The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025753	Escherichia coli strain CV839-06 chromosome, complete genome	4931011	23	30239	4931011	tail,integrase,holin,terminase,capsid,portal	Escherichia_phage(50.0%)	48	12428:12443	31935:31950
AUP42665.1|23_2816_-	hypothetical protein	NA	A0A1B5FPE2	Escherichia_phage	95.2	0.0e+00
AUP42666.1|2861_3068_-|tail	phage tail protein	tail	A0A1B5FP87	Escherichia_phage	98.5	1.4e-31
AUP42667.1|3051_3189_-	hypothetical protein	NA	NA	NA	NA	NA
AUP42668.1|3163_3535_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
AUP42669.1|3549_4254_-|tail	tail protein	tail	A0A1B5FP82	Escherichia_phage	96.2	1.5e-117
AUP42670.1|4313_4538_-	hypothetical protein	NA	A0A1B5FP84	Escherichia_phage	98.6	1.0e-32
AUP42671.1|4654_5101_-	hypothetical protein	NA	S4TR46	Salmonella_phage	80.4	2.3e-63
AUP42672.1|5447_5678_-	hypothetical protein	NA	A0A1B5FP86	Escherichia_phage	100.0	8.2e-33
AUP42673.1|5764_5953_-	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
AUP42674.1|6004_7210_-|capsid	capsid protein	capsid	U5P0G9	Shigella_phage	99.0	1.3e-222
AUP42675.1|7224_7875_-	primosome assembly protein PriA	NA	U5P4H2	Shigella_phage	100.0	2.5e-119
AUP42676.1|7852_9094_-|portal	portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
AUP42677.1|9093_9276_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
AUP42678.1|9287_11045_-	hypothetical protein	NA	A0A1B5FP96	Escherichia_phage	99.7	0.0e+00
AUP42679.1|11044_11365_-|terminase	terminase	terminase	A0A1B5FPA0	Escherichia_phage	100.0	4.5e-53
AUP42680.1|12068_12224_-	hypothetical protein	NA	NA	NA	NA	NA
AUP42681.1|12265_12643_-	hypothetical protein	NA	Q9MBZ3	Enterobacteria_phage	96.0	9.6e-63
12428:12443	attL	ATCCACCGCATCACCG	NA	NA	NA	NA
AUP42682.1|12645_12921_-|holin	holin	holin	Q9MBZ4	Enterobacteria_phage	96.7	5.5e-44
AUP42683.1|12910_13303_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	96.2	5.9e-55
AUP42684.1|13391_13544_-	membrane protein	NA	NA	NA	NA	NA
AUP42685.1|13540_13966_-	hypothetical protein	NA	Q71TK7	Escherichia_phage	87.2	2.3e-60
AUP42686.1|14386_14530_-	hypothetical protein	NA	NA	NA	NA	NA
AUP42687.1|15583_16273_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	9.6e-61
AUP42688.1|16269_16635_-	endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	3.2e-39
AUP42689.1|16635_17691_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	47.6	7.0e-87
AUP42690.1|17933_18065_-	hypothetical protein	NA	NA	NA	NA	NA
AUP42691.1|18100_18358_+	addiction module antidote protein	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
AUP42692.1|18363_18663_+	plasmid stabilization system protein	NA	A0A2R2Z2Y1	Escherichia_phage	99.0	3.9e-51
AUP42693.1|18868_18985_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	86.8	3.2e-09
AUP42694.1|19103_19265_-	hypothetical protein	NA	NA	NA	NA	NA
AUP42695.1|19264_19699_-	hypothetical protein	NA	V5UT79	Shigella_phage	56.2	3.3e-35
AUP42696.1|19878_20235_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
AUP42697.1|20292_20715_-	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	8.8e-65
AUP42698.1|20755_21826_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
AUP42699.1|21897_22323_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUP42701.1|22319_22535_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP42700.1|22527_23301_+	putative regulator for DicB	NA	H9C160	Pectobacterium_phage	43.1	1.0e-55
AUP42702.1|23492_23729_+	hypothetical protein	NA	M4QQ57	Salicola_phage	53.2	4.6e-07
AUP42703.1|23730_23859_+	hypothetical protein	NA	NA	NA	NA	NA
AUP42704.1|23888_24107_+	phage protein	NA	NA	NA	NA	NA
AUP42705.1|24129_24537_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	40.9	1.0e-09
AUP42706.1|24514_24748_-	hypothetical protein	NA	NA	NA	NA	NA
AUP42707.1|25308_25497_+	regulatory protein	NA	NA	NA	NA	NA
AUP42708.1|25493_25685_+	hypothetical protein	NA	NA	NA	NA	NA
AUP42709.1|25778_28250_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
AUP42710.1|28311_28581_+	excisionase	NA	NA	NA	NA	NA
AUP42711.1|28549_29668_+|integrase	integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
AUP42712.1|29771_30239_-	membrane protein	NA	A0A1B0YZW3	Pseudomonas_phage	29.5	2.4e-07
31935:31950	attR	CGGTGATGCGGTGGAT	NA	NA	NA	NA
>prophage 2
CP025753	Escherichia coli strain CV839-06 chromosome, complete genome	4931011	1292280	1363515	4931011	integrase,holin,tRNA,transposase	Shigella_phage(26.67%)	73	1308174:1308189	1366145:1366160
AUP43911.1|1292280_1293186_-|transposase	transposase	transposase	Q9ZXG3	Shigella_phage	96.3	1.6e-172
AUP43912.1|1293143_1293389_-|transposase	transposase	transposase	Q76S41	Shigella_phage	98.8	1.3e-36
AUP43913.1|1293948_1294086_+	hypothetical protein	NA	NA	NA	NA	NA
AUP43914.1|1294168_1295782_-|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	5.4e-171
AUP43915.1|1295812_1296109_-	isocitrate lyase	NA	A0A0P0ZBY2	Stx2-converting_phage	60.2	2.2e-30
AUP43916.1|1296159_1296594_-|transposase	transposase putative transposase	transposase	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
AUP43917.1|1297373_1297943_+	hypothetical protein	NA	NA	NA	NA	NA
AUP43918.1|1298202_1298604_+	hypothetical protein	NA	NA	NA	NA	NA
AUP43919.1|1298591_1299026_+	hypothetical protein	NA	NA	NA	NA	NA
AUP43920.1|1299204_1299333_+	hypothetical protein	NA	NA	NA	NA	NA
AUP43921.1|1299757_1301290_+|transposase	transposase putative transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	81.4	1.2e-239
AUP43922.1|1301528_1302887_-	hypothetical protein	NA	NA	NA	NA	NA
AUP43923.1|1303265_1303457_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
AUP43924.1|1303619_1303877_-	hypothetical protein	NA	NA	NA	NA	NA
AUP43925.1|1304638_1304848_-|transposase	transposase, IS1 family	transposase	U5P0U6	Shigella_phage	98.6	2.2e-32
AUP43926.1|1304848_1305142_-|transposase	transposase, IS1 family	transposase	U5P0U6	Shigella_phage	89.0	4.2e-42
AUP43927.1|1305627_1306149_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AUP43928.1|1306145_1307099_+	fec operon regulator FecR	NA	NA	NA	NA	NA
AUP43929.1|1307185_1309510_+	transporter iron(III) dicitrate TonB-dependent receptor	NA	NA	NA	NA	NA
1308174:1308189	attL	TCAACAGCCTGCTGCA	NA	NA	NA	NA
AUP43930.1|1309554_1310457_+	periplasmic binding protein	NA	NA	NA	NA	NA
AUP43931.1|1310453_1311452_+	iron ABC transporter	NA	NA	NA	NA	NA
AUP43932.1|1311448_1312405_+	hypothetical protein	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AUP43934.1|1312437_1312578_-	hypothetical protein	NA	NA	NA	NA	NA
AUP43933.1|1312561_1313173_+	iron ABC transporter	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.5	6.6e-05
AUP43935.1|1313730_1313988_-	transporter	NA	NA	NA	NA	NA
AUP43936.1|1314309_1314909_-|integrase	integrase	integrase	S5FNT8	Shigella_phage	95.5	5.0e-98
AUP43937.1|1314964_1315267_-|transposase	transposase IS911, transposase orfA	transposase	Q716C1	Shigella_phage	96.5	1.2e-36
AUP43938.1|1315473_1316295_+	carbohydrate transporter	NA	NA	NA	NA	NA
AUP43939.1|1316873_1317386_+	glycosyl transferase family 1	NA	NA	NA	NA	NA
AUP43940.1|1317822_1318341_+	hypothetical protein	NA	NA	NA	NA	NA
AUP43941.1|1318405_1319350_+	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
AUP43942.1|1319530_1320670_+|integrase	integrase	integrase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.7e-68
AUP43943.1|1320817_1322821_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AUP43944.1|1322883_1324254_+	hypothetical protein	NA	NA	NA	NA	NA
AUP43945.1|1324407_1324626_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUP43946.1|1324676_1325456_-	IstB-like ATP binding protein	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
AUP43947.1|1325455_1326478_-|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	7.8e-200
AUP43948.1|1326649_1327024_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP43949.1|1327081_1327201_-	putative alcohol dehydrogenase	NA	NA	NA	NA	NA
AUP43950.1|1327204_1327333_-	Protein yhdH	NA	NA	NA	NA	NA
AUP43951.1|1327423_1327594_-	hypothetical protein	NA	NA	NA	NA	NA
AUP43952.1|1327714_1329328_-|transposase	IS66 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AUP43953.1|1329358_1329655_-	isocitrate lyase	NA	A0A0P0ZBY2	Stx2-converting_phage	63.3	2.2e-30
AUP43954.1|1329705_1330068_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	100.0	5.6e-36
AUP43955.1|1330145_1331120_-|integrase	integrase	integrase	Q9ZXG3	Shigella_phage	96.0	9.4e-171
AUP43956.1|1331077_1331323_-|transposase	transposase	transposase	Q76S41	Shigella_phage	98.8	1.3e-36
AUP43957.1|1332190_1332307_+	acetolactate synthase	NA	NA	NA	NA	NA
AUP43958.1|1332407_1333190_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AUP43959.1|1333495_1334416_+	ribokinase	NA	NA	NA	NA	NA
AUP43960.1|1334443_1335760_+	sugar:proton symporter	NA	NA	NA	NA	NA
AUP43961.1|1335771_1336785_+	deoxyribose mutarotase	NA	NA	NA	NA	NA
AUP43962.1|1337268_1337460_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	65.6	8.3e-15
AUP43963.1|1337706_1338963_-	PTS beta-glucoside transporter subunit IIBC	NA	NA	NA	NA	NA
AUP43964.1|1338975_1339263_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
AUP43965.1|1339278_1339722_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
AUP43966.1|1339992_1341024_+	LacI family transcription regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	1.4e-18
AUP43967.1|1341105_1341243_+|transposase	transposase hypothetical protein	transposase	NA	NA	NA	NA
AUP43968.1|1341357_1341477_+	hypothetical protein	NA	NA	NA	NA	NA
AUP43969.1|1341549_1341687_+	hypothetical protein	NA	NA	NA	NA	NA
AUP43970.1|1341855_1342746_+	hypothetical protein	NA	NA	NA	NA	NA
AUP43971.1|1342738_1346071_+	ATP-binding protein	NA	NA	NA	NA	NA
AUP43972.1|1346063_1346903_+	hypothetical protein	NA	A0A0F7L647	uncultured_marine_virus	34.7	2.7e-25
AUP43973.1|1347051_1348896_-	hypothetical protein	NA	NA	NA	NA	NA
AUP43974.1|1348898_1351283_-	histidine kinase	NA	NA	NA	NA	NA
AUP43975.1|1351551_1352805_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	40.9	3.0e-84
AUP43976.1|1353242_1354304_+	alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	29.4	8.7e-45
AUP43977.1|1354433_1355936_+	hypothetical protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
AUP43978.1|1356096_1357179_-	lipopolysaccharide ABC transporter permease	NA	NA	NA	NA	NA
AUP43979.1|1357178_1358186_-	lipopolysaccharide ABC transporter permease LptF	NA	NA	NA	NA	NA
AUP43980.1|1358192_1358321_+	hypothetical protein	NA	NA	NA	NA	NA
AUP43981.1|1358545_1360057_+	multifunctional aminopeptidase A	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AUP43982.1|1360216_1360660_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AUP43983.1|1360659_1363515_+|tRNA	valyl-tRNA synthase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
1366145:1366160	attR	TCAACAGCCTGCTGCA	NA	NA	NA	NA
>prophage 3
CP025753	Escherichia coli strain CV839-06 chromosome, complete genome	4931011	2057134	2070097	4931011		Morganella_phage(30.0%)	18	NA	NA
AUP44628.1|2057134_2058454_-	hypothetical protein	NA	B6SCW4	Bacteriophage	43.2	1.2e-35
AUP44629.1|2058453_2059131_-	DNA transfer protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
AUP44630.1|2059124_2059586_-	hypothetical protein	NA	Q2A0B3	Sodalis_phage	71.5	2.9e-61
AUP44631.1|2059602_2059764_-	hypothetical protein	NA	NA	NA	NA	NA
AUP44632.1|2059946_2060060_+	hypothetical protein	NA	NA	NA	NA	NA
AUP44633.1|2060348_2063105_-	hypothetical protein	NA	A0A1W6JPG0	Morganella_phage	57.1	1.5e-298
AUP44634.1|2063455_2063797_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
AUP44635.1|2063807_2064410_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	2.0e-25
AUP44636.1|2064402_2064624_-	hypothetical protein	NA	NA	NA	NA	NA
AUP44637.1|2064620_2064884_-	hypothetical protein	NA	NA	NA	NA	NA
AUP44638.1|2065067_2065286_-	hypothetical protein	NA	NA	NA	NA	NA
AUP44639.1|2065278_2065473_-	fructokinase hypothetical protein	NA	NA	NA	NA	NA
AUP44640.1|2065874_2065991_+	putative packaging protein gp3	NA	I6S1J2	Salmonella_phage	74.3	9.5e-06
AUP44641.1|2066303_2067137_-	hypothetical protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
AUP44642.1|2067149_2067581_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	6.7e-28
AUP44643.1|2067580_2067784_-	regulatory protein	NA	NA	NA	NA	NA
AUP44644.1|2067896_2068742_-	hypothetical protein	NA	NA	NA	NA	NA
AUP44645.1|2068837_2070097_-	hypothetical protein	NA	A0A1W6JPG6	Morganella_phage	78.4	7.9e-194
>prophage 4
CP025753	Escherichia coli strain CV839-06 chromosome, complete genome	4931011	2665473	2696414	4931011	integrase,tRNA,transposase	Shigella_phage(23.08%)	30	2681733:2681748	2701726:2701741
AUP45231.1|2665473_2665806_+|tRNA	methionyl-tRNA synthetase	tRNA	NA	NA	NA	NA
AUP45232.1|2665847_2667137_-	putrescine--2-oxoglutarate aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.2e-33
AUP45233.1|2667325_2667454_+	hypothetical protein	NA	NA	NA	NA	NA
AUP45234.1|2667644_2669165_+	aerotaxis receptor	NA	A0A1B0V854	Salmonella_phage	51.5	1.5e-34
AUP45235.1|2669318_2669942_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP45236.1|2670229_2670994_+	FMN reductase	NA	NA	NA	NA	NA
AUP45237.1|2671290_2672607_+|integrase	integrase	integrase	A0A248SL35	Klebsiella_phage	28.4	5.0e-34
AUP45238.1|2672736_2673333_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	87.4	9.4e-97
AUP45239.1|2673415_2674720_-	hypothetical protein	NA	NA	NA	NA	NA
AUP45240.1|2675288_2675423_+	hypothetical protein	NA	NA	NA	NA	NA
AUP45241.1|2676091_2676838_+	hypothetical protein	NA	NA	NA	NA	NA
AUP45242.1|2677119_2677620_+	hypothetical protein	NA	NA	NA	NA	NA
AUP45243.1|2678008_2678623_+	hypothetical protein	NA	NA	NA	NA	NA
AUP45244.1|2678926_2679217_+	hypothetical protein	NA	NA	NA	NA	NA
AUP45245.1|2679331_2679478_+	hypothetical protein	NA	NA	NA	NA	NA
AUP45246.1|2679516_2680428_-|integrase	integrase	integrase	Q9ZXG3	Shigella_phage	96.0	8.8e-171
AUP45247.1|2680385_2680751_-|transposase	transposase IS2	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
AUP45248.1|2680908_2681583_+	hypothetical protein	NA	NA	NA	NA	NA
2681733:2681748	attL	TATTTTCATGGAAGGA	NA	NA	NA	NA
AUP45249.1|2681778_2681904_+	hypothetical protein	NA	NA	NA	NA	NA
AUP45250.1|2681999_2682128_-	hypothetical protein	NA	NA	NA	NA	NA
AUP45251.1|2682273_2682402_+	hypothetical protein	NA	NA	NA	NA	NA
AUP45252.1|2682487_2682841_+	element, Orf2 protein, IS66 family	NA	A0A0P0ZDM8	Stx2-converting_phage	73.3	9.3e-36
AUP45253.1|2682860_2684393_+|transposase	IS66 family element, transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	5.9e-159
AUP45254.1|2684615_2684894_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	72.1	3.4e-33
AUP45255.1|2685848_2686625_+	hypothetical protein	NA	NA	NA	NA	NA
AUP45256.1|2687280_2688888_-	type I restriction-modification protein subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	40.5	1.7e-100
AUP45257.1|2688884_2690045_-	anticodon nuclease	NA	NA	NA	NA	NA
AUP45258.1|2690041_2691313_-	hypothetical protein	NA	A0A2H4PQP5	Staphylococcus_phage	24.6	6.2e-13
AUP45259.1|2691494_2694467_-	DEAD/DEAH box helicase	NA	A0A220A398	Liberibacter_phage	22.1	4.4e-17
AUP45260.1|2695532_2696414_-|integrase	integrase	integrase	Q9ZXG3	Shigella_phage	61.2	9.0e-96
2701726:2701741	attR	TCCTTCCATGAAAATA	NA	NA	NA	NA
>prophage 5
CP025753	Escherichia coli strain CV839-06 chromosome, complete genome	4931011	3091249	3104431	4931011		Escherichia_phage(50.0%)	12	NA	NA
AUP45652.1|3091249_3092011_+	stationary phase survival protein SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
AUP45653.1|3092004_3092631_+	hypothetical protein	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AUP45654.1|3092770_3093910_+	lipoprotein NlpD activator of AmiC murein hydrolase activity, lipoprotein	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AUP45655.1|3094088_3094964_+	RpoS variant	NA	G8CLC7	Synechococcus_phage	37.6	5.4e-32
AUP45656.1|3095057_3096422_-	transporter	NA	NA	NA	NA	NA
AUP45657.1|3096510_3097287_-	hypothetical protein	NA	NA	NA	NA	NA
AUP45658.1|3097291_3097930_-	aldolase putative class II aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AUP45659.1|3097926_3099189_-	membrane protein hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AUP45660.1|3099185_3100094_-	oxidoreductase 6-phosphogluconate dehydrogenase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AUP45661.1|3100289_3101057_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AUP45662.1|3101107_3101764_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
AUP45663.1|3101869_3104431_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 6
CP025753	Escherichia coli strain CV839-06 chromosome, complete genome	4931011	3186211	3256823	4931011	tail,plate,head,terminase,capsid,tRNA,portal	Salmonella_phage(81.82%)	80	NA	NA
AUP45750.1|3186211_3187228_-	recombinase	NA	E5G6L0	Salmonella_phage	93.5	6.1e-189
AUP45751.1|3187230_3187533_-	hypothetical protein	NA	E5G6L1	Salmonella_phage	95.9	4.4e-34
AUP45752.1|3188110_3188227_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.4	3.6e-13
AUP45753.1|3188259_3188769_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	94.7	6.6e-83
AUP45754.1|3188776_3189073_+	hypothetical protein	NA	E5G6L4	Salmonella_phage	93.9	1.1e-21
AUP45755.1|3189190_3189532_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	96.5	1.9e-54
AUP45756.1|3189599_3189833_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	4.6e-31
AUP45757.1|3189832_3190060_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AUP45758.1|3190056_3190914_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	94.7	1.8e-157
AUP45759.1|3190910_3193325_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.9	0.0e+00
AUP45760.1|3193677_3193911_+	DNA-damage-inducible protein DinI	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AUP45761.1|3194590_3194977_+	hypothetical protein	NA	NA	NA	NA	NA
AUP45762.1|3195376_3195634_+	hypothetical protein	NA	NA	NA	NA	NA
AUP45763.1|3195750_3196155_+	hypothetical protein	NA	NA	NA	NA	NA
AUP45764.1|3196185_3197211_-|portal	PBSX family phage portal protein	portal	E5G6M3	Salmonella_phage	88.5	6.9e-172
AUP45765.1|3197210_3198977_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
AUP45767.1|3198986_3199121_-	hypothetical protein	NA	NA	NA	NA	NA
AUP45766.1|3199119_3199953_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	91.7	1.5e-121
AUP45768.1|3199969_3201028_+|capsid	capsid protein P2 family phage major capsid protein	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
AUP45769.1|3201031_3201682_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.9e-111
AUP45770.1|3201777_3202242_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	8.4e-77
AUP45771.1|3202241_3202445_+|tail	tail protein X phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AUP45772.1|3202448_3202664_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AUP45773.1|3202644_3203157_+	glycoside hydrolase	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
AUP45774.1|3203158_3203536_+	membrane protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	1.1e-15
AUP45775.1|3203532_3203961_+	hypothetical protein	NA	E5G6N2	Salmonella_phage	77.3	3.8e-47
AUP45776.1|3203920_3204094_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	73.7	4.3e-18
AUP45777.1|3204056_3204488_+|tail	tail protein phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
AUP45778.1|3204480_3204927_+	virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	86.3	2.3e-63
AUP45779.1|3204995_3205574_+|plate	baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	9.4e-94
AUP45780.1|3205570_3205930_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
AUP45781.1|3205916_3206825_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	2.7e-143
AUP45782.1|3206817_3207423_+|tail	tail protein phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	7.5e-110
AUP45783.1|3207419_3209507_+|tail	tail fiber protein	tail	A0A0F7LDR4	Escherichia_phage	42.7	3.6e-74
AUP45784.1|3209506_3209920_+|tail	tail fiber assembly protein	tail	U5P0S4	Shigella_phage	73.0	5.8e-21
AUP45785.1|3210026_3211199_+|tail	tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	1.0e-203
AUP45786.1|3211208_3211724_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
AUP45787.1|3211778_3212081_+	hypothetical protein	NA	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AUP45788.1|3212095_3212215_+|tail	tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AUP45789.1|3212207_3215285_+|tail	tail protein	tail	E5G6Q1	Salmonella_phage	69.3	0.0e+00
AUP45790.1|3215281_3215767_+|tail	tail assembly protein	tail	E5G6Q2	Salmonella_phage	80.6	1.8e-66
AUP45791.1|3215763_3216864_+	late control protein D	NA	E5G6Q3	Salmonella_phage	85.5	3.4e-177
AUP45792.1|3216954_3217173_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AUP45793.1|3217434_3217608_+	hypothetical protein	NA	NA	NA	NA	NA
AUP45794.1|3217576_3218350_+	reverse transcriptase	NA	NA	NA	NA	NA
AUP45795.1|3219035_3219518_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
AUP45796.1|3219649_3220126_+	hypothetical protein	NA	NA	NA	NA	NA
AUP45797.1|3220115_3220406_+	hypothetical protein	NA	NA	NA	NA	NA
AUP45798.1|3220467_3220809_-	outer membrane biogenesis protein BamE	NA	NA	NA	NA	NA
AUP45799.1|3220957_3222619_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AUP45800.1|3222704_3223583_-	inorganic polyphosphate/ATP-NAD kinase	NA	NA	NA	NA	NA
AUP45802.1|3223579_3223741_-	hypothetical protein	NA	NA	NA	NA	NA
AUP45801.1|3223705_3224299_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
AUP45803.1|3224353_3225616_-	membrane protein	NA	NA	NA	NA	NA
AUP45804.1|3225660_3226527_-	membrane protein hypothetical protein	NA	NA	NA	NA	NA
AUP45805.1|3226618_3227980_+	Signal recognition particle, subunit Ffh SRP54	NA	NA	NA	NA	NA
AUP45806.1|3228116_3228365_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUP45807.1|3228380_3228932_+	16S rRNA-processing protein M	NA	NA	NA	NA	NA
AUP45808.1|3228962_3229730_+	hypothetical protein	NA	NA	NA	NA	NA
AUP45809.1|3229771_3230119_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AUP45810.1|3230194_3230677_-	membrane protein outer membrane lipoprotein	NA	NA	NA	NA	NA
AUP45811.1|3230692_3231916_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUP45812.1|3231908_3232427_-	hypothetical protein	NA	NA	NA	NA	NA
AUP45813.1|3232576_3232942_-	lipoprotein	NA	NA	NA	NA	NA
AUP45814.1|3233151_3234222_+	phospho-2-dehydro-3-deoxyheptonate aldolase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
AUP45815.1|3234232_3235354_+	chorismate mutase bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AUP45816.1|3235396_3236557_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AUP45817.1|3236806_3237148_-	hypothetical protein	NA	NA	NA	NA	NA
AUP45818.1|3237418_3238156_-	lipoprotein	NA	NA	NA	NA	NA
AUP45819.1|3238290_3239271_+	23S rRNA pseudouridine synthase D	NA	NA	NA	NA	NA
AUP45820.1|3239267_3239999_+	membrane protein	NA	NA	NA	NA	NA
AUP45821.1|3240128_3242702_+	protein disaggregation chaperone	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
AUP45822.1|3242743_3242878_-	hypothetical protein	NA	NA	NA	NA	NA
AUP45823.1|3248567_3249866_+	alpha-ketoglutarate transporter	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
AUP45824.1|3249862_3250135_-	lipoprotein putative lipoprotein	NA	NA	NA	NA	NA
AUP45825.1|3250231_3251587_-	phosphatidylserine synthase	NA	NA	NA	NA	NA
AUP45826.1|3251700_3254361_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AUP45827.1|3254392_3255091_-	hypothetical protein	NA	NA	NA	NA	NA
AUP45828.1|3255159_3255579_-	thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AUP45829.1|3255785_3256823_+|tRNA	methyltransferase hypothetical tRNA/rRNA methyltransferase YfiF	tRNA	NA	NA	NA	NA
>prophage 7
CP025753	Escherichia coli strain CV839-06 chromosome, complete genome	4931011	3747169	3756610	4931011		Enterobacteria_phage(85.71%)	9	NA	NA
AUP46285.1|3747169_3748096_+	ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
AUP46286.1|3748100_3748832_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AUP46287.1|3748979_3749711_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AUP46288.1|3749917_3751618_+	sensor histidine kinase	NA	B6DZC2	Enterobacteria_phage	99.5	2.4e-307
AUP46289.1|3751614_3752334_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP46290.1|3752380_3752851_+	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
AUP46291.1|3752890_3753352_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AUP46292.1|3753476_3755477_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
AUP46293.1|3755473_3756610_-	hypothetical protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 8
CP025753	Escherichia coli strain CV839-06 chromosome, complete genome	4931011	3849418	3856957	4931011		Enterobacteria_phage(28.57%)	7	NA	NA
AUP46367.1|3849418_3850813_+	colanic acid biosynthesis protein	NA	A0A291LBB9	Klebsiella_phage	31.9	2.8e-19
AUP46368.1|3850970_3851966_+	UDP-N-acetylglucosamine 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
AUP46369.1|3852208_3853102_+	UTP--glucose-1-phosphate uridylyltransferase subunit GalU UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AUP46370.1|3853474_3854560_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.1e-100
AUP46371.1|3854559_3855462_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	4.4e-29
AUP46372.1|3855516_3856395_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	64.1	6.6e-107
AUP46373.1|3856399_3856957_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.8	3.9e-52
>prophage 9
CP025753	Escherichia coli strain CV839-06 chromosome, complete genome	4931011	3886143	4059621	4931011	tail,integrase,holin,terminase,head,capsid,transposase,portal	Escherichia_phage(30.63%)	194	3923186:3923245	4030331:4031661
AUP46404.1|3886143_3887166_-|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	3.9e-199
AUP46405.1|3887503_3887686_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP46406.1|3887834_3887975_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46407.1|3888816_3889020_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46408.1|3889019_3889394_-	toxin	NA	NA	NA	NA	NA
AUP46409.1|3889483_3889852_-	antitoxin	NA	NA	NA	NA	NA
AUP46410.1|3889901_3890015_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46411.1|3890014_3890236_-	DNA repair protein RadC	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AUP46412.1|3890304_3890781_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46413.1|3890796_3891270_-	hypothetical protein	NA	A9J566	Pseudomonas_phage	31.2	3.3e-12
AUP46414.1|3891611_3892430_-	hypothetical protein	NA	A0A2C9CX26	Yersinia_phage	39.3	4.7e-46
AUP46415.1|3892584_3892743_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46416.1|3892813_3895660_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46417.1|3896031_3896904_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46418.1|3896988_3897906_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46419.1|3898462_3898591_+	hypothetical protein	NA	NA	NA	NA	NA
AUP46420.1|3898737_3898935_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46421.1|3899105_3899708_-	aec62	NA	NA	NA	NA	NA
AUP46422.1|3899802_3900009_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUP46423.1|3900752_3900893_+	hemolysin activation protein	NA	NA	NA	NA	NA
AUP46424.1|3901636_3902206_+	hypothetical protein	NA	NA	NA	NA	NA
AUP46425.1|3902773_3902908_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP46426.1|3903262_3903742_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP46427.1|3903927_3904338_+	hypothetical protein	NA	NA	NA	NA	NA
AUP46428.1|3905143_3905860_+	DNA-binding protein	NA	NA	NA	NA	NA
AUP46429.1|3905847_3906003_+|transposase	transposase	transposase	NA	NA	NA	NA
AUP46430.1|3906301_3906421_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46431.1|3906501_3906615_+	gamma-glutamyltranspeptidase	NA	NA	NA	NA	NA
AUP46432.1|3906654_3907203_-	phosphotriesterase	NA	NA	NA	NA	NA
AUP46433.1|3907233_3907485_-	phosphotriesterase	NA	NA	NA	NA	NA
AUP46434.1|3908332_3908497_+	hypothetical protein	NA	NA	NA	NA	NA
AUP46435.1|3908687_3908828_+	hypothetical protein	NA	NA	NA	NA	NA
AUP46436.1|3908961_3909507_+	adenosylcobinamide kinase	NA	NA	NA	NA	NA
AUP46437.1|3909503_3910247_+	cobalamin synthase	NA	NA	NA	NA	NA
AUP46438.1|3910258_3911338_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
AUP46439.1|3911402_3912335_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AUP46440.1|3912791_3913709_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUP46441.1|3913810_3914761_+	CysB family transcriptional regulator	NA	NA	NA	NA	NA
AUP46442.1|3915067_3916522_+	MATE family multidrug exporter	NA	NA	NA	NA	NA
AUP46443.1|3917154_3917871_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46444.1|3918213_3919668_-	AMP nucleosidase AMP nucleosidase	NA	NA	NA	NA	NA
AUP46445.1|3919769_3921086_-	shikimate transporter	NA	NA	NA	NA	NA
AUP46446.1|3921400_3922453_+	hypothetical protein	NA	NA	NA	NA	NA
AUP46447.1|3922486_3922621_+	hypothetical protein	NA	NA	NA	NA	NA
AUP46448.1|3922708_3923038_-	autotransporter	NA	NA	NA	NA	NA
3923186:3923245	attL	TGGATTTGCCCCTATATTTCCAGACACCTGTTATCACTTAACCCATTACTGGCTTGCTGC	NA	NA	NA	NA
AUP46449.1|3923196_3924102_-|transposase	transposase	transposase	Q9ZXG3	Shigella_phage	96.3	1.6e-172
AUP46450.1|3924059_3924305_-|transposase	transposase	transposase	Q76S41	Shigella_phage	98.8	1.3e-36
AUP46451.1|3924500_3925874_-	autotransporter	NA	NA	NA	NA	NA
AUP46452.1|3925909_3926050_-	adhesin	NA	NA	NA	NA	NA
AUP46453.1|3926006_3926717_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46454.1|3927408_3929430_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUP46455.1|3929560_3931138_-	salicyl-AMP ligase	NA	NA	NA	NA	NA
AUP46456.1|3931141_3931945_-	thioesterase yersiniabactin siderophore biosynthetic protein	NA	NA	NA	NA	NA
AUP46457.1|3931941_3933042_-	oxidoreductase yersiniabactin biosynthetic protein YbtU	NA	NA	NA	NA	NA
AUP46458.1|3933038_3942530_-	polyketide synthase	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
AUP46459.1|3942617_3948725_-	peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.3	4.0e-33
AUP46460.1|3948915_3949875_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUP46461.1|3950131_3951844_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	2.3e-31
AUP46462.1|3951830_3953633_+	ABC transporter permease	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
AUP46463.1|3953625_3954906_+	MFS transporter	NA	NA	NA	NA	NA
AUP46464.1|3954933_3956238_+	salicylate synthase	NA	NA	NA	NA	NA
AUP46465.1|3956431_3957181_-|integrase	putative prophage P4 integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	42.0	1.6e-40
AUP46466.1|3957185_3957347_-|integrase	integrase	integrase	A7X7X0	Dichelobacter_phage	51.3	1.7e-05
AUP46467.1|3957684_3958482_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
AUP46468.1|3958717_3959743_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
AUP46469.1|3959742_3959946_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46470.1|3960004_3962446_-	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	47.0	1.0e-112
AUP46471.1|3962539_3962731_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46472.1|3962727_3962916_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AUP46473.1|3962932_3963055_+	hypothetical protein	NA	NA	NA	NA	NA
AUP46474.1|3963483_3963702_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46475.1|3963731_3963860_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46476.1|3963861_3964098_-	hypothetical protein	NA	M4QQ57	Salicola_phage	48.9	5.1e-06
AUP46477.1|3964314_3964734_-	XRE family transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
AUP46478.1|3964813_3965068_+	regulatory protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
AUP46479.1|3965064_3965490_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUP46480.1|3965561_3966638_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.5e-63
AUP46481.1|3966678_3967089_+	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	91.2	1.2e-63
AUP46482.1|3967158_3967515_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	6.7e-58
AUP46483.1|3967698_3968010_+	hypothetical protein	NA	A0A0F6R8N3	Escherichia_coli_O157_typing_phage	87.6	2.8e-36
AUP46484.1|3968448_3968712_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	71.3	1.5e-30
AUP46485.1|3968722_3969067_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	92.1	7.4e-54
AUP46486.1|3969266_3969557_+	hypothetical protein	NA	NA	NA	NA	NA
AUP46487.1|3969597_3970425_+	hypothetical protein	NA	NA	NA	NA	NA
AUP46488.1|3971636_3971750_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46489.1|3972021_3973071_+	hypothetical protein	NA	U5P0K4	Shigella_phage	54.0	2.1e-107
AUP46490.1|3973083_3973443_+	endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	8.3e-40
AUP46491.1|3973439_3974129_+	antiterminator	NA	I6PDF8	Cronobacter_phage	49.8	5.8e-58
AUP46492.1|3974748_3974877_+	hypothetical protein	NA	NA	NA	NA	NA
AUP46493.1|3975290_3975683_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	90.0	3.4e-55
AUP46494.1|3975672_3975948_+|holin	holin	holin	Q9MBZ4	Enterobacteria_phage	96.7	7.2e-44
AUP46495.1|3975950_3976328_+	hypothetical protein	NA	Q9MBZ3	Enterobacteria_phage	98.4	1.3e-64
AUP46496.1|3976369_3976522_+	hypothetical protein	NA	NA	NA	NA	NA
AUP46497.1|3976574_3976709_+	hypothetical protein	NA	NA	NA	NA	NA
AUP46498.1|3977224_3977398_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46499.1|3978052_3978373_+|terminase	terminase	terminase	A0A1B5FPA0	Escherichia_phage	97.2	1.9e-51
AUP46500.1|3978372_3980130_+	hypothetical protein	NA	A0A1B5FP96	Escherichia_phage	99.7	0.0e+00
AUP46501.1|3980141_3980324_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
AUP46502.1|3980323_3981565_+|portal	portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
AUP46503.1|3981542_3982193_+	primosome assembly protein PriA	NA	U5P4H2	Shigella_phage	100.0	2.5e-119
AUP46504.1|3982207_3983413_+|capsid	capsid protein	capsid	U5P0G9	Shigella_phage	99.0	1.3e-222
AUP46505.1|3983464_3983653_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	98.4	2.7e-26
AUP46506.1|3983739_3983970_+	hypothetical protein	NA	A0A1B5FP86	Escherichia_phage	98.5	3.1e-32
AUP46507.1|3984316_3984763_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.1	2.3e-63
AUP46508.1|3984879_3985104_+	hypothetical protein	NA	A0A1B5FP84	Escherichia_phage	97.3	3.0e-32
AUP46509.1|3985164_3985869_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	94.9	2.8e-116
AUP46510.1|3985883_3986255_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
AUP46511.1|3986266_3986557_+|tail	phage tail protein	tail	A0A1B5FP87	Escherichia_phage	97.8	1.1e-42
AUP46512.1|3986602_3987829_+|tail	lambda family phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	100.0	4.9e-132
AUP46513.1|3987810_3988050_+	hypothetical protein	NA	A0A1B5FPE2	Escherichia_phage	94.8	4.7e-31
AUP46514.1|3988109_3988436_+	hypothetical protein	NA	A0A1B5FPE2	Escherichia_phage	99.0	1.0e-44
AUP46515.1|3988583_3989825_+|tail	lambda family phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	94.7	9.5e-200
AUP46516.1|3989817_3990159_+|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	65.5	1.8e-39
AUP46517.1|3990158_3990857_+|tail	tail protein	tail	A0A1B5FP81	Escherichia_phage	97.8	2.8e-132
AUP46518.1|3990861_3991605_+|tail	putative tail assembly protein	tail	K7PLW1	Enterobacteria_phage	97.6	8.6e-148
AUP46519.1|3991601_3992144_+	hypothetical protein	NA	A0A291AWV5	Escherichia_phage	86.3	2.3e-78
AUP46520.1|3992204_3995684_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.4	0.0e+00
AUP46521.1|3995751_3996351_+	hypothetical protein	NA	A0A0P0ZCF6	Stx2-converting_phage	96.5	3.5e-107
AUP46522.1|3996351_3996525_-	hypothetical protein	NA	Q6H9T0	Enterobacteria_phage	100.0	1.9e-26
AUP46523.1|3996912_3997650_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46524.1|3997685_3997883_+	hypothetical protein	NA	NA	NA	NA	NA
AUP46525.1|3997888_3998812_+|tail	phage tail fiber protein	tail	X2KTY7	Enterobacteria_phage	65.2	2.2e-28
AUP46526.1|3998851_3998965_+	hypothetical protein	NA	NA	NA	NA	NA
AUP46527.1|3999245_4000079_-	putrescine/spermidine ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	28.7	6.5e-11
AUP46528.1|4000092_4001229_-	putrescine/spermidine ABC transporter ATPase	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
AUP46529.1|4001207_4001423_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46530.1|4001478_4002705_+	peptidase T	NA	NA	NA	NA	NA
AUP46531.1|4002753_4003875_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46532.1|4003950_4005411_-	sensor protein PhoQ	NA	NA	NA	NA	NA
AUP46533.1|4005410_4006082_-	PhoP family transcriptional regulator	NA	NA	NA	NA	NA
AUP46534.1|4006250_4007621_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
AUP46535.1|4007624_4008266_-	lysogenization regulator	NA	NA	NA	NA	NA
AUP46536.1|4008301_4009408_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46537.1|4009461_4009923_-	phosphatase phosphohydrolase	NA	NA	NA	NA	NA
AUP46538.1|4009932_4010556_-	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AUP46539.1|4010757_4012008_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
AUP46540.1|4012121_4013264_-|integrase	integrase	integrase	O21929	Phage_21	100.0	6.2e-206
AUP46541.1|4013629_4013869_-	hypothetical protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
AUP46542.1|4013916_4014135_-	conjugal transfer protein TraR	NA	M1FQT7	Enterobacteria_phage	98.6	1.7e-35
AUP46543.1|4014233_4014449_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
AUP46544.1|4014525_4015083_-	DNA N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
AUP46545.1|4015233_4015758_-	exonuclease	NA	A0A0N6WET1	Escherichia_phage	99.4	2.6e-98
AUP46546.1|4015910_4016696_-	recombinase Bet protein	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AUP46547.1|4016701_4016998_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	6.8e-48
AUP46548.1|4017074_4017281_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AUP46549.1|4017759_4018272_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46550.1|4018268_4019408_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46551.1|4019537_4020023_-	regulatory protein	NA	Q76H56	Enterobacteria_phage	84.5	3.1e-74
AUP46552.1|4020598_4021138_+	regulator	NA	M9NZI6	Enterobacteria_phage	66.7	6.8e-62
AUP46553.1|4021134_4022154_+	hypothetical protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	4.0e-111
AUP46554.1|4022150_4022864_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	83.4	1.7e-108
AUP46555.1|4023060_4023177_+	hypothetical protein	NA	NA	NA	NA	NA
AUP46556.1|4023858_4024362_+|transposase	transposase IS1 transposase	transposase	U5P0U6	Shigella_phage	98.8	8.2e-94
AUP46557.1|4024372_4024522_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46558.1|4024786_4025242_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.2	2.7e-59
AUP46559.1|4025404_4025695_+	hypothetical protein	NA	K7PGZ6	Enterobacteria_phage	95.8	3.0e-48
AUP46560.1|4025691_4026054_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	7.3e-60
AUP46561.1|4026053_4026191_+	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	68.3	9.2e-08
AUP46562.1|4026276_4026660_+	antitermination protein	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
AUP46563.1|4026848_4027931_-	outer membrane porin protein C	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
AUP46564.1|4028504_4028720_+|holin	holin	holin	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AUP46565.1|4028719_4029109_+	lysozyme	NA	A0A291AWW2	Escherichia_phage	97.3	1.2e-57
AUP46566.1|4029270_4029516_+|transposase	transposase	transposase	Q76S41	Shigella_phage	98.8	1.3e-36
AUP46567.1|4029473_4030379_+|transposase	transposase	transposase	Q9ZXG3	Shigella_phage	96.3	1.6e-172
AUP46568.1|4030549_4031011_+	endopeptidase	NA	A0A0K2FJD0	Enterobacteria_phage	97.4	1.0e-74
AUP46569.1|4031042_4031336_-	hypothetical protein	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AUP46570.1|4032281_4032827_+	protein convertase	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
4030331:4031661	attR	GCAGCAAGCCAGTAATGGGTTAAGTGATAACAGGTGTCTGGAAATATAGGGGCAAATCCACAATTTCAGAACATCGACGCTTCTTCGCAAAATAAACCAGGGCGATATCAAAGGCGCATGTGATCAGCTACGTCGCTGGACATATGCTGGCGGTAAGCAATGGAAAGGTCTCATGACTCGTCGTGAGATTGAGCGTGAAATCTGTTTGTGGGGTCAGCAATGAACAGAGTAACCGCGATTATCTCCGCTCTGGTTATCTGCATCATCGTCTGCCTGTCATGGGCTGTTAATCATTACCGTGATAACGCCATTACCTACAAAGCCCAGCGCGACAAAAATGCCAGAGAACTGAAGCTGGCGAACGCGGCAATTACTGACATGCAGATGCGCCAGCGTGATGTTGCTGCACTGGATGAAAAATACACGAAGGAGTTAGCTAATGCGAAAGCTGAAAATGATGCTCTGCGTGATGATGTTGCCGCTGGTCGTCGTCGGTTGCACATCAAAGCAGTCTGTCAGTCAGTGCGTGAAGCCACCACCGCCTCCGGCGTGGATAATGCAGCCTCCCCCCGACTGGCAGACACCGCTGAACAGGATTATTTCACCCTCAGAGAGAGGCTGATCACTATGCAAAAACAACTGGAAGGAACCCAGAAGTATATTAATGAGCAGTGCAGATAGAGCTGCCCATATCGATGGGCAACTCATGCAATTATTGTGAGCAATACACACGCGCTTCCAGCGGAGTATAAATGCCTAAAGTAATAAAACCGAGCAATCCATTTACGAATGTTTGCTGGGTTTCTGTTTTAACAACATTTTCTGCGCCGCCACAAATTTTGGCTGCATCAACAGTTTTCTCCTGTCCAATTCCCGAAACGAAGAAGTGATGGGTGATGGTTTCCTTTGGTGTTACTGCTGTCGGTTTGTTTCCAACAGTAAACGTCTGTTGAGCACATCCTGTAATAAGCATTGCCAGAGCGGCAGAAAACAACATTTTTTTCATCTTATTATCCTGCATTGTTAAAAACGGCAGAATCCTATGTGACAACAATTAAACGATAGTTAAATGGATTGATGAAAATTAAAACTATATAGGTGTACGCTCAGACTATTGGAGGAAGTTGGGGACACTCAGAATCCTGTGGAATGAAATAAACCGGTCTATCCGTCTATTACCCTTTTAGCTGCGCTGTATCGTCGCCGTATTCCCGCATTAACCATGACCGTAGCCCGACGGGGAATTCCTTCTGCGTGAGTGTGCGGGAATAATCAAAAACGATGCACACCGGGTTTTACTGTGCTGACAGACGCAGGGTTACCCTCATAGT	NA	NA	NA	NA
AUP46571.1|4032801_4034727_+|terminase	terminase putative packaging protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
AUP46572.1|4034723_4034930_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AUP46573.1|4034926_4036528_+	plasmid partitioning protein ParB	NA	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
AUP46574.1|4036508_4037828_+|capsid	capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	98.2	4.5e-232
AUP46575.1|4037837_4038170_+|head	bacteriophage lambda head decoration protein D	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
AUP46576.1|4038225_4039251_+|head	head protein	head	C6ZCY2	Enterobacteria_phage	99.1	1.7e-191
AUP46577.1|4039292_4039688_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
AUP46578.1|4039699_4040053_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.2e-62
AUP46579.1|4040064_4040643_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	7.8e-80
AUP46580.1|4040639_4041035_+	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
AUP46581.1|4041042_4041783_+|tail	tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.4	9.5e-131
AUP46582.1|4041798_4042221_+|tail	tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	3.8e-68
AUP46583.1|4042202_4042637_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AUP46584.1|4042629_4044090_+|tail	tail protein	tail	A0A2R9YJM8	Escherichia_phage	93.8	1.8e-245
AUP46585.1|4044150_4045209_+|tail	tail protein	tail	A0A2R9YJM8	Escherichia_phage	93.8	3.8e-165
AUP46586.1|4045205_4045535_+|tail	tail protein	tail	A0A2R9YJM0	Escherichia_phage	98.2	4.7e-58
AUP46587.1|4045534_4046233_+|tail	tail protein	tail	A5LH40	Enterobacteria_phage	96.1	1.1e-128
AUP46588.1|4046381_4046981_+	endopeptidase	NA	C6ZCZ3	Enterobacteria_phage	99.5	1.1e-121
AUP46589.1|4046977_4047550_+|tail	phage tail protein	tail	A0A0K2FJB0	Escherichia_phage	97.9	6.3e-82
AUP46590.1|4047610_4049794_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	99.0	0.0e+00
AUP46591.1|4049983_4051024_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	98.0	2.6e-195
AUP46592.1|4051094_4051694_+	hypothetical protein	NA	K7PJP9	Enterobacteria_phage	99.5	6.7e-111
AUP46593.1|4051694_4051868_-	hypothetical protein	NA	Q6H9T0	Enterobacteria_phage	96.5	2.8e-25
AUP46594.1|4051908_4055034_+|tail	tail fiber protein	tail	K7PGT9	Enterobacteria_phage	70.9	5.5e-281
AUP46595.1|4055216_4055333_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46596.1|4055509_4056598_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.0	1.1e-15
AUP46597.1|4057803_4059621_+	ATPase AAA	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.0e-26
>prophage 10
CP025753	Escherichia coli strain CV839-06 chromosome, complete genome	4931011	4463380	4522602	4931011	protease,tail,transposase,capsid	Enterobacteria_phage(47.62%)	70	NA	NA
AUP46974.1|4463380_4463539_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	84.6	3.0e-18
AUP46975.1|4463856_4464447_+	hypothetical protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AUP46976.1|4464544_4465120_-|tail	tail assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	2.0e-104
AUP46977.1|4465119_4466778_-	membrane protein	NA	U5N099	Enterobacteria_phage	56.9	8.8e-76
AUP46978.1|4466738_4466873_-	hypothetical protein	NA	NA	NA	NA	NA
AUP46979.1|4466908_4467646_+	hypothetical protein	NA	NA	NA	NA	NA
AUP46980.1|4468033_4468207_+	hypothetical protein	NA	Q6H9T0	Enterobacteria_phage	100.0	1.9e-26
AUP46981.1|4468207_4468807_-	hypothetical protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.3e-109
AUP46982.1|4468873_4472272_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	88.6	0.0e+00
AUP46983.1|4472332_4472881_-|tail	bacteriophage lambda tail assembly protein I	tail	A0A291AWV5	Escherichia_phage	100.0	1.1e-94
AUP46984.1|4472877_4473513_-	endopeptidase	NA	A0A0K2FIQ5	Escherichia_phage	98.6	8.4e-128
AUP46985.1|4473626_4474325_-|tail	tail protein putative minor tail protein	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
AUP46986.1|4474334_4474664_-|tail	tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
AUP46987.1|4474663_4477729_-|tail	tail protein	tail	A0A291AWX1	Escherichia_phage	99.1	0.0e+00
AUP46988.1|4477700_4477976_-|tail	tail protein minor tail protein	tail	A5LH37	Enterobacteria_phage	100.0	1.3e-45
AUP46989.1|4478038_4478425_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.9	2.2e-62
AUP46990.1|4478485_4479229_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	97.6	3.6e-130
AUP46991.1|4479239_4479641_-|tail	tail protein tail component of prophage	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
AUP46992.1|4479637_4480216_-|tail	tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
AUP46993.1|4480227_4480503_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
AUP46994.1|4480495_4480819_-	hypothetical protein	NA	K7PLV6	Enterobacteria_phage	99.1	9.4e-51
AUP46995.1|4480905_4482864_-	peptidase S14	NA	A5LH30	Enterobacteria_phage	99.4	0.0e+00
AUP46996.1|4482910_4484386_-|capsid	capsid protein	capsid	K7PJP3	Enterobacteria_phage	99.6	6.2e-283
AUP46997.1|4484385_4484598_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AUP46998.1|4484594_4486526_-	DNA packaging protein	NA	A5LH27	Enterobacteria_phage	98.4	0.0e+00
AUP46999.1|4486702_4487005_-	hypothetical protein	NA	A5LH26	Enterobacteria_phage	100.0	3.5e-47
AUP47000.1|4487275_4487395_-	membrane protein	NA	NA	NA	NA	NA
AUP47001.1|4487810_4488017_-	phage protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
AUP47002.1|4488879_4489053_-	hypothetical protein	NA	NA	NA	NA	NA
AUP47003.1|4489726_4489939_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AUP47004.1|4490302_4490785_-	hypothetical protein	NA	A0A291LBG9	Klebsiella_phage	29.9	2.8e-06
AUP47005.1|4490796_4491330_-	hypothetical protein	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AUP47006.1|4491326_4491638_-	hypothetical protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AUP47007.1|4491642_4491849_-	hypothetical protein	NA	A5LH82	Enterobacteria_phage	94.1	4.5e-30
AUP47008.1|4492611_4492827_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AUP47009.1|4493127_4493340_+	cold-shock protein	NA	NA	NA	NA	NA
AUP47010.1|4493574_4493730_-	hypothetical protein	NA	NA	NA	NA	NA
AUP47011.1|4493761_4494514_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
AUP47012.1|4494527_4495577_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
AUP47013.1|4495923_4496175_-	hypothetical protein	NA	NA	NA	NA	NA
AUP47014.1|4496236_4496353_-	hypothetical protein	NA	NA	NA	NA	NA
AUP47015.1|4496905_4497145_-	bifunctional antitoxin/transcriptional repressor RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AUP47016.1|4497677_4498010_+	protein flxA hypothetical protein	NA	NA	NA	NA	NA
AUP47017.1|4498446_4499787_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP47018.1|4500280_4501246_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	1.7e-55
AUP47019.1|4501226_4501688_-	hypothetical protein	NA	NA	NA	NA	NA
AUP47020.1|4501731_4501959_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP47021.1|4502309_4502444_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP47022.1|4502635_4502791_+	hypothetical protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
AUP47023.1|4502792_4503368_+	hypothetical protein	NA	NA	NA	NA	NA
AUP47024.1|4503854_4504043_+	regulatory protein	NA	NA	NA	NA	NA
AUP47025.1|4504217_4505123_-|transposase	transposase	transposase	Q9ZXG3	Shigella_phage	96.3	1.6e-172
AUP47026.1|4505080_4505326_-|transposase	transposase	transposase	Q76S41	Shigella_phage	98.8	1.3e-36
AUP47027.1|4505628_4505970_+	hypothetical protein	NA	NA	NA	NA	NA
AUP47028.1|4506004_4506565_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AUP47029.1|4506567_4507191_-	hypothetical protein	NA	NA	NA	NA	NA
AUP47030.1|4507385_4507691_+	membrane protein	NA	NA	NA	NA	NA
AUP47031.1|4507889_4510316_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
AUP47032.1|4510373_4512800_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.4	3.1e-207
AUP47033.1|4512810_4513428_+	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AUP47034.1|4513429_4514284_+	oxidoreductase, membrane subunit	NA	NA	NA	NA	NA
AUP47035.1|4514326_4514941_+	hypothetical protein	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AUP47036.1|4515135_4516392_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
AUP47037.1|4516344_4517040_-	dithiobiotin synthetase	NA	NA	NA	NA	NA
AUP47038.1|4517164_4518385_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP47039.1|4518519_4519413_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUP47040.1|4519519_4520773_+	membrane protein putative arabinose efflux transporter	NA	NA	NA	NA	NA
AUP47041.1|4520821_4520941_-	hypothetical protein	NA	NA	NA	NA	NA
AUP47042.1|4521169_4521505_+	acid-shock protein	NA	NA	NA	NA	NA
AUP47043.1|4521780_4522602_+|protease	serine protease hypothetical protein	protease	NA	NA	NA	NA
>prophage 11
CP025753	Escherichia coli strain CV839-06 chromosome, complete genome	4931011	4901277	4930956	4931011	tail,transposase	Escherichia_phage(35.0%)	29	NA	NA
AUP47431.1|4901277_4902954_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
AUP47432.1|4903209_4903392_-	hypothetical protein	NA	NA	NA	NA	NA
AUP47433.1|4903470_4904382_-	membrane protein hypothetical protein	NA	NA	NA	NA	NA
AUP47434.1|4904560_4905481_+	multidrug transporter	NA	NA	NA	NA	NA
AUP47435.1|4905469_4905940_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	49.0	1.8e-34
AUP47436.1|4905920_4907339_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	4.0e-101
AUP47437.1|4907405_4907834_-	hydrolase	NA	NA	NA	NA	NA
AUP47438.1|4908092_4908596_+|transposase	transposase, IS1 family	transposase	U5P0U6	Shigella_phage	93.8	3.1e-85
AUP47439.1|4908652_4910011_-	sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
AUP47440.1|4910010_4910793_-	transcriptional regulator	NA	W8CYM9	Bacillus_phage	35.2	4.8e-32
AUP47441.1|4910814_4911228_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AUP47442.1|4911336_4912341_+	TMAO/DMSO reductase	NA	NA	NA	NA	NA
AUP47443.1|4912341_4912977_+	sulfite oxidase subunit YedZ	NA	NA	NA	NA	NA
AUP47444.1|4913233_4913884_+	zinc/cadmium-binding protein	NA	NA	NA	NA	NA
AUP47445.1|4915653_4917786_-|tail	tail fiber protein	tail	K7PGT9	Enterobacteria_phage	59.0	3.8e-241
AUP47446.1|4917964_4918432_+	hypothetical protein	NA	NA	NA	NA	NA
AUP47447.1|4918819_4918993_+	hypothetical protein	NA	Q6H9T0	Enterobacteria_phage	96.5	2.8e-25
AUP47448.1|4918993_4919593_-	hypothetical protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	4.8e-109
AUP47449.1|4919661_4923057_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.9	0.0e+00
AUP47450.1|4923117_4923630_-|tail	tail protein	tail	K7PH50	Enterobacteria_phage	95.9	5.4e-85
AUP47451.1|4923662_4924406_-|tail	tail protein	tail	K7PLW1	Enterobacteria_phage	93.1	6.4e-143
AUP47452.1|4924410_4925109_-|tail	tail protein	tail	A0A1B5FP81	Escherichia_phage	96.6	4.4e-130
AUP47453.1|4925108_4925450_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	65.5	6.0e-40
AUP47454.1|4925442_4928670_-|tail	lambda family phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.7	0.0e+00
AUP47455.1|4928715_4929006_-|tail	phage tail protein	tail	A0A1B5FP87	Escherichia_phage	97.8	1.1e-42
AUP47456.1|4929017_4929389_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
AUP47457.1|4929403_4930108_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	94.9	2.8e-116
AUP47458.1|4930168_4930393_-	hypothetical protein	NA	A0A1B5FP84	Escherichia_phage	97.3	3.0e-32
AUP47459.1|4930509_4930956_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.1	2.3e-63
>prophage 1
CP025752	Escherichia coli strain CV839-06 plasmid pCV839-06-p2, complete sequence	63821	1457	53671	63821	transposase,integrase	Escherichia_phage(41.18%)	59	23930:23989	54249:54447
AUP42588.1|1457_3071_-|transposase	IS66 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AUP42589.1|3101_3452_-	isocitrate lyase hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AUP42590.1|3448_3874_-|transposase	IS66 transposase	transposase	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AUP42591.1|3944_4082_-	hypothetical protein	NA	NA	NA	NA	NA
AUP42592.1|4384_5110_+|transposase	transposase	transposase	A0A077SK28	Escherichia_phage	99.1	5.8e-125
AUP42593.1|5119_5899_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.2	1.7e-138
AUP42594.1|5898_6921_-|transposase	transposase IS100, transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AUP42595.1|7045_7324_+|transposase	transposase	transposase	A0A077SK28	Escherichia_phage	95.7	1.9e-44
AUP42596.1|7362_7488_-	hypothetical protein	NA	NA	NA	NA	NA
AUP42597.1|7719_7851_-	hypothetical protein	NA	NA	NA	NA	NA
AUP42598.1|8168_12260_+	autotransporter	NA	Q9LA58	Enterobacterial_phage	42.6	2.4e-284
AUP42599.1|12423_12552_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	1.6e-06
AUP42600.1|12517_13405_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
AUP42601.1|13404_13680_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	3.5e-46
AUP42602.1|13889_14006_-	hypothetical protein	NA	NA	NA	NA	NA
AUP42603.1|14036_15473_-	hemolysin D	NA	NA	NA	NA	NA
AUP42604.1|15491_17615_-	peptidase C39	NA	W8CYL7	Bacillus_phage	29.9	1.7e-47
AUP42605.1|17686_20761_-	exotoxin paxA	NA	NA	NA	NA	NA
AUP42606.1|20772_21285_-	hemolysin D	NA	NA	NA	NA	NA
AUP42607.1|21767_22673_-|integrase	integrase	integrase	Q9ZXG3	Shigella_phage	94.7	1.2e-167
AUP42608.1|22630_22996_-|transposase	transposase IS2	transposase	Q76S41	Shigella_phage	99.2	1.1e-58
AUP42609.1|23815_23932_-	hypothetical protein	NA	NA	NA	NA	NA
23930:23989	attL	CATCGATAGGAATTTAAATCCCAAAAAGATTAAAAAAACACCCAAAAACGGATGTTTATT	NA	NA	NA	NA
AUP42610.1|24117_24438_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP42611.1|24538_25405_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
AUP42612.1|25612_25744_+	hypothetical protein	NA	NA	NA	NA	NA
AUP42613.1|25755_26619_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP42614.1|26573_26939_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP42615.1|27040_27157_+	hypothetical protein	NA	NA	NA	NA	NA
AUP42616.1|27361_27490_-	hypothetical protein	NA	NA	NA	NA	NA
AUP42617.1|27594_27960_+|transposase	transposase IS2	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
AUP42618.1|27983_28823_+|integrase	integrase	integrase	Q9ZXG3	Shigella_phage	99.3	5.1e-165
AUP42619.1|29360_29528_+	hypothetical protein	NA	NA	NA	NA	NA
AUP42620.1|30510_30807_-	hypothetical protein	NA	NA	NA	NA	NA
AUP42621.1|31104_31248_-	hypothetical protein	NA	NA	NA	NA	NA
AUP42622.1|31506_31623_-	hypothetical protein	NA	NA	NA	NA	NA
AUP42623.1|31641_32007_+|transposase	transposase	transposase	NA	NA	NA	NA
AUP42624.1|31961_33194_+|transposase	transposase IS1294	transposase	NA	NA	NA	NA
AUP42625.1|33374_35492_-	DNA topoisomerase III	NA	NA	NA	NA	NA
AUP42626.1|35503_36091_-	hypothetical protein	NA	NA	NA	NA	NA
AUP42627.1|36092_36266_-	hypothetical protein	NA	NA	NA	NA	NA
AUP42628.1|36340_36556_-	IncN plasmid KikA protein	NA	NA	NA	NA	NA
AUP42629.1|36661_38629_-	conjugal transfer protein TraK	NA	NA	NA	NA	NA
AUP42630.1|38679_39699_-	secretion system protein E	NA	NA	NA	NA	NA
AUP42631.1|39698_40841_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
AUP42632.1|40830_41610_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
AUP42633.1|41606_42344_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AUP42634.1|42474_44847_-	conjugal transfer protein	NA	NA	NA	NA	NA
AUP42635.1|44849_45170_-	hypothetical protein	NA	NA	NA	NA	NA
AUP42636.1|45227_45521_-	conjugal transfer protein	NA	NA	NA	NA	NA
AUP42637.1|45513_46098_-	conjugal transfer protein	NA	NA	NA	NA	NA
AUP42638.1|46087_46273_-	hypothetical protein	NA	NA	NA	NA	NA
AUP42639.1|46468_47464_+	conjugal transfer protein TraA	NA	NA	NA	NA	NA
AUP42640.1|47465_48107_+	conjugal transfer protein TrbJ	NA	NA	NA	NA	NA
AUP42641.1|48119_48353_+	hypothetical protein	NA	NA	NA	NA	NA
AUP42642.1|48393_48681_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AUP42643.1|48877_49216_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP42644.1|50394_51198_-	hypothetical protein	NA	NA	NA	NA	NA
AUP42645.1|51256_51376_+	hypothetical protein	NA	NA	NA	NA	NA
AUP42646.1|52438_53671_-|transposase	transposase IS1294	transposase	NA	NA	NA	NA
54249:54447	attR	CATCGATAGGAATTTAAATCCCAAAAAGATTAAAAAAACACCCAAAAACGGATGTTTATTCAACACTGCCTGCGTGCCATGAGTGCACCGCCATCAATTAAATGGATCTTATCGAGTGATACTGTATATCACTGATGGTTTTTTACTCCATTCCCCTGAAAATGGACGCAACTTCCCCGATGCGGCTCTCAGCCGCACA	NA	NA	NA	NA
