding protein	NA	NA	NA	NA	NA
AUT42777.1|3102222_3104331_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUT44367.1|3104600_3105152_+	sulfite reductase	NA	NA	NA	NA	NA
AUT42778.1|3105660_3107550_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
3105889:3105904	attR	GGCGGGATCCAGTTCC	NA	NA	NA	NA
AUT44368.1|3107570_3108197_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
AUT42779.1|3108224_3109028_+	ParA family protein	NA	Q8JL10	Natrialba_phage	36.0	3.1e-18
AUT42780.1|3109024_3109933_+	chromosome partitioning protein ParB	NA	A0A1C9EHW0	Gordonia_phage	38.2	1.5e-13
AUT44369.1|3110141_3110534_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
AUT42781.1|3110542_3111325_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
AUT42782.1|3111383_3111623_+	ATP synthase subunit C	NA	NA	NA	NA	NA
AUT42783.1|3111674_3112145_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
AUT42784.1|3112158_3112692_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
AUT42785.1|3112707_3114249_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
AUT42786.1|3114291_3115158_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
AUT42787.1|3115191_3116580_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
AUT44370.1|3116607_3117027_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
AUT42788.1|3117120_3118482_+	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A1V0SFS6	Hokovirus	30.5	1.1e-20
AUT42789.1|3118533_3119925_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
AUT42790.1|3120021_3121224_-|transposase	ISL3 family transposase ISAeme19	transposase	A9YX10	Burkholderia_phage	53.2	1.0e-102
>prophage 8
CP026122	Aeromonas sp. ASNIH5 chromosome, complete genome	4759223	4043737	4133646	4759223	holin,terminase,tRNA,capsid,transposase,head,portal,tail,protease,integrase	Vibrio_phage(16.22%)	93	4036768:4036785	4075073:4075090
4036768:4036785	attL	CTCCCAGCATCTGCATCA	NA	NA	NA	NA
AUT43562.1|4043737_4044655_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AUT43563.1|4044727_4044991_+	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AUT43564.1|4045054_4046341_+	GTPase HflX	NA	NA	NA	NA	NA
AUT43565.1|4046434_4047586_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
AUT43566.1|4047589_4048474_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
AUT43567.1|4048558_4048747_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
AUT43568.1|4048831_4049803_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	23.3	1.1e-06
AUT43569.1|4050045_4050357_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
AUT43570.1|4050374_4050632_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
AUT43571.1|4050821_4052024_+	GTPase ObgE	NA	NA	NA	NA	NA
AUT43572.1|4052391_4053762_+	hypothetical protein	NA	NA	NA	NA	NA
AUT43573.1|4053833_4056719_-	phosphodiesterase	NA	NA	NA	NA	NA
AUT43574.1|4056935_4057925_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AUT43575.1|4058108_4058594_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUT43576.1|4058720_4059542_-	bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2R4ALY4	Aeromonas_phage	42.5	2.3e-05
AUT43577.1|4059548_4059911_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
AUT43578.1|4059915_4060728_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
AUT44423.1|4060717_4061713_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
AUT43579.1|4061763_4063056_-	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
AUT43580.1|4063086_4065546_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
AUT43581.1|4065720_4066731_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AUT43582.1|4066727_4067396_+	mannose-1-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AUT43583.1|4067415_4068240_+	co-chaperone DjlA	NA	NA	NA	NA	NA
AUT43584.1|4068361_4069564_+|transposase	ISL3 family transposase ISAeme19	transposase	A9YX10	Burkholderia_phage	53.2	1.0e-102
AUT43585.1|4069637_4070993_-	adenine permease PurP	NA	A0A0R6PHV4	Moraxella_phage	37.8	7.9e-67
AUT43586.1|4071248_4071578_-	hypothetical protein	NA	NA	NA	NA	NA
AUT43587.1|4071689_4073357_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.8	3.9e-39
AUT43588.1|4073385_4074693_-|integrase	integrase	integrase	Q8W658	Enterobacteria_phage	39.4	7.9e-80
AUT43589.1|4074668_4074878_-	hypothetical protein	NA	NA	NA	NA	NA
AUT43590.1|4074944_4075418_-	single-stranded DNA-binding protein	NA	R9TR60	Vibrio_phage	59.6	3.2e-47
4075073:4075090	attR	CTCCCAGCATCTGCATCA	NA	NA	NA	NA
AUT43591.1|4075417_4075675_-	hypothetical protein	NA	NA	NA	NA	NA
AUT43592.1|4075730_4075925_-	hypothetical protein	NA	NA	NA	NA	NA
AUT43593.1|4075900_4076338_-	hypothetical protein	NA	NA	NA	NA	NA
AUT43594.1|4076334_4076529_-	hypothetical protein	NA	NA	NA	NA	NA
AUT43595.1|4076619_4078431_-	hypothetical protein	NA	Q5QF27	Pseudomonas_virus	44.8	4.8e-152
AUT43596.1|4078427_4080173_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	46.3	1.0e-50
AUT43597.1|4080210_4080414_-	hypothetical protein	NA	NA	NA	NA	NA
AUT43598.1|4082264_4082957_-	LexA family transcriptional repressor	NA	B1B6L9	Salmonella_phage	39.2	8.5e-25
AUT43599.1|4083064_4083283_+	hypothetical protein	NA	NA	NA	NA	NA
AUT43600.1|4083302_4083812_+	transcriptional regulator	NA	NA	NA	NA	NA
AUT44424.1|4083928_4084159_+	hypothetical protein	NA	NA	NA	NA	NA
AUT43601.1|4085224_4085887_+	replication protein P	NA	A0A1I9KFB0	Aeromonas_phage	63.3	3.7e-70
AUT43602.1|4085886_4086147_+	hypothetical protein	NA	A0A1I9KFB1	Aeromonas_phage	54.2	3.9e-15
AUT44425.1|4086670_4087874_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.1	4.5e-114
AUT43603.1|4087937_4088132_+	hypothetical protein	NA	A0A1I9KFG5	Aeromonas_phage	73.0	4.5e-16
AUT44426.1|4088131_4088359_+	hypothetical protein	NA	NA	NA	NA	NA
AUT43604.1|4088355_4088565_+	hypothetical protein	NA	NA	NA	NA	NA
AUT43605.1|4088557_4088863_+	hypothetical protein	NA	NA	NA	NA	NA
AUT43606.1|4088852_4089242_+	hypothetical protein	NA	A0A1V0E824	Vibrio_phage	52.3	3.9e-19
AUT43607.1|4089345_4090155_+	hypothetical protein	NA	U5P4K5	Shigella_phage	36.1	3.5e-30
AUT43608.1|4090576_4091059_-	toxin	NA	L7THB5	Pseudomonas_virus	36.0	9.2e-18
AUT43609.1|4091055_4091415_-	XRE family transcriptional regulator	NA	L7TKV7	Pseudomonas_virus	54.3	2.1e-22
AUT43610.1|4091553_4091859_+	hypothetical protein	NA	NA	NA	NA	NA
AUT43611.1|4092071_4092335_+	hypothetical protein	NA	NA	NA	NA	NA
AUT43612.1|4092331_4093321_+	hypothetical protein	NA	R9TRM9	Vibrio_phage	30.2	1.7e-34
AUT44427.1|4093440_4093686_+	hypothetical protein	NA	A0A067ZIN8	Vibrio_phage	58.2	1.4e-19
AUT44428.1|4093772_4094321_+	antitermination protein	NA	NA	NA	NA	NA
AUT43613.1|4094426_4095458_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
AUT43614.1|4095880_4096444_+	hypothetical protein	NA	NA	NA	NA	NA
AUT43615.1|4096502_4097339_+	hypothetical protein	NA	NA	NA	NA	NA
AUT43616.1|4097364_4098402_-|transposase	IS630-like element ISAeme16 family transposase	transposase	NA	NA	NA	NA
AUT43617.1|4099228_4100790_-|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
AUT43618.1|4101495_4102770_-	protein UmuC	NA	F1C5A5	Cronobacter_phage	56.0	4.9e-127
AUT43619.1|4102772_4103189_-	UV protection and mutation protein	NA	A0A1W6JNS2	Morganella_phage	51.9	1.1e-32
AUT43620.1|4103352_4103994_+	DUF159 family protein	NA	C7BGE4	Burkholderia_phage	42.9	5.3e-45
AUT43621.1|4104996_4105365_+	hypothetical protein	NA	NA	NA	NA	NA
AUT43622.1|4105393_4105642_+	hypothetical protein	NA	NA	NA	NA	NA
AUT44429.1|4105789_4106113_+|holin	phage holin, lambda family	holin	A5X9I3	Aeromonas_virus	52.5	1.3e-20
AUT43623.1|4106099_4106618_+	glycoside hydrolase	NA	V5YSX1	Pseudomonas_phage	77.2	1.3e-70
AUT43624.1|4106614_4107157_+	DUF2514 domain-containing protein	NA	A0A2D1GNE2	Pseudomonas_phage	52.5	9.4e-11
AUT43625.1|4107243_4107624_+	HNH endonuclease	NA	A0A1V0E8A5	Vibrio_phage	58.1	8.0e-33
AUT43626.1|4107719_4108205_+|terminase	phage terminase small subunit P27 family	terminase	A0A2D1GNP3	Pseudomonas_phage	59.6	1.1e-47
AUT43627.1|4108214_4109936_+|terminase	terminase	terminase	U5P0Q5	Shigella_phage	74.3	1.3e-260
AUT43628.1|4109929_4110118_+	hypothetical protein	NA	NA	NA	NA	NA
AUT43629.1|4110117_4111371_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	65.4	4.3e-160
AUT43630.1|4111358_4112294_+	serine peptidase	NA	Q6UAX7	Klebsiella_phage	50.5	3.7e-79
AUT43631.1|4112362_4113649_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	62.4	1.6e-141
AUT43632.1|4113891_4114203_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	39.3	1.6e-10
AUT43633.1|4114211_4114751_+	hypothetical protein	NA	NA	NA	NA	NA
AUT43634.1|4114750_4115308_+	hypothetical protein	NA	NA	NA	NA	NA
AUT43635.1|4115304_4115727_+	hypothetical protein	NA	NA	NA	NA	NA
AUT43636.1|4115766_4116516_+	hypothetical protein	NA	NA	NA	NA	NA
AUT43637.1|4117233_4120809_+	hypothetical protein	NA	A0A2I7S9D9	Vibrio_phage	32.1	2.3e-33
AUT43638.1|4120805_4121192_+	hypothetical protein	NA	NA	NA	NA	NA
AUT43639.1|4121188_4124806_+	curculin (mannose-binding) lectin protein	NA	A0A0M4U447	Ralstonia_phage	43.8	1.1e-269
AUT43640.1|4124851_4126057_+	hypothetical protein	NA	NA	NA	NA	NA
AUT44430.1|4126070_4127270_+	hypothetical protein	NA	NA	NA	NA	NA
AUT43641.1|4127768_4128173_+	hypothetical protein	NA	NA	NA	NA	NA
AUT43642.1|4128200_4130147_+	hypothetical protein	NA	NA	NA	NA	NA
AUT43643.1|4130143_4130368_+	hypothetical protein	NA	A0A088C533	Shewanella_sp._phage	41.8	4.1e-05
AUT43644.1|4130446_4130833_+	pilus assembly protein	NA	NA	NA	NA	NA
AUT43645.1|4130848_4131880_-|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
AUT44431.1|4132442_4133646_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.1	4.5e-114
>prophage 9
CP026122	Aeromonas sp. ASNIH5 chromosome, complete genome	4759223	4700901	4708126	4759223		Escherichia_phage(33.33%)	8	NA	NA
AUT44106.1|4700901_4701609_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.3	2.5e-27
AUT44107.1|4702534_4703620_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	50.9	4.5e-97
AUT44108.1|4703619_4704507_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.4	1.4e-27
AUT44109.1|4704630_4705506_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	63.8	4.7e-105
AUT44467.1|4705603_4706146_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	59.6	1.4e-54
AUT44110.1|4706154_4706556_+	dTDP-6-deoxy-3,4-keto-hexulose isomerase	NA	NA	NA	NA	NA
AUT44111.1|4706558_4707020_+	dTDP-6-deoxy-3,4-keto-hexulose isomerase	NA	NA	NA	NA	NA
AUT44112.1|4707022_4708126_+	aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.4	3.6e-41
