The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026005	Brucella melitensis strain CIIMS-PH-3 chromosome 1, complete sequence	2122768	453127	463150	2122768	integrase,transposase	Brucella_phage(37.5%)	16	448125:448165	463228:463268
448125:448165	attL	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
AUS46283.1|453127_454579_-	hypothetical protein	NA	A0A141GEY6	Brucella_phage	56.9	1.1e-135
AUS46284.1|454990_455683_-	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.5	4.4e-106
AUS46285.1|455683_456443_-|transposase	IS5/IS1182 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	7.9e-16
AUS46286.1|457283_457529_+	hypothetical protein	NA	NA	NA	NA	NA
AUS46287.1|457528_457843_+	hypothetical protein	NA	K4NZP3	Burkholderia_phage	42.1	2.0e-05
AUS46288.1|457958_458192_-	hypothetical protein	NA	NA	NA	NA	NA
AUS46289.1|458190_458361_+	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	45.1	3.1e-05
AUS47794.1|458708_459419_-	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
AUS46290.1|459764_460241_-	hypothetical protein	NA	NA	NA	NA	NA
AUS46291.1|460263_460539_-	hypothetical protein	NA	NA	NA	NA	NA
AUS46292.1|460535_460766_-	hypothetical protein	NA	NA	NA	NA	NA
AUS46293.1|460762_461467_-	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.5e-05
AUS46294.1|461516_461720_+	hypothetical protein	NA	NA	NA	NA	NA
AUS46295.1|461716_461932_+	hypothetical protein	NA	NA	NA	NA	NA
AUS46296.1|461934_462138_+	hypothetical protein	NA	NA	NA	NA	NA
AUS46297.1|462124_463150_+|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	36.7	5.6e-49
463228:463268	attR	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
>prophage 2
CP026005	Brucella melitensis strain CIIMS-PH-3 chromosome 1, complete sequence	2122768	532162	544090	2122768	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
AUS46355.1|532162_534490_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
AUS46356.1|534609_534951_-	immunogenic membrane protein YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
AUS46357.1|535110_535977_+	DUF815 domain-containing protein	NA	NA	NA	NA	NA
AUS46358.1|536025_537324_-	LysM peptidoglycan-binding domain-containing protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
AUS46359.1|537372_537558_-	hypothetical protein	NA	NA	NA	NA	NA
AUS46360.1|537702_538371_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
AUS46361.1|538367_539135_-	5'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
AUS47801.1|539283_540567_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	2.6e-104
AUS46362.1|540643_541468_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
AUS46363.1|541464_542046_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AUS46364.1|542156_542375_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
AUS46365.1|542520_543246_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	1.5e-43
AUS46366.1|543238_544090_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
>prophage 3
CP026005	Brucella melitensis strain CIIMS-PH-3 chromosome 1, complete sequence	2122768	768746	815143	2122768	integrase,tail,head,protease	Mesorhizobium_phage(14.29%)	39	759552:759566	772989:773003
759552:759566	attL	CCGCTTCGCACTTTT	NA	NA	NA	NA
AUS46581.1|768746_769673_+|integrase	site-specific integrase	integrase	A0A076YL28	Mesorhizobium_phage	31.6	5.9e-29
AUS46582.1|770035_771169_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X7QHI1	Faustovirus	24.2	2.4e-16
AUS47818.1|771186_771561_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
AUS46583.1|771605_772256_-	antifreeze protein	NA	NA	NA	NA	NA
AUS47819.1|772911_773682_+	YitT family protein	NA	NA	NA	NA	NA
772989:773003	attR	CCGCTTCGCACTTTT	NA	NA	NA	NA
AUS46584.1|773741_773999_-	sel1 repeat family protein	NA	NA	NA	NA	NA
AUS46585.1|774268_774508_+	hypothetical protein	NA	NA	NA	NA	NA
AUS46586.1|774504_774852_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
AUS46587.1|774910_775621_-	thiol:disulfide oxidoreductase	NA	NA	NA	NA	NA
AUS46588.1|776187_777690_+	AMP nucleosidase	NA	NA	NA	NA	NA
AUS46589.1|777742_778819_+	AP endonuclease	NA	NA	NA	NA	NA
AUS46590.1|778934_780626_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
AUS46591.1|781014_781887_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
AUS46592.1|783308_784268_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AUS46593.1|784493_787145_+	aminopeptidase N	NA	NA	NA	NA	NA
AUS46594.1|787535_789887_+	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	34.8	6.3e-27
AUS46595.1|790157_792269_+	hypothetical protein	NA	NA	NA	NA	NA
AUS46596.1|792313_795265_-	[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
AUS46597.1|795387_796794_-	sensor histidine kinase	NA	NA	NA	NA	NA
AUS46598.1|796790_797498_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUS46599.1|797591_799133_-|protease	DegP-like serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	1.7e-28
AUS46600.1|799274_799751_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
AUS46601.1|799747_801739_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
AUS46602.1|801758_802256_-	cytochrome c-type biogenesis protein CcmE	NA	NA	NA	NA	NA
AUS46603.1|802252_803392_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
AUS47820.1|803492_803945_-	hypothetical protein	NA	NA	NA	NA	NA
AUS46604.1|804038_805349_-	ATP-binding protein	NA	NA	NA	NA	NA
AUS46605.1|805423_806113_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUS47821.1|806191_806488_-	hypothetical protein	NA	NA	NA	NA	NA
AUS46606.1|806649_806856_-	hypothetical protein	NA	NA	NA	NA	NA
AUS46607.1|810780_811215_-	peptidase P60	NA	NA	NA	NA	NA
AUS46608.1|811211_812087_-	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	38.9	4.5e-47
AUS46609.1|812083_812716_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	47.6	2.9e-48
AUS46610.1|812718_813264_-|tail	phage tail protein	tail	A0A0S2SYD9	Pseudomonas_phage	46.4	2.8e-07
AUS46611.1|813268_813439_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
AUS46612.1|813482_813824_-	gene transfer agent family protein	NA	NA	NA	NA	NA
AUS46613.1|813820_814234_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
AUS46614.1|814274_814682_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AUS46615.1|814804_815143_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
