The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP022704	Mycobacterium tuberculosis strain Beijing2014PNGD chromosome, complete genome	4404064	2938210	2976472	4404064	integrase,protease,tRNA,head,terminase,capsid	Mycobacterium_phage(33.33%)	41	2966998:2967025	2976625:2976652
AVO64441.1|2938210_2940289_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
AUS62609.1|2942351_2942852_+	DUF1990 domain-containing protein	NA	NA	NA	NA	NA
AUS62610.1|2942868_2943309_-	DoxX family membrane protein	NA	NA	NA	NA	NA
AUS63952.1|2943455_2944133_+	transcriptional regulator	NA	NA	NA	NA	NA
AUS62611.1|2944117_2944471_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AUS62612.1|2944483_2944909_-	hypothetical protein	NA	NA	NA	NA	NA
AUS62613.1|2944905_2945580_-	transcriptional regulator	NA	NA	NA	NA	NA
AUS62614.1|2945657_2946479_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUS62615.1|2946614_2947508_+	universal stress protein	NA	NA	NA	NA	NA
AUS63953.1|2947510_2948329_-	universal stress protein	NA	NA	NA	NA	NA
AUS62616.1|2948343_2949525_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AUS62617.1|2949583_2950015_-	hypoxic response protein 1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
AUS63954.1|2952082_2952445_+	hypothetical protein	NA	NA	NA	NA	NA
AUS63955.1|2952791_2953916_+	hypothetical protein	NA	NA	NA	NA	NA
AVO64442.1|2953917_2954457_+	archease	NA	NA	NA	NA	NA
AVO64443.1|2954596_2955895_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
AUS62618.1|2955933_2956215_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
AUS62619.1|2956359_2956845_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
AUS62620.1|2956871_2957129_-	hypothetical protein	NA	NA	NA	NA	NA
AVO64444.1|2959474_2959717_+	hypothetical protein	NA	NA	NA	NA	NA
AUS62621.1|2959717_2960395_+	hypothetical protein	NA	NA	NA	NA	NA
AUS62622.1|2960590_2961247_+	DedA family protein	NA	NA	NA	NA	NA
AUS62623.1|2961409_2961856_+	STAS domain-containing protein	NA	NA	NA	NA	NA
AUS62624.1|2962030_2962363_-	YnfA family protein	NA	NA	NA	NA	NA
AUS62625.1|2962482_2962842_-	transcriptional regulator	NA	NA	NA	NA	NA
AUS62626.2|2962943_2963582_+	hypothetical protein	NA	NA	NA	NA	NA
AUS62627.1|2963539_2963920_+	transcriptional regulator	NA	NA	NA	NA	NA
AUS63956.1|2965604_2965841_+	DUF3018 domain-containing protein	NA	NA	NA	NA	NA
AUS62629.1|2965913_2966087_+	hypothetical protein	NA	NA	NA	NA	NA
2966998:2967025	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
AVO64445.1|2967131_2967563_+	hypothetical protein	NA	NA	NA	NA	NA
AUS62630.1|2967559_2968558_+|integrase	integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
AUS62631.1|2968571_2969036_+	hypothetical protein	NA	NA	NA	NA	NA
AUS62633.1|2969446_2970886_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
AUS62634.2|2970893_2971427_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
AUS62635.2|2971579_2972206_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
AUS63957.1|2972237_2972561_-	toxin	NA	NA	NA	NA	NA
AUS62636.1|2972640_2972886_-	antitoxin	NA	NA	NA	NA	NA
AUS62638.1|2974313_2974706_-	hypothetical protein	NA	NA	NA	NA	NA
AUS62639.1|2974702_2974963_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
AUS63958.1|2974979_2975342_-	hypothetical protein	NA	NA	NA	NA	NA
AUS62640.1|2975344_2976472_-|integrase	integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2976625:2976652	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
