The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026085	Escherichia coli strain DH5alpha chromosome, complete genome	4833062	1085317	1092457	4833062		Escherichia_phage(83.33%)	6	NA	NA
AUT08005.1|1085317_1085956_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AUT08006.1|1085952_1087215_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AUT08007.1|1087211_1088120_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AUT08008.1|1088315_1089083_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AUT08009.1|1089133_1089790_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
AUT08010.1|1089895_1092457_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 2
CP026085	Escherichia coli strain DH5alpha chromosome, complete genome	4833062	1163996	1171760	4833062	transposase,integrase	Escherichia_phage(66.67%)	6	1155231:1155244	1172070:1172083
1155231:1155244	attL	TACCGCCGCAGTCA	NA	NA	NA	NA
AUT08076.1|1163996_1165158_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AUT08077.1|1165310_1167029_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
AUT08078.1|1167030_1168779_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
AUT08079.1|1168850_1169267_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
AUT11531.1|1169305_1170535_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
AUT08080.1|1171277_1171760_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1172070:1172083	attR	TGACTGCGGCGGTA	NA	NA	NA	NA
>prophage 3
CP026085	Escherichia coli strain DH5alpha chromosome, complete genome	4833062	1435519	1480663	4833062	lysis,portal,tail,terminase,holin,coat	Enterobacteria_phage(50.85%)	63	NA	NA
AUT08315.1|1435519_1436953_-	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
AUT08316.1|1437168_1438083_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
AUT08317.1|1438154_1439402_+	MFS transporter	NA	NA	NA	NA	NA
AUT08318.1|1439931_1440132_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AUT08319.1|1440255_1440600_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	95.6	6.5e-58
AUT08320.1|1440657_1441458_-	hypothetical protein	NA	K7P7Q8	Enterobacteria_phage	98.5	1.7e-157
AUT08321.1|1441500_1441785_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	92.6	9.4e-47
AUT08322.1|1441777_1442467_-	DUF551 domain-containing protein	NA	A0A2D1GLX9	Escherichia_phage	79.1	4.1e-96
AUT08323.1|1442468_1443068_-	hypothetical protein	NA	A5VWB3	Enterobacteria_phage	94.1	3.8e-45
AUT08324.1|1443064_1443709_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	98.1	1.1e-130
AUT08325.1|1443705_1444224_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	64.2	6.6e-54
AUT08326.1|1444220_1444385_-	DUF2737 domain-containing protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
AUT08327.1|1444395_1444689_-	RecBCD nuclease inhibitor	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
AUT08328.1|1444705_1445254_-	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	97.8	3.6e-103
AUT08329.1|1445262_1445778_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	88.3	1.3e-65
AUT08330.1|1445778_1446486_-	recombinase	NA	K7PKU3	Enterobacteria_phage	99.1	5.0e-137
AUT08331.1|1447096_1447285_-	hypothetical protein	NA	A0A0B7MKW0	Enterobacteria_phage	59.3	3.8e-12
AUT08332.1|1447284_1447614_-	hypothetical protein	NA	A0A088CPT8	Enterobacteria_phage	72.9	1.9e-14
AUT08333.1|1447666_1448032_-	hypothetical protein	NA	A0A192Y658	Salmonella_phage	99.2	1.1e-58
AUT08334.1|1448089_1448368_-	hypothetical protein	NA	NA	NA	NA	NA
AUT08335.1|1448370_1448763_-	regulator	NA	Q76H58	Enterobacteria_phage	65.7	1.4e-27
AUT08336.1|1449032_1449686_-	LexA family transcriptional repressor	NA	A0A0N7BTS4	Escherichia_phage	96.8	1.9e-122
AUT08337.1|1449803_1450019_+	XRE family transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
AUT08338.1|1450128_1450425_+	hypothetical protein	NA	G9L678	Escherichia_phage	98.0	2.0e-47
AUT08339.1|1450457_1450604_+	hypothetical protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
AUT08340.1|1450596_1451496_+	DNA replication protein	NA	K7PH26	Enterobacteria_phage	99.7	6.1e-164
AUT08341.1|1451470_1452922_+	helicase DnaB	NA	Q7Y2K5	Escherichia_phage	99.2	1.2e-275
AUT08342.1|1452921_1453002_+	histone H1	NA	NA	NA	NA	NA
AUT08343.1|1453006_1453276_+	hypothetical protein	NA	A0A220NQU9	Salmonella_phage	40.3	2.6e-06
AUT08344.1|1453316_1453763_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	93.2	3.4e-75
AUT08345.1|1453759_1454287_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
AUT08346.1|1454283_1454460_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
AUT08347.1|1454462_1454822_+	DUF2591 domain-containing protein	NA	G8EYI2	Enterobacteria_phage	95.8	1.2e-62
AUT08348.1|1454821_1454998_+	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
AUT08349.1|1455711_1456002_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
AUT08350.1|1455998_1456361_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
AUT08351.1|1456357_1456546_+	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
AUT08352.1|1456542_1457166_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
AUT11545.1|1457306_1457489_-	hypothetical protein	NA	A0A088CPS7	Enterobacteria_phage	95.0	1.5e-26
AUT08353.1|1457599_1457923_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AUT08354.1|1457906_1458383_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
AUT08355.1|1458379_1458847_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	95.5	6.1e-75
AUT08356.1|1458834_1458987_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
AUT11546.1|1459190_1459676_+	helicase	NA	C6ZR70	Salmonella_phage	100.0	8.5e-88
AUT08357.1|1459924_1460167_+	DUF2560 domain-containing protein	NA	A5VW77	Enterobacteria_phage	98.8	2.9e-36
AUT08358.1|1460246_1460735_+	DNA-packaging protein	NA	G8EYI7	Enterobacteria_phage	99.4	4.1e-90
AUT08359.1|1460712_1462212_+|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	100.0	4.8e-307
AUT08360.1|1462212_1464378_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.7	0.0e+00
AUT08361.1|1464391_1465303_+	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	99.7	6.3e-161
AUT08362.1|1465302_1466598_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	99.1	4.7e-242
AUT08363.1|1466642_1466897_+	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	95.5	1.1e-25
AUT08364.1|1466874_1467375_+	recombinase RmuC	NA	G8EYJ2	Enterobacteria_phage	98.2	1.2e-89
AUT08365.1|1467374_1468793_+	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	98.9	1.0e-274
AUT08366.1|1468792_1469641_+	hypothetical protein	NA	Q716G6	Shigella_phage	97.2	3.8e-99
AUT08367.1|1469640_1470096_+	hypothetical protein	NA	Q716G5	Shigella_phage	98.0	1.1e-86
AUT08368.1|1470098_1470791_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
AUT08369.1|1470800_1472189_+	DNA transfer protein	NA	A0A220NR03	Salmonella_phage	64.0	7.7e-150
AUT08370.1|1472188_1474186_+	DNA transfer protein	NA	Q716G2	Shigella_phage	95.9	0.0e+00
AUT08371.1|1474275_1474536_-	toxin-antitoxin system HicB family antitoxin	NA	A0A088CPT2	Enterobacteria_phage	98.8	3.6e-37
AUT08372.1|1474657_1476856_+|tail	phage tail protein	tail	F8UBT4	Escherichia_phage	37.6	4.1e-105
AUT08373.1|1476888_1478016_-	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	30.2	1.0e-19
AUT08374.1|1478261_1479419_-	DUF4102 domain-containing protein	NA	A5VW56	Enterobacteria_phage	99.5	3.7e-222
AUT08375.1|1479730_1480663_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 4
CP026085	Escherichia coli strain DH5alpha chromosome, complete genome	4833062	1710840	1720281	4833062		Enterobacteria_phage(85.71%)	10	NA	NA
AUT08583.1|1710840_1711767_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.7e-24
AUT08584.1|1711771_1712503_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AUT08585.1|1712483_1712591_-	hypothetical protein	NA	NA	NA	NA	NA
AUT08586.1|1712650_1713382_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AUT08587.1|1713603_1715289_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AUT08588.1|1715285_1716005_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUT08589.1|1716051_1716522_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
AUT08590.1|1716561_1717023_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AUT08591.1|1717147_1719148_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
AUT08592.1|1719144_1720281_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 5
CP026085	Escherichia coli strain DH5alpha chromosome, complete genome	4833062	1732792	1796093	4833062	portal,lysis,plate,protease,tRNA,tail,integrase,terminase,holin,head,capsid	Escherichia_phage(38.3%)	76	1760035:1760062	1791009:1791036
AUT08598.1|1732792_1734826_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
AUT08599.1|1734957_1736067_+	protein mrp	NA	NA	NA	NA	NA
AUT08600.1|1736329_1736611_+	DUF2574 domain-containing protein	NA	NA	NA	NA	NA
AUT08601.1|1736903_1737446_+	hypothetical protein	NA	NA	NA	NA	NA
AUT08602.1|1737526_1738201_+	fimbrial assembly protein	NA	NA	NA	NA	NA
AUT08603.1|1738216_1740697_+	fimbrial assembly protein	NA	NA	NA	NA	NA
AUT08604.1|1740712_1741747_+	adhesin	NA	NA	NA	NA	NA
AUT08605.1|1741828_1742167_-	nickel/cobalt homeostasis protein RcnB	NA	NA	NA	NA	NA
AUT08606.1|1742385_1743210_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AUT08607.1|1743330_1743603_+	transcriptional regulator	NA	NA	NA	NA	NA
AUT08608.1|1743825_1744614_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AUT08609.1|1744610_1745411_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AUT08610.1|1745475_1746294_+	hydrolase	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
AUT08611.1|1746345_1747092_+	transcriptional regulator	NA	NA	NA	NA	NA
AUT08612.1|1747065_1748031_-	sugar kinase	NA	NA	NA	NA	NA
AUT08613.1|1748027_1749032_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
AUT08614.1|1749028_1750306_-	MFS transporter	NA	NA	NA	NA	NA
AUT08615.1|1750562_1751615_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AUT08616.1|1751924_1752779_+	tagatose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AUT08617.1|1752807_1754070_+	tagatose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AUT08618.1|1754079_1754532_+	galactitol-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AUT08619.1|1754562_1754847_+	galactitol-specific phosphotransferase enzyme IIB component	NA	NA	NA	NA	NA
AUT08620.1|1754850_1756206_+	galactitol permease IIC component	NA	NA	NA	NA	NA
AUT08621.1|1756253_1757294_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
AUT08622.1|1757393_1758173_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AUT08623.1|1758254_1759154_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
AUT08624.1|1759559_1759877_+	hypothetical protein	NA	NA	NA	NA	NA
AUT08625.1|1759864_1760014_+	hypothetical protein	NA	NA	NA	NA	NA
1760035:1760062	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
AUT08626.1|1760141_1761155_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
AUT08627.1|1761270_1761570_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
AUT08628.1|1761691_1761967_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
AUT08629.1|1762144_1762645_+	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	99.4	1.7e-91
AUT08630.1|1762708_1762933_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AUT08631.1|1762932_1763232_+	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	4.2e-45
AUT08632.1|1763234_1763459_+	hypothetical protein	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
AUT08633.1|1763455_1763731_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
AUT08634.1|1763720_1765997_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.9	0.0e+00
AUT08635.1|1766770_1766965_+	hypothetical protein	NA	NA	NA	NA	NA
AUT08636.1|1767161_1768595_+	ABC transporter	NA	A0A2I7RNF1	Vibrio_phage	30.1	3.9e-40
AUT08637.1|1768587_1769160_+	hypothetical protein	NA	NA	NA	NA	NA
AUT08638.1|1769218_1770247_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.1	6.2e-197
AUT08639.1|1770246_1772019_-	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
AUT08640.1|1772192_1773047_+|capsid	capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
AUT08641.1|1773105_1774179_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.7	7.4e-201
AUT08642.1|1774182_1774926_+|terminase	terminase	terminase	Q858W5	Yersinia_virus	96.0	2.3e-121
AUT08643.1|1775025_1775535_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	98.8	2.1e-89
AUT08644.1|1775534_1775738_+|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
AUT08645.1|1775741_1776023_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AUT08646.1|1776022_1776520_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	99.4	3.4e-92
AUT08647.1|1776534_1776960_+	protein lysA	NA	U5N096	Enterobacteria_phage	98.6	2.9e-60
AUT08648.1|1776947_1777373_+	protein lysB	NA	U5N3W5	Enterobacteria_phage	95.7	8.0e-66
AUT08649.1|1777344_1777518_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	6.8e-24
AUT08650.1|1777480_1777948_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	3.3e-81
AUT08651.1|1777940_1778393_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	4.1e-76
AUT08652.1|1778459_1779095_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	6.5e-112
AUT08653.1|1779091_1779439_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
AUT08654.1|1779443_1780352_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	2.8e-161
AUT08655.1|1780344_1780956_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
AUT11552.1|1782123_1782564_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	61.9	2.7e-48
AUT08656.1|1782535_1783129_-|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	63.0	1.3e-58
AUT08657.1|1783128_1783623_-|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	94.1	6.6e-80
AUT08658.1|1783653_1784247_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	98.0	1.2e-104
AUT08659.1|1784306_1785497_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.1e-224
AUT08660.1|1785509_1786028_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AUT08661.1|1786084_1786360_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AUT11553.1|1786392_1786512_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AUT08662.1|1786504_1788952_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	98.8	0.0e+00
AUT08663.1|1788966_1789446_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
AUT08664.1|1789445_1790609_+	hypothetical protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
AUT08665.1|1790608_1790908_+	transcriptional regulator	NA	Q858U4	Yersinia_virus	97.0	9.3e-53
AUT08666.1|1791180_1792542_-|protease	protease	protease	Q6DW11	Phage_TP	100.0	1.1e-217
1791009:1791036	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
AUT08667.1|1792644_1792941_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUT08668.1|1792942_1793239_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AUT08669.1|1793447_1793780_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AUT08670.1|1793970_1794693_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
AUT08671.1|1794689_1796093_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 6
CP026085	Escherichia coli strain DH5alpha chromosome, complete genome	4833062	2290910	2345677	4833062	transposase,lysis,portal,tail,terminase,head,capsid	Enterobacteria_phage(49.02%)	75	NA	NA
AUT09146.1|2290910_2293337_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	2.7e-214
AUT09147.1|2293535_2293841_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AUT11579.1|2293948_2294659_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AUT09148.1|2294661_2295222_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AUT09149.1|2295256_2295598_-	hypothetical protein	NA	NA	NA	NA	NA
AUT09150.1|2295732_2296059_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AUT09151.1|2296095_2296284_+	hypothetical protein	NA	NA	NA	NA	NA
AUT09152.1|2296264_2297479_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AUT09153.1|2297490_2298510_+	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	25.9	1.3e-16
AUT09154.1|2298567_2298678_+	transporter	NA	NA	NA	NA	NA
AUT09155.1|2298697_2299993_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.1	7.4e-155
AUT09156.1|2300012_2300264_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AUT09157.1|2300336_2302814_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
AUT09158.1|2302906_2303098_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUT09159.1|2303094_2303283_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AUT09160.1|2303850_2304069_-	hypothetical protein	NA	NA	NA	NA	NA
AUT09161.1|2304098_2304269_-	hypothetical protein	NA	NA	NA	NA	NA
AUT09162.1|2304228_2304384_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AUT09163.1|2304550_2304958_-	transcriptional regulator	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
AUT09164.1|2305041_2305272_+	division inhibition gene dicB repressor	NA	NA	NA	NA	NA
AUT09165.1|2305255_2305777_+	hypothetical protein	NA	NA	NA	NA	NA
AUT09166.1|2305703_2306723_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.4e-55
AUT09167.1|2306763_2307186_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
AUT09168.1|2307182_2307539_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
AUT09169.1|2308691_2308871_+	hypothetical protein	NA	NA	NA	NA	NA
AUT09170.1|2308845_2309028_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
AUT09171.1|2309205_2310519_+|transposase	transposase	transposase	NA	NA	NA	NA
AUT09172.1|2310563_2310686_+	plasmid mobilization protein	NA	NA	NA	NA	NA
AUT09173.1|2310955_2311288_-	protein FlxA	NA	NA	NA	NA	NA
AUT09174.1|2311490_2311796_-	hypothetical protein	NA	NA	NA	NA	NA
AUT09175.1|2311820_2312060_+	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AUT09176.1|2312059_2312347_+	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AUT09177.1|2312418_2312574_+	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AUT09178.1|2312790_2313042_+	hypothetical protein	NA	NA	NA	NA	NA
AUT09179.1|2313108_2313387_+	hypothetical protein	NA	NA	NA	NA	NA
AUT09180.1|2313388_2314438_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
AUT09181.1|2314451_2315204_+	antitermination protein Q	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
AUT09182.1|2315625_2315838_-	cold-shock protein CspF	NA	NA	NA	NA	NA
AUT09183.1|2316138_2316354_+	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AUT09184.1|2317107_2317323_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AUT09185.1|2317327_2317639_+	hypothetical protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AUT09186.1|2317635_2318169_+	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AUT09187.1|2318165_2318663_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
AUT09188.1|2319025_2319238_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AUT09189.1|2319248_2319437_+	cold-shock protein	NA	NA	NA	NA	NA
AUT09190.1|2319467_2319740_+	hypothetical protein	NA	NA	NA	NA	NA
AUT09191.1|2319911_2320085_+	protein GnsB	NA	NA	NA	NA	NA
AUT09192.1|2320236_2320647_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AUT09193.1|2320704_2320938_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
AUT09194.1|2321085_2321187_+	hypothetical protein	NA	NA	NA	NA	NA
AUT09195.1|2321326_2321872_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
AUT09196.1|2321846_2323772_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
AUT09197.1|2323768_2323975_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AUT09198.1|2323971_2325573_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.6	5.9e-311
AUT09199.1|2325553_2326873_+|capsid	capsid assembly protein	capsid	A0A0K2FI53	Enterobacteria_phage	99.3	2.5e-235
AUT09200.1|2326882_2327215_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AUT09201.1|2327270_2328296_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
AUT09202.1|2328337_2328736_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	4.5e-63
AUT09203.1|2328747_2329101_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
AUT09204.1|2329112_2329691_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
AUT09205.1|2329687_2330083_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
AUT11580.1|2330090_2330831_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
AUT09206.1|2330846_2331269_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	98.6	1.3e-71
AUT09207.1|2331250_2331685_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AUT09208.1|2331677_2334239_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.3	0.0e+00
AUT09209.1|2334235_2334565_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	9.6e-59
AUT09210.1|2334564_2335263_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	1.6e-132
AUT09211.1|2335268_2336012_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	6.8e-145
AUT09212.1|2335909_2336581_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	3.1e-104
AUT09213.1|2336641_2340055_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.4	0.0e+00
AUT09214.1|2340125_2340725_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.0	9.7e-110
AUT11581.1|2340789_2343864_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
AUT09215.1|2343863_2344439_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
AUT09216.1|2344536_2345127_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AUT09217.1|2345443_2345677_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
>prophage 7
CP026085	Escherichia coli strain DH5alpha chromosome, complete genome	4833062	2547377	2583214	4833062	terminase,holin,tail,plate	Escherichia_phage(74.36%)	42	NA	NA
AUT09385.1|2547377_2548511_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
AUT09386.1|2548651_2549086_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
AUT09387.1|2549625_2550198_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.3	1.8e-76
AUT09388.1|2550212_2553353_-	shikimate transporter	NA	A0A0U2SH60	Escherichia_phage	71.2	0.0e+00
AUT09389.1|2553376_2553922_-|tail	phage tail protein	tail	Q8W612	Enterobacteria_phage	76.4	3.8e-76
AUT09390.1|2553924_2555478_-|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	79.2	4.6e-228
AUT09391.1|2555474_2556101_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	99.0	2.2e-120
AUT09392.1|2556084_2557311_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	98.8	5.8e-226
AUT09393.1|2557332_2557872_+	hypothetical protein	NA	NA	NA	NA	NA
AUT09394.1|2557912_2558287_+	phage antirepressor Ant	NA	A0A0U2QL80	Escherichia_phage	95.8	6.8e-61
AUT09395.1|2558262_2558610_-	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	94.8	4.1e-60
AUT09396.1|2558883_2558982_-	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	83.9	2.3e-08
AUT09397.1|2558999_2559197_-	hypothetical protein	NA	NA	NA	NA	NA
AUT09398.1|2559306_2560020_-|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	96.6	1.8e-126
AUT09399.1|2560019_2561027_-	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	96.1	1.2e-189
AUT09400.1|2561026_2561293_-	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	94.3	2.7e-43
AUT09401.1|2561289_2561958_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	98.6	4.3e-122
AUT09402.1|2561961_2563950_-	lytic transglycosylase domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	94.4	0.0e+00
AUT09403.1|2564013_2564631_-	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	98.0	4.2e-108
AUT09404.1|2564627_2565059_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	99.3	2.8e-74
AUT09405.1|2565082_2566420_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	96.2	1.0e-244
AUT09406.1|2566419_2567364_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.4	2.2e-172
AUT09407.1|2567350_2567791_-	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	98.6	2.2e-82
AUT09408.1|2567787_2568228_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	99.3	1.2e-77
AUT09409.1|2568227_2568698_-	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	100.0	2.5e-84
AUT09410.1|2568755_2569784_-	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	99.4	3.3e-190
AUT09411.1|2569798_2570416_-	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	100.0	5.9e-118
AUT09412.1|2570408_2571731_-	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	95.2	6.8e-188
AUT11591.1|2571711_2572431_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	97.9	6.2e-135
AUT09413.1|2572489_2573926_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	95.8	5.2e-266
AUT09414.1|2573944_2575273_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	98.9	8.4e-263
AUT09415.1|2575262_2576354_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	92.1	1.0e-144
AUT09416.1|2576357_2576567_-	hypothetical protein	NA	NA	NA	NA	NA
AUT09417.1|2576544_2577477_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	7.1e-83
AUT09418.1|2577469_2578258_-	transcriptional regulator	NA	R4TG31	Halovirus	41.1	2.5e-49
AUT09419.1|2578859_2579237_-	peptidase M15	NA	Q9MBZ3	Enterobacteria_phage	97.6	3.0e-64
AUT09420.1|2579239_2579515_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	97.8	5.5e-44
AUT09421.1|2579504_2579897_-|holin	holin	holin	Q8W636	Enterobacteria_phage	96.2	8.4e-54
AUT09422.1|2581167_2581704_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	69.1	6.3e-68
AUT09423.1|2581700_2581991_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	4.3e-47
AUT09424.1|2581990_2582590_-	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
AUT09425.1|2583058_2583214_-	type I toxin-antitoxin system hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	96.1	5.5e-17
>prophage 8
CP026085	Escherichia coli strain DH5alpha chromosome, complete genome	4833062	2587231	2603919	4833062	tRNA,integrase	Escherichia_phage(75.0%)	24	2579486:2579499	2603462:2603475
2579486:2579499	attL	ATTCAGTAATCCGG	NA	NA	NA	NA
AUT09430.1|2587231_2587654_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	89.9	7.4e-64
AUT09431.1|2587669_2588482_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	87.0	1.4e-114
AUT09432.1|2588453_2589200_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
AUT09433.1|2589206_2590064_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
AUT09434.1|2590076_2590499_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
AUT09435.1|2590495_2590750_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
AUT09436.1|2590829_2591249_+	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
AUT09437.1|2591285_2591504_+	hypothetical protein	NA	NA	NA	NA	NA
AUT09438.1|2591534_2591669_+	hypothetical protein	NA	NA	NA	NA	NA
AUT09439.1|2591679_2591832_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
AUT09440.1|2592252_2592474_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	100.0	6.2e-38
AUT11592.1|2592473_2592644_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.1	6.7e-24
AUT09441.1|2592718_2592994_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	92.3	6.3e-40
AUT09442.1|2593095_2595696_+	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	1.8e-248
AUT09443.1|2595688_2596498_+	DNA recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
AUT09444.1|2596554_2596749_+	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
AUT09445.1|2596741_2596951_+	double-strand break reduction protein	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
AUT09446.1|2597029_2597245_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AUT09447.1|2597246_2598482_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
AUT09448.1|2598533_2599469_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	4.5e-146
AUT09449.1|2599597_2600971_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AUT09450.1|2601000_2601174_-	hypothetical protein	NA	NA	NA	NA	NA
AUT09451.1|2601448_2602432_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AUT11593.1|2602686_2603919_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2603462:2603475	attR	CCGGATTACTGAAT	NA	NA	NA	NA
>prophage 9
CP026085	Escherichia coli strain DH5alpha chromosome, complete genome	4833062	3053290	3142571	4833062	transposase,portal,plate,protease,tail,tRNA,integrase,head,capsid	Salmonella_phage(58.33%)	96	3131847:3131864	3149924:3149941
AUT09877.1|3053290_3054583_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AUT09878.1|3054673_3056017_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
AUT09879.1|3056027_3056639_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUT09880.1|3056793_3060861_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	9.3e-87
AUT09881.1|3060995_3061490_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AUT09882.1|3062034_3063000_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
AUT09883.1|3063122_3064889_+	ATP-binding/permease CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AUT09884.1|3064889_3066611_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
AUT09885.1|3066652_3067357_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUT09886.1|3067641_3067860_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AUT09887.1|3068544_3070821_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AUT09888.1|3070851_3071172_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AUT09889.1|3071494_3071719_+	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AUT09890.1|3071791_3073738_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
AUT09891.1|3073734_3074850_-	MacA family efflux pump subunit	NA	NA	NA	NA	NA
AUT09892.1|3074964_3075957_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AUT09893.1|3075953_3077612_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AUT09894.1|3078037_3078733_+	aquaporin	NA	NA	NA	NA	NA
AUT09895.1|3079227_3080127_+	transporter	NA	NA	NA	NA	NA
AUT09896.1|3080270_3081923_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AUT09897.1|3081934_3082903_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUT09898.1|3083035_3084754_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
AUT09899.1|3084790_3085792_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AUT09900.1|3085802_3087233_+	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
AUT11618.1|3087331_3088345_+	hypothetical protein	NA	NA	NA	NA	NA
AUT09901.1|3088341_3089172_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
AUT09902.1|3089168_3089492_-	hypothetical protein	NA	NA	NA	NA	NA
AUT09903.1|3089617_3090133_+	lipoprotein	NA	NA	NA	NA	NA
AUT09904.1|3090350_3091079_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.2	1.3e-28
AUT09905.1|3091096_3091828_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUT09906.1|3091834_3092551_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AUT09907.1|3092550_3093219_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AUT09908.1|3093510_3094242_+	arginine/ornithine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUT09909.1|3094416_3095544_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	4.6e-28
AUT09910.1|3095584_3096073_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AUT09911.1|3096132_3096978_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AUT09912.1|3096974_3097928_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AUT09913.1|3097937_3099071_-	putrescine transport ATP-binding protein PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
AUT09914.1|3099165_3100278_-	putrescine-binding periplasmic protein	NA	NA	NA	NA	NA
AUT09915.1|3100261_3100423_-	putrescine/spermidine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUT09916.1|3100628_3101105_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AUT09917.1|3101192_3102095_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
AUT09918.1|3102155_3102878_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AUT09919.1|3102861_3103149_-	hypothetical protein	NA	NA	NA	NA	NA
AUT09920.1|3103308_3103566_+	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
AUT09921.1|3103595_3103973_-	hypothetical protein	NA	NA	NA	NA	NA
AUT09922.1|3104242_3105928_+	transporter	NA	NA	NA	NA	NA
AUT09923.1|3106163_3106382_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AUT09924.1|3106472_3107573_-	late control protein D	NA	A0A1S6KZZ5	Salmonella_phage	87.2	2.5e-175
AUT09925.1|3107569_3108055_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.3e-67
AUT09926.1|3108051_3111129_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AUT09927.1|3111121_3111241_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AUT09928.1|3111255_3111558_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AUT09929.1|3111612_3112128_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
AUT09930.1|3112137_3113310_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	4.6e-204
AUT09931.1|3113452_3114019_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
AUT09932.1|3114049_3114430_+	hypothetical protein	NA	I3PGW0	Xanthomonas_phage	31.8	3.0e-08
AUT09933.1|3114449_3115663_-|transposase	transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
AUT09934.1|3115686_3115875_+	hypothetical protein	NA	NA	NA	NA	NA
AUT09935.1|3115843_3116449_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.4	1.9e-97
AUT09936.1|3116448_3117963_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	74.7	8.2e-206
AUT09937.1|3117959_3118565_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	91.5	7.5e-110
AUT09938.1|3118557_3119466_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	2.3e-142
AUT09939.1|3119452_3119812_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
AUT09940.1|3119808_3120387_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	4.7e-93
AUT09941.1|3120509_3121379_+	hypothetical protein	NA	NA	NA	NA	NA
AUT09942.1|3121434_3121881_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	80.3	1.9e-57
AUT09943.1|3121873_3122305_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
AUT11619.1|3122267_3122513_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.3	5.3e-30
AUT09944.1|3122400_3122829_-	hypothetical protein	NA	E5G6N2	Salmonella_phage	73.0	4.6e-45
AUT09945.1|3122825_3123203_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AUT09946.1|3123204_3123717_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	1.8e-88
AUT09947.1|3123697_3123913_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AUT09948.1|3123916_3124120_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	91.0	3.0e-31
AUT09949.1|3124119_3124584_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
AUT09950.1|3124679_3125330_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AUT09951.1|3125333_3126392_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
AUT09952.1|3126408_3127242_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
AUT09953.1|3127384_3129151_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AUT09954.1|3129150_3130176_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.2	1.9e-169
AUT09955.1|3130216_3131998_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
3131847:3131864	attL	TATTTTTTTTGAATGGAT	NA	NA	NA	NA
AUT09956.1|3132530_3132866_+	hypothetical protein	NA	NA	NA	NA	NA
AUT09957.1|3133058_3133364_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AUT09958.1|3133302_3133491_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
AUT09959.1|3133643_3136058_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.1	0.0e+00
AUT09960.1|3136054_3136912_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.1	5.2e-157
AUT09961.1|3136908_3137136_-	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AUT09962.1|3137135_3137369_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AUT09963.1|3137436_3137778_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AUT09964.1|3137859_3138108_+	hypothetical protein	NA	NA	NA	NA	NA
AUT09965.1|3138193_3138490_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
AUT09966.1|3138497_3139007_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	86.4	1.0e-75
AUT09967.1|3139072_3139276_-	regulator	NA	NA	NA	NA	NA
AUT09968.1|3139335_3139986_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	39.2	4.2e-34
AUT09969.1|3139986_3141438_+	NTPase KAP	NA	R9TRQ8	Vibrio_phage	29.7	1.8e-45
AUT09970.1|3141518_3142571_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.8	2.1e-107
3149924:3149941	attR	ATCCATTCAAAAAAAATA	NA	NA	NA	NA
>prophage 10
CP026085	Escherichia coli strain DH5alpha chromosome, complete genome	4833062	3873236	3932751	4833062	protease,transposase,tRNA	uncultured_marine_virus(20.0%)	52	NA	NA
AUT10632.1|3873236_3874589_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
AUT10633.1|3874600_3875458_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AUT10634.1|3875470_3876229_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
AUT10635.1|3876417_3877614_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AUT10636.1|3877705_3878263_-	ribosome-recycling factor	NA	NA	NA	NA	NA
AUT10637.1|3878554_3879280_-	UMP kinase	NA	NA	NA	NA	NA
AUT10638.1|3879426_3880278_-	elongation factor Ts	NA	NA	NA	NA	NA
AUT10639.1|3880296_3880584_+	hypothetical protein	NA	NA	NA	NA	NA
AUT10640.1|3880535_3881261_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AUT10641.1|3881407_3881629_+	hypothetical protein	NA	NA	NA	NA	NA
AUT10642.1|3881628_3882423_+	methionine aminopeptidase	NA	NA	NA	NA	NA
AUT10643.1|3882484_3885157_+	bifunctional uridylyltransferase/uridylyl-removing protein	NA	NA	NA	NA	NA
AUT10644.1|3885187_3886012_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AUT10645.1|3886065_3886878_+	phosphodiesterase YaeI	NA	NA	NA	NA	NA
AUT10646.1|3887039_3887426_+	hypothetical protein	NA	NA	NA	NA	NA
AUT10647.1|3887514_3888672_-	carbohydrate diacid regulator	NA	NA	NA	NA	NA
AUT10648.1|3888826_3890251_-|protease	periplasmic serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
AUT10649.1|3890380_3891898_-	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
AUT10650.1|3891981_3892680_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
AUT10651.1|3892672_3893473_+	cobalamin-binding protein	NA	NA	NA	NA	NA
AUT10652.1|3893510_3894134_+	hypothetical protein	NA	NA	NA	NA	NA
AUT10653.1|3894180_3894525_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
AUT10654.1|3894606_3896028_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
AUT10655.1|3896252_3897533_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
AUT10656.1|3897690_3899673_-	iron(3+)-hydroxamate import system permease FhuB	NA	NA	NA	NA	NA
AUT10657.1|3899669_3900560_-	iron(3+)-hydroxamate-binding protein FhuD	NA	NA	NA	NA	NA
AUT10658.1|3900559_3901357_-	iron(3+)-hydroxamate import ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	2.7e-14
AUT10659.1|3902464_3903673_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AUT10660.1|3905208_3907743_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
AUT10661.1|3907729_3907936_-	hypothetical protein	NA	NA	NA	NA	NA
AUT10662.1|3907938_3910368_-	ATP-dependent RNA helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.1	1.3e-38
AUT10663.1|3910441_3910972_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AUT10664.1|3910986_3911691_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AUT10665.1|3911868_3912324_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AUT10666.1|3912360_3913287_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AUT10667.1|3913325_3914744_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
AUT10668.1|3914740_3915220_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine pyrophosphokinase	NA	NA	NA	NA	NA
AUT10669.1|3915589_3916174_+	fimbrial protein	NA	NA	NA	NA	NA
AUT10670.1|3916271_3917012_+	fimbrial chaperone	NA	NA	NA	NA	NA
AUT10671.1|3917046_3919644_+	outer membrane usher protein	NA	NA	NA	NA	NA
AUT10672.1|3919660_3920230_+	fimbrial protein	NA	NA	NA	NA	NA
AUT10673.1|3920241_3920847_+	fimbrial protein StaE	NA	NA	NA	NA	NA
AUT10674.1|3920873_3921470_+	fimbrial protein StaF	NA	NA	NA	NA	NA
AUT10675.1|3922480_3923689_+|transposase	IS4 family transposase ISVsa5	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AUT10676.1|3924127_3924796_+	putative tetracyline resistance transcriptional regulator TetC	NA	NA	NA	NA	NA
AUT10677.1|3925752_3926961_+|transposase	IS4 family transposase ISVsa5	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AUT10678.1|3927530_3928157_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUT10679.1|3928134_3928821_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUT10680.1|3928828_3929215_-	amino acid-binding protein	NA	NA	NA	NA	NA
AUT10681.1|3929207_3929528_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AUT10682.1|3929971_3931177_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
AUT10683.1|3931542_3932751_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
