The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025939	Bacillus velezensis strain 10075 chromosome, complete genome	4326822	112749	155670	4326822		Bacillus_phage(64.86%)	59	NA	NA
AUS14798.1|112749_113715_+	recombinase XerD	NA	A0A142F1N9	Bacillus_phage	49.1	7.4e-83
AUS14799.1|113902_114355_+	hypothetical protein	NA	NA	NA	NA	NA
AUS14800.1|114351_114801_+	hypothetical protein	NA	NA	NA	NA	NA
AUS14801.1|114816_115236_+	helix-turn-helix domain-containing protein	NA	A0A2H4IZR0	uncultured_Caudovirales_phage	58.7	2.7e-34
AUS14802.1|115628_115952_+	hypothetical protein	NA	A0A0S2MUA3	Bacillus_phage	37.8	1.7e-07
AUS14803.1|115999_116395_+	hypothetical protein	NA	NA	NA	NA	NA
AUS14804.1|116408_116624_+	hypothetical protein	NA	NA	NA	NA	NA
AUS14805.1|116620_116959_+	hypothetical protein	NA	R4JGJ3	Bacillus_phage	39.5	2.9e-10
AUS14806.1|117086_117437_+	hypothetical protein	NA	NA	NA	NA	NA
AUS14807.1|118461_118818_+	hypothetical protein	NA	A0A2I6UHX7	Bacillus_phage	58.7	4.7e-27
AUS14808.1|118984_119164_+	hypothetical protein	NA	A0A1P8CX65	Bacillus_phage	64.6	6.8e-11
AUS14809.1|119156_119939_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	53.4	3.3e-73
AUS14810.1|119935_120442_+	hypothetical protein	NA	NA	NA	NA	NA
AUS14811.1|120438_120663_+	hypothetical protein	NA	NA	NA	NA	NA
AUS14812.1|120659_122075_+	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	50.6	1.3e-125
AUS14813.1|122209_123205_+	DNA primase	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	45.9	1.8e-71
AUS14814.1|123221_123467_-	XRE family transcriptional regulator	NA	O64102	Bacillus_phage	41.2	2.8e-07
AUS14815.1|123520_123730_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUS14816.1|123843_125070_+	hypothetical protein	NA	I7J4K0	Bacillus_phage	30.8	5.0e-44
AUS14817.1|125292_125964_+	hypothetical protein	NA	NA	NA	NA	NA
AUS14818.1|126266_126833_+	hypothetical protein	NA	NA	NA	NA	NA
AUS14819.1|127070_127826_+	single-stranded DNA-binding protein	NA	A0A0N9SJW5	Paenibacillus_phage	51.1	3.0e-55
AUS14820.1|127860_128295_+	hypothetical protein	NA	NA	NA	NA	NA
AUS14821.1|128294_129602_+	hypothetical protein	NA	A0A142F1R1	Bacillus_phage	29.0	4.0e-23
AUS14822.1|129957_132114_+	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	53.2	6.0e-210
AUS14823.1|132113_133025_+	hypothetical protein	NA	A0A0K2CNU9	Brevibacillus_phage	55.5	4.3e-85
AUS14824.1|133025_134087_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	53.1	7.8e-78
AUS14825.1|134240_134774_+	hypothetical protein	NA	A0A2H4IZL3	uncultured_Caudovirales_phage	44.0	1.9e-32
AUS14826.1|134773_135139_+	hypothetical protein	NA	A0A140HLL8	Bacillus_phage	37.7	1.8e-13
AUS14827.1|135138_135360_+	hypothetical protein	NA	NA	NA	NA	NA
AUS14828.1|135365_135605_+	hypothetical protein	NA	NA	NA	NA	NA
AUS14829.1|135601_135787_+	hypothetical protein	NA	NA	NA	NA	NA
AUS14830.1|135791_136148_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	56.8	7.7e-30
AUS18666.1|136182_136860_+	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A217ER63	Bacillus_phage	84.4	3.1e-104
AUS14831.1|136957_137644_+	HNH endonuclease	NA	L0LCB9	Bacillus_phage	57.7	3.5e-47
AUS14832.1|137794_139177_+	ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	78.6	2.2e-213
AUS14833.1|139164_139416_+	hypothetical protein	NA	NA	NA	NA	NA
AUS14834.1|139412_140396_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	77.7	2.6e-144
AUS14835.1|140618_141140_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	53.7	2.4e-40
AUS14836.1|141139_141451_+	hypothetical protein	NA	NA	NA	NA	NA
AUS14837.1|141451_142237_+	thymidylate synthase (FAD)	NA	A0A142F1S2	Bacillus_phage	67.6	1.8e-87
AUS14838.1|142233_142791_+	hypothetical protein	NA	U5PX11	Bacillus_phage	39.7	2.8e-34
AUS14839.1|142833_143400_+	hypothetical protein	NA	A0A142F1S8	Bacillus_phage	59.8	9.7e-27
AUS14840.1|143599_144610_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	33.6	2.4e-15
AUS14841.1|144606_145182_+	dephospho-CoA kinase	NA	J9Q953	Bacillus_phage	43.9	4.7e-37
AUS14842.1|145164_145557_-	hypothetical protein	NA	NA	NA	NA	NA
AUS14843.1|145592_146852_+	hypothetical protein	NA	A0A0N9ST12	Paenibacillus_phage	66.1	3.5e-149
AUS14844.1|147268_147898_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	39.4	5.2e-13
AUS14845.1|147935_148115_+	hypothetical protein	NA	NA	NA	NA	NA
AUS14846.1|148147_148576_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUS14847.1|148893_149706_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	61.7	2.0e-97
AUS14848.1|149797_150154_-	hypothetical protein	NA	NA	NA	NA	NA
AUS14849.1|150168_150351_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	81.8	5.7e-21
AUS14850.1|150532_150970_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	67.9	1.4e-49
AUS14851.1|151075_151279_-	hypothetical protein	NA	NA	NA	NA	NA
AUS14852.1|151638_153399_-	right-handed parallel beta-helix repeat-containing protein	NA	F8WPS8	Bacillus_phage	46.9	1.7e-146
AUS14853.1|153398_154196_-	hypothetical protein	NA	O64134	Bacillus_phage	49.2	5.4e-55
AUS14854.1|154327_154549_+	transcriptional regulator	NA	NA	NA	NA	NA
AUS14855.1|154647_155670_+	hypothetical protein	NA	A0A1V0SAH6	Catovirus	44.1	4.2e-12
>prophage 2
CP025939	Bacillus velezensis strain 10075 chromosome, complete genome	4326822	161059	189638	4326822	head,portal,terminase,tail,protease,holin,capsid	Bacillus_phage(63.64%)	31	NA	NA
AUS14863.1|161059_161395_+	endonuclease	NA	A0A1B1P8D2	Bacillus_phage	57.8	8.9e-28
AUS14864.1|161517_161841_+|terminase	phage terminase small subunit P27 family	terminase	A0A0K2CZN8	Paenibacillus_phage	72.0	3.7e-31
AUS14865.1|161815_163597_+|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	67.1	1.9e-246
AUS14866.1|163608_164874_+|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	43.6	1.2e-88
AUS14867.1|164860_165607_+|protease	Clp protease ClpP	protease	A0A2I7SCR6	Paenibacillus_phage	51.3	6.8e-60
AUS14868.1|165606_166761_+|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	59.0	1.5e-119
AUS14869.1|166801_167290_+	hypothetical protein	NA	NA	NA	NA	NA
AUS14870.1|167292_167532_+|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	48.6	1.4e-11
AUS14871.1|167537_167879_+|head,tail	head-tail adaptor protein	head,tail	A6M954	Geobacillus_virus	46.7	2.4e-20
AUS18667.1|167902_168304_+	hypothetical protein	NA	NA	NA	NA	NA
AUS14872.1|168300_168645_+	hypothetical protein	NA	A0A0S2SY15	Bacillus_phage	48.7	2.3e-23
AUS18668.1|168662_169250_+|tail	phage tail protein	tail	NA	NA	NA	NA
AUS14873.1|169915_175264_+|tail	phage tail tape measure protein	tail	Q2I8F0	Bacillus_phage	44.4	3.4e-97
AUS14874.1|175263_176082_+|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	42.4	2.0e-57
AUS14875.1|176093_177623_+	hypothetical protein	NA	A0A0U4JID8	Exiguobacterium_phage	34.4	3.8e-49
AUS14876.1|177637_180199_+	peptidase G2	NA	D6R401	Bacillus_phage	60.2	4.4e-300
AUS14877.1|180212_181409_+	hypothetical protein	NA	D6R402	Bacillus_phage	59.6	1.5e-101
AUS14878.1|181405_181789_+	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	59.1	4.9e-30
AUS18669.1|181793_181994_+	XkdX family protein	NA	A0A1W6JQ64	Staphylococcus_phage	56.5	6.1e-08
AUS14879.1|182016_182301_+|holin	holin	holin	NA	NA	NA	NA
AUS14880.1|182382_183321_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	62.6	4.8e-95
AUS14881.1|183342_183600_+|holin	holin	holin	A0A0U4JE55	Bacillus_phage	57.6	5.0e-23
AUS14882.1|183729_184059_+	hypothetical protein	NA	NA	NA	NA	NA
AUS14883.1|184078_184414_-	YolD-like family protein	NA	O64030	Bacillus_phage	34.7	4.4e-11
AUS14884.1|184489_184741_-	hypothetical protein	NA	A0A2H4J8H2	uncultured_Caudovirales_phage	50.8	1.3e-10
AUS14885.1|184760_184967_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUS14886.1|185141_185933_+	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	30.5	1.2e-17
AUS14887.1|186228_186549_+	hypothetical protein	NA	NA	NA	NA	NA
AUS14888.1|186615_187257_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AUS14889.1|187475_188651_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AUS14890.1|188792_189638_+	GW domain-containing glycosaminoglycan-binding protein	NA	A0A0K2CP65	Brevibacillus_phage	45.2	1.5e-26
>prophage 3
CP025939	Bacillus velezensis strain 10075 chromosome, complete genome	4326822	445015	490699	4326822	terminase,holin,coat,portal	uncultured_Caudovirales_phage(58.82%)	66	NA	NA
AUS15120.1|445015_445195_+	DNA-binding response regulator	NA	A0A290GJH9	Caldibacillus_phage	82.5	1.3e-17
AUS15121.1|445206_445683_-	hypothetical protein	NA	A0A2H4JA43	uncultured_Caudovirales_phage	37.6	3.8e-24
AUS15122.1|445828_446509_-	hypothetical protein	NA	NA	NA	NA	NA
AUS15123.1|446946_447369_-	transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	41.4	3.1e-09
AUS15124.1|447513_447756_+	transcriptional regulator	NA	NA	NA	NA	NA
AUS15125.1|448003_448702_+	phage antirepressor	NA	Q4ZCB0	Staphylococcus_virus	48.4	5.0e-33
AUS15126.1|448769_449342_+	XRE family transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	55.0	3.4e-59
AUS15127.1|449338_449617_+	hypothetical protein	NA	NA	NA	NA	NA
AUS15128.1|449603_449804_+	hypothetical protein	NA	NA	NA	NA	NA
AUS15129.1|449914_450532_+	hypothetical protein	NA	NA	NA	NA	NA
AUS15130.1|450524_450710_+	hypothetical protein	NA	NA	NA	NA	NA
AUS15131.1|450709_451660_+	hypothetical protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	73.3	9.6e-136
AUS15132.1|451662_452502_+	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	79.4	2.5e-119
AUS15133.1|453506_454415_+	ATP-binding protein IstB	NA	A0A2H4J4P8	uncultured_Caudovirales_phage	72.8	1.9e-104
AUS15134.1|454713_455103_+	hypothetical protein	NA	Q5YA89	Bacillus_phage	50.8	1.1e-26
AUS15135.1|455089_455548_+	hypothetical protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	79.3	1.0e-58
AUS15136.1|455901_456105_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	3.4e-22
AUS15137.1|456136_456523_+	hypothetical protein	NA	NA	NA	NA	NA
AUS15138.1|456519_456780_+	hypothetical protein	NA	F8WQ54	Bacillus_phage	43.4	3.3e-06
AUS15139.1|456783_457197_+	hypothetical protein	NA	A0A1P8CWZ8	Bacillus_phage	93.2	8.9e-70
AUS15140.1|457306_457630_+	hypothetical protein	NA	M5ABU9	Bacillus_phage	34.7	1.6e-05
AUS15141.1|457626_458310_+	dUTPase	NA	R9TQ23	Paenibacillus_phage	43.8	9.0e-35
AUS15142.1|458309_458615_+	hypothetical protein	NA	Q38076	Bacillus_phage	36.5	1.5e-10
AUS18682.1|458873_459185_+	hypothetical protein	NA	F8WQ59	Bacillus_phage	46.2	5.5e-16
AUS15143.1|459181_459631_+	hypothetical protein	NA	M4ZRL6	Bacillus_phage	52.5	3.2e-33
AUS15144.1|459627_459816_+	hypothetical protein	NA	NA	NA	NA	NA
AUS15145.1|460183_460402_+	hypothetical protein	NA	NA	NA	NA	NA
AUS15146.1|460407_460842_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.2	1.8e-49
AUS15147.1|460875_461166_+	hypothetical protein	NA	NA	NA	NA	NA
AUS15148.1|461509_461716_+	hypothetical protein	NA	NA	NA	NA	NA
AUS15149.1|461715_462177_+	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	52.0	1.1e-25
AUS15150.1|462345_462603_+	hypothetical protein	NA	A0A2H4J825	uncultured_Caudovirales_phage	38.8	3.9e-07
AUS15151.1|462768_463530_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	60.4	3.3e-62
AUS15152.1|463516_464722_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	84.0	1.2e-202
AUS15153.1|464725_466159_+|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	58.9	2.5e-151
AUS15154.1|466109_466289_+	hypothetical protein	NA	NA	NA	NA	NA
AUS15155.1|466426_467146_+	ribonuclease	NA	A0A1L2K2N1	Aeribacillus_phage	56.1	5.0e-52
AUS15156.1|467160_468021_+|coat	P22 coat protein - protein 5 domain protein	coat	A0A1L2JY55	Aeribacillus_phage	77.1	4.5e-124
AUS15157.1|468034_468238_+	hypothetical protein	NA	NA	NA	NA	NA
AUS15158.1|468249_469119_+	hypothetical protein	NA	A0A2H4JD21	uncultured_Caudovirales_phage	43.0	1.1e-50
AUS15159.1|469133_469469_+	hypothetical protein	NA	A0A2H4J6J9	uncultured_Caudovirales_phage	56.8	7.3e-30
AUS15160.1|469473_469977_+	hypothetical protein	NA	A0A2H4J4S5	uncultured_Caudovirales_phage	59.5	9.5e-50
AUS15161.1|469976_470366_+	hypothetical protein	NA	A0A2H4JDP3	uncultured_Caudovirales_phage	57.9	2.1e-28
AUS15162.1|470322_470793_+	hypothetical protein	NA	A0A2H4J4R9	uncultured_Caudovirales_phage	57.0	4.4e-49
AUS15163.1|470797_471832_+	hypothetical protein	NA	A0A2H4J8B9	uncultured_Caudovirales_phage	63.3	1.0e-122
AUS15164.1|471848_472244_+	DUF3277 domain-containing protein	NA	A0A2H4J4R5	uncultured_Caudovirales_phage	64.3	2.3e-38
AUS15165.1|472344_472644_+	hypothetical protein	NA	A0A2D1GQ87	Lysinibacillus_phage	41.7	1.7e-06
AUS15166.1|472802_477458_+	hypothetical protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	49.7	1.2e-117
AUS15167.1|477458_478016_+	LysM domain-containing protein	NA	A0A2H4JD33	uncultured_Caudovirales_phage	65.9	8.6e-60
AUS15168.1|478029_478389_+	hypothetical protein	NA	A0A2H4J6L1	uncultured_Caudovirales_phage	71.2	6.1e-43
AUS15169.1|478372_479341_+	hypothetical protein	NA	A0A2H4J4T4	uncultured_Caudovirales_phage	58.6	1.4e-102
AUS18683.1|479340_479688_+	hypothetical protein	NA	A0A2H4JDQ2	uncultured_Caudovirales_phage	59.1	3.4e-30
AUS15170.1|479684_480041_+	DUF2634 domain-containing protein	NA	A0A2H4J4S8	uncultured_Caudovirales_phage	60.2	1.8e-34
AUS15171.1|480033_481209_+	hypothetical protein	NA	A0A2H4J8D2	uncultured_Caudovirales_phage	71.9	1.4e-152
AUS15172.1|481205_481835_+	hypothetical protein	NA	A0A2H4J4S3	uncultured_Caudovirales_phage	82.8	1.1e-90
AUS15173.1|481849_483070_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	41.3	7.9e-50
AUS15174.1|483088_483553_+	hypothetical protein	NA	O64053	Bacillus_phage	34.9	6.6e-05
AUS15175.1|483542_483737_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	64.5	8.2e-18
AUS15176.1|483801_484080_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	72.8	5.1e-29
AUS15177.1|484095_484359_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	69.0	2.6e-27
AUS15178.1|484415_485573_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	66.2	1.3e-70
AUS15179.1|485593_486334_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AUS15180.1|486879_487110_+	DNA-binding protein	NA	A0A290FZJ4	Caldibacillus_phage	51.4	2.8e-09
AUS15181.1|487301_487691_-	hypothetical protein	NA	NA	NA	NA	NA
AUS15182.1|487705_489286_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	55.6	1.7e-68
AUS15183.1|489586_490699_+	aspartate phosphatase	NA	D6R410	Bacillus_phage	67.6	3.5e-137
>prophage 4
CP025939	Bacillus velezensis strain 10075 chromosome, complete genome	4326822	947869	954122	4326822		Staphylococcus_phage(66.67%)	10	NA	NA
AUS15594.1|947869_948985_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.3	5.7e-55
AUS15595.1|948965_949613_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	8.8e-40
AUS15596.1|949627_950824_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	2.1e-116
AUS15597.1|950856_951321_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
AUS15598.1|951437_951812_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUS15599.1|951717_951933_-	hypothetical protein	NA	NA	NA	NA	NA
AUS15600.1|951877_952399_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
AUS15601.1|952486_952576_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
AUS15602.1|952783_953539_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	2.9e-10
AUS15603.1|953528_954122_+	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
>prophage 5
CP025939	Bacillus velezensis strain 10075 chromosome, complete genome	4326822	1111467	1119109	4326822		Bacillus_phage(88.89%)	12	NA	NA
AUS15766.1|1111467_1111692_+	XRE family transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	80.3	3.4e-23
AUS15767.1|1112069_1112294_+	hypothetical protein	NA	O64027	Bacillus_phage	54.5	5.7e-15
AUS15768.1|1112299_1112659_+	hypothetical protein	NA	O64028	Bacillus_phage	61.4	7.5e-33
AUS15769.1|1113871_1114114_-	hypothetical protein	NA	NA	NA	NA	NA
AUS15770.1|1114280_1114403_-	phosphatase RapK inhibitor	NA	NA	NA	NA	NA
AUS15771.1|1114399_1115515_-	tetratricopeptide repeat-containing protein	NA	D6R410	Bacillus_phage	47.8	9.1e-93
AUS15772.1|1115882_1116335_+	hypothetical protein	NA	O64117	Bacillus_phage	76.7	6.3e-61
AUS15773.1|1116581_1116956_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	52.8	8.1e-30
AUS18711.1|1117758_1118112_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
AUS15774.1|1118276_1118471_+	hypothetical protein	NA	O64195	Bacillus_phage	70.0	2.5e-14
AUS15775.1|1118473_1118650_+	hypothetical protein	NA	O64196	Bacillus_phage	93.1	5.0e-22
AUS15776.1|1118683_1119109_-	SDR family oxidoreductase	NA	A0A1V0SAI8	Catovirus	35.6	2.7e-13
>prophage 6
CP025939	Bacillus velezensis strain 10075 chromosome, complete genome	4326822	1415820	1448472	4326822		Bacillus_phage(83.87%)	52	NA	NA
AUS16006.1|1415820_1416420_-	hypothetical protein	NA	O64195	Bacillus_phage	90.9	5.7e-94
AUS16007.1|1416517_1416757_+	XRE family transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	65.8	6.5e-25
AUS16008.1|1416986_1417418_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16009.1|1417846_1418092_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16010.1|1418256_1418496_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16011.1|1418762_1418984_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16012.1|1418993_1419821_-	hypothetical protein	NA	O64184	Bacillus_phage	89.5	8.3e-152
AUS16013.1|1419822_1420767_-	HNH endonuclease	NA	A0A1B1P765	Bacillus_phage	41.8	6.9e-17
AUS16014.1|1420812_1421016_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16015.1|1421035_1421377_-	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	72.6	3.3e-22
AUS16016.1|1421504_1421867_-	hypothetical protein	NA	R4JGJ3	Bacillus_phage	46.3	1.0e-21
AUS16017.1|1421863_1422340_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16018.1|1422351_1422678_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16019.1|1422737_1423103_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16020.1|1423232_1423739_-	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	39.8	4.8e-33
AUS16021.1|1423738_1424590_-	thymidylate synthase	NA	U5J9N5	Bacillus_phage	39.4	1.1e-50
AUS16022.1|1424640_1425288_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
AUS16023.1|1425304_1425691_-	hypothetical protein	NA	A0A1P8CX52	Bacillus_phage	62.1	7.8e-36
AUS16024.1|1426059_1426359_-	hypothetical protein	NA	O64180	Bacillus_phage	53.3	5.1e-19
AUS16025.1|1426351_1426618_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16026.1|1426958_1427393_+	hypothetical protein	NA	NA	NA	NA	NA
AUS16027.1|1428175_1428415_-	thiol reductase thioredoxin	NA	A0A1P8CX24	Bacillus_phage	77.2	3.4e-29
AUS16028.1|1429025_1429664_-	hypothetical protein	NA	A0A2I6PF91	Proteus_phage	25.1	3.3e-07
AUS16029.1|1430398_1430641_-	hypothetical protein	NA	NA	NA	NA	NA
AUS18723.1|1432258_1432936_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	96.0	9.0e-120
AUS18722.1|1432943_1433333_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	82.9	9.0e-56
AUS16030.1|1433335_1433701_-	hypothetical protein	NA	O64171	Bacillus_phage	80.0	8.4e-48
AUS16031.1|1433943_1434144_-	hypothetical protein	NA	O64170	Bacillus_phage	98.5	1.8e-31
AUS16032.1|1434188_1434380_-	hypothetical protein	NA	O64169	Bacillus_phage	96.9	3.5e-29
AUS16033.1|1434399_1434534_-	hypothetical protein	NA	O64168	Bacillus_phage	95.5	3.7e-17
AUS16034.1|1434565_1435033_-	hypothetical protein	NA	O64167	Bacillus_phage	78.2	1.6e-62
AUS16035.1|1435096_1435390_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16036.1|1435434_1435632_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16037.1|1435624_1436065_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16038.1|1436065_1436494_-	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	63.0	1.9e-35
AUS16039.1|1436505_1436955_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16040.1|1436971_1437151_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16041.1|1437212_1437551_-	hypothetical protein	NA	S5MS56	Bacillus_phage	53.0	7.6e-19
AUS16042.1|1438083_1438269_-	hypothetical protein	NA	A0A1P8CX22	Bacillus_phage	70.0	2.4e-19
AUS16043.1|1438562_1439321_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16044.1|1439508_1439706_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16045.1|1439720_1439948_-	hypothetical protein	NA	A0A1P8CX31	Bacillus_phage	65.3	4.9e-22
AUS16046.1|1439985_1440201_-	hypothetical protein	NA	O64155	Bacillus_phage	58.8	2.1e-14
AUS16047.1|1440250_1441003_-	site-specific DNA-methyltransferase	NA	A0A2H4IZ65	uncultured_Caudovirales_phage	58.4	2.7e-72
AUS16048.1|1441097_1441532_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16049.1|1441544_1442042_-	hypothetical protein	NA	A0A1P8CX28	Bacillus_phage	76.2	3.8e-67
AUS16050.1|1442201_1442405_-	hypothetical protein	NA	O64150	Bacillus_phage	80.6	4.5e-27
AUS18724.1|1442416_1443076_-	hypothetical protein	NA	A0A1P8CX16	Bacillus_phage	37.2	8.1e-25
AUS16051.1|1443138_1444860_-	hypothetical protein	NA	A0A1B1P7M5	Bacillus_phage	56.3	5.4e-177
AUS16052.1|1444869_1445937_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16053.1|1445952_1446969_-	hypothetical protein	NA	A0A1W6JK26	Lactococcus_phage	29.6	2.8e-16
AUS16054.1|1446990_1448472_-	DNA helicase	NA	V9VET6	Lactococcus_phage	26.9	1.5e-42
>prophage 7
CP025939	Bacillus velezensis strain 10075 chromosome, complete genome	4326822	1451501	1479994	4326822	integrase	Bacillus_phage(90.32%)	48	1467711:1467731	1483444:1483464
AUS16058.1|1451501_1452431_-	hypothetical protein	NA	A0A127AW73	Bacillus_phage	28.5	1.1e-19
AUS16059.1|1453326_1453704_-	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	77.0	7.6e-52
AUS18725.1|1453776_1454013_+	hypothetical protein	NA	NA	NA	NA	NA
AUS16060.1|1454050_1454575_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16061.1|1454687_1456430_-	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	64.1	4.7e-221
AUS18726.1|1456426_1457251_-	hypothetical protein	NA	O64134	Bacillus_phage	63.7	3.9e-93
AUS16062.1|1457529_1457880_-	hypothetical protein	NA	A0A0H3UZ02	Geobacillus_virus	59.5	3.3e-17
AUS16063.1|1457923_1458145_-	hypothetical protein	NA	A0A1P8CWZ6	Bacillus_phage	87.7	9.0e-29
AUS16064.1|1458216_1458891_+	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	95.1	7.9e-76
AUS16065.1|1458958_1459771_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	87.0	3.6e-139
AUS16066.1|1460840_1461149_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16067.1|1461160_1461685_-	hypothetical protein	NA	A0A1Z1DA37	Bacillus_phage	56.7	2.7e-47
AUS16068.1|1461722_1461944_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16069.1|1462170_1462362_-	hypothetical protein	NA	A0A142F1P8	Bacillus_phage	50.0	2.1e-13
AUS16070.1|1462465_1462651_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16071.1|1462983_1463358_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	65.9	4.0e-37
AUS16072.1|1463371_1463587_-	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	91.5	2.3e-29
AUS16073.1|1463838_1465260_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16074.1|1465349_1465868_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AUS16075.1|1466022_1466469_-	hypothetical protein	NA	A0A191ZDH8	Pseudoalteromonas_virus	38.2	1.0e-10
AUS16076.1|1466449_1466665_-	hypothetical protein	NA	A0A0Y0ATQ5	Bacillus_phage	47.9	3.7e-11
AUS16077.1|1466783_1466966_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16078.1|1466953_1467166_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16079.1|1467162_1467387_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16080.1|1467423_1467648_-	hypothetical protein	NA	A0A1P8CWW8	Bacillus_phage	50.6	1.5e-15
1467711:1467731	attL	AATACTTATTTTATTTTTATT	NA	NA	NA	NA
AUS16081.1|1467756_1468002_-	hypothetical protein	NA	A0A1P8CWW5	Bacillus_phage	52.0	5.7e-16
AUS16082.1|1468076_1468376_-	hypothetical protein	NA	A0A1P8CWX3	Bacillus_phage	51.0	3.6e-20
AUS16083.1|1468541_1468763_+	XRE family transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	79.5	2.2e-27
AUS16084.1|1468983_1469967_-|integrase	integrase	integrase	A0A1P8CWX4	Bacillus_phage	78.0	1.1e-139
AUS16085.1|1469987_1471337_-	hypothetical protein	NA	A0A1P8CWX1	Bacillus_phage	75.2	1.1e-188
AUS16086.1|1471413_1472472_-|integrase	integrase	integrase	A0A1P8CWW9	Bacillus_phage	75.7	1.8e-154
AUS16087.1|1472684_1472915_-	hypothetical protein	NA	A0A1P8CWW1	Bacillus_phage	72.3	5.5e-21
AUS16088.1|1472929_1473142_-	hypothetical protein	NA	A0A1P8CWW7	Bacillus_phage	78.5	3.5e-22
AUS16089.1|1473726_1474881_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16090.1|1475042_1475453_-	HicB family protein	NA	A0A1L2JY34	Aeribacillus_phage	58.1	3.1e-38
AUS16091.1|1475535_1475868_-	hypothetical protein	NA	A0A1P8CWV8	Bacillus_phage	51.9	9.1e-25
AUS16092.1|1475873_1476419_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16093.1|1476467_1476599_-	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	86.0	1.0e-16
AUS16094.1|1476610_1476826_-	hypothetical protein	NA	O64089	Bacillus_phage	50.7	4.4e-12
AUS16095.1|1476828_1477080_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	61.0	3.5e-21
AUS16096.1|1477149_1477332_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	87.9	6.5e-25
AUS16097.1|1477346_1477571_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16098.1|1477595_1477823_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16099.1|1477865_1478417_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16100.1|1478610_1478943_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16101.1|1478980_1479427_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16102.1|1479518_1479734_-	XRE family transcriptional regulator	NA	O64085	Bacillus_phage	42.3	2.7e-09
AUS18727.1|1479781_1479994_-	XRE family transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	76.8	1.1e-23
1483444:1483464	attR	AATACTTATTTTATTTTTATT	NA	NA	NA	NA
>prophage 8
CP025939	Bacillus velezensis strain 10075 chromosome, complete genome	4326822	1506930	1523110	4326822		Bacillus_phage(64.71%)	24	NA	NA
AUS16128.1|1506930_1508373_+	hypothetical protein	NA	U5J9V5	Bacillus_phage	39.5	3.5e-89
AUS18728.1|1508447_1509884_+	hypothetical protein	NA	A0A0K2FMA5	Brevibacillus_phage	33.3	3.7e-62
AUS16129.1|1509908_1510451_+	hypothetical protein	NA	NA	NA	NA	NA
AUS16130.1|1510475_1511468_+	hypothetical protein	NA	E0YJ30	Lactococcus_phage	31.6	2.0e-35
AUS16131.1|1511520_1512054_+	hypothetical protein	NA	A0A0K2FLE1	Brevibacillus_phage	40.8	6.6e-25
AUS18729.1|1512189_1512498_+	hypothetical protein	NA	A0A0H3UZ42	Geobacillus_virus	44.0	2.0e-13
AUS16132.1|1512494_1512815_+	hypothetical protein	NA	U5J9I5	Bacillus_phage	37.9	9.7e-16
AUS16133.1|1512811_1513477_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	53.6	3.1e-48
AUS16134.1|1513473_1513980_+	hypothetical protein	NA	O64060	Bacillus_phage	68.5	4.0e-64
AUS18730.1|1513991_1514717_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	40.8	1.1e-43
AUS16135.1|1514755_1515547_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	37.5	2.3e-18
AUS16136.1|1515567_1516035_+	hypothetical protein	NA	NA	NA	NA	NA
AUS16137.1|1516106_1516463_+	hypothetical protein	NA	O64055	Bacillus_phage	78.8	2.4e-47
AUS16138.1|1516462_1517794_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	39.6	5.0e-21
AUS16139.1|1517807_1518083_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	37.2	4.0e-10
AUS16140.1|1518083_1518236_+	XkdX family protein	NA	NA	NA	NA	NA
AUS16141.1|1518254_1519103_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
AUS16142.1|1519185_1519671_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	64.5	4.7e-54
AUS16143.1|1519670_1520087_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	68.3	3.6e-47
AUS16144.1|1520100_1521078_+	recombinase XerD	NA	A0A0K2FM05	Brevibacillus_phage	59.9	1.3e-108
AUS16145.1|1521288_1521471_+	hypothetical protein	NA	NA	NA	NA	NA
AUS16146.1|1521471_1521828_+	hypothetical protein	NA	NA	NA	NA	NA
AUS16147.1|1521891_1522302_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16148.1|1522483_1523110_+	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	28.9	3.1e-18
>prophage 9
CP025939	Bacillus velezensis strain 10075 chromosome, complete genome	4326822	2060624	2134700	4326822	terminase,capsid,tail,protease,holin,portal	Bacillus_phage(25.64%)	82	NA	NA
AUS16554.1|2060624_2061584_+|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	50.9	3.4e-72
AUS16555.1|2061961_2064250_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AUS16556.1|2064298_2064970_-	transcriptional regulator YeiL	NA	NA	NA	NA	NA
AUS16557.1|2065051_2066236_+	MFS transporter	NA	NA	NA	NA	NA
AUS16558.1|2066475_2068233_+	hypothetical protein	NA	NA	NA	NA	NA
AUS16559.1|2068254_2069382_-	glycosyltransferase	NA	NA	NA	NA	NA
AUS16560.1|2069386_2069851_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16561.1|2069856_2070111_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16562.1|2070029_2070314_+	hypothetical protein	NA	NA	NA	NA	NA
AUS16563.1|2070591_2071002_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
AUS16564.1|2071075_2071585_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUS16565.1|2071612_2072038_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
AUS16566.1|2072151_2073399_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.4	1.6e-98
AUS16567.1|2073395_2074508_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.2	1.2e-73
AUS16568.1|2074876_2075779_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	35.5	3.6e-15
AUS16569.1|2075853_2076168_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AUS16570.1|2076167_2076506_-	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
AUS16571.1|2076693_2077239_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUS16572.1|2077338_2077857_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUS16573.1|2078046_2078907_+	hypothetical protein	NA	NA	NA	NA	NA
AUS16574.1|2078977_2080027_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AUS16575.1|2080054_2081026_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.6	5.2e-20
AUS16576.1|2081029_2081929_-	NlpC/P60 family protein	NA	A0A0A8WIF2	Clostridium_phage	43.0	2.0e-18
AUS16577.1|2081925_2083023_-	dipeptide epimerase	NA	NA	NA	NA	NA
AUS16578.1|2083029_2083965_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AUS16579.1|2084052_2085672_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUS16580.1|2085668_2086697_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	7.5e-17
AUS16581.1|2086702_2087650_-	ABC transporter permease	NA	NA	NA	NA	NA
AUS16582.1|2087655_2088582_-	ABC transporter permease	NA	NA	NA	NA	NA
AUS16583.1|2088596_2089421_-	aminopeptidase	NA	NA	NA	NA	NA
AUS16584.1|2089576_2091136_-	MFS transporter	NA	NA	NA	NA	NA
AUS16585.1|2091421_2092774_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	33.3	1.2e-22
AUS16586.1|2093141_2094113_-	glycosyltransferase	NA	A0A2H5BFL1	Salmonella_phage	41.6	3.8e-63
AUS16587.1|2094124_2096302_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
AUS16588.1|2096485_2097436_-	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
AUS16589.1|2097757_2099074_+	amino acid permease	NA	NA	NA	NA	NA
AUS16590.1|2099359_2099977_+	DUF47 domain-containing protein	NA	NA	NA	NA	NA
AUS16591.1|2099989_2100988_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
AUS16592.1|2101091_2101838_+	type II toxin-antitoxin system SpoIISA family toxin	NA	NA	NA	NA	NA
AUS16593.1|2101838_2102009_+	stage II sporulation protein SB	NA	NA	NA	NA	NA
AUS16594.1|2102265_2103144_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.5	3.7e-81
AUS16595.1|2103157_2103421_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
AUS16596.1|2103434_2103698_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
AUS16597.1|2103749_2104511_-|portal	phage portal protein	portal	NA	NA	NA	NA
AUS16598.1|2104567_2104765_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	7.3e-14
AUS16599.1|2104769_2105195_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16600.1|2105207_2106797_-	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	55.4	4.9e-15
AUS16601.1|2106799_2107072_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16602.1|2107068_2107647_-	DUF2313 domain-containing protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	31.0	2.4e-12
AUS16603.1|2107630_2108677_-|portal	phage portal protein	portal	S6AVU3	Thermus_phage	44.1	1.0e-69
AUS16604.1|2108669_2109095_-	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	1.5e-11
AUS16605.1|2109198_2109465_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	38.6	1.5e-06
AUS16606.1|2109464_2110442_-|portal	phage portal protein	portal	A0A1L6BY20	Clostridium_phage	30.9	1.7e-34
AUS16607.1|2110455_2111115_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	45.3	1.8e-08
AUS16608.1|2111107_2115991_-|portal	phage portal protein	portal	A0A1L2JY60	Aeribacillus_phage	46.6	3.2e-41
AUS16609.1|2115978_2116131_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16610.1|2116172_2116619_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
AUS16611.1|2116693_2117137_-|portal	phage portal protein	portal	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
AUS16612.1|2117138_2118536_-|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	40.4	9.0e-82
AUS16613.1|2118535_2118745_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16614.1|2118741_2119188_-|portal	phage portal protein	portal	NA	NA	NA	NA
AUS16615.1|2119184_2119688_-|portal	phage portal protein	portal	NA	NA	NA	NA
AUS16616.1|2119684_2120041_-	DUF3599 domain-containing protein	NA	NA	NA	NA	NA
AUS16617.1|2120037_2120421_-	DUF3199 domain-containing protein	NA	NA	NA	NA	NA
AUS16618.1|2120437_2121373_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
AUS16619.1|2121399_2122242_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	58.1	2.5e-55
AUS18749.1|2122261_2123653_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.8	1.4e-138
AUS16620.1|2123701_2125000_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	58.9	2.1e-149
AUS16621.1|2124996_2125794_-|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	49.4	2.3e-58
AUS16622.1|2125906_2126419_-	Fis family transcriptional regulator	NA	A0A0K2CNQ1	Brevibacillus_phage	44.6	2.9e-22
AUS16623.1|2126525_2126729_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	7.0e-12
AUS16624.1|2126718_2127060_-|portal	phage portal protein	portal	NA	NA	NA	NA
AUS16625.1|2127324_2128125_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.3	1.4e-58
AUS16626.1|2128024_2128852_-|portal	phage portal protein	portal	S6BFM4	Thermus_phage	50.0	1.3e-19
AUS16627.1|2128841_2129021_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16628.1|2129211_2129550_+	XRE family transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
AUS16629.1|2129697_2130288_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
AUS16630.1|2130309_2131146_-	manganese catalase	NA	NA	NA	NA	NA
AUS16631.1|2131216_2131819_-	hypothetical protein	NA	A0A0Y0AJU6	Bacillus_phage	48.3	4.6e-43
AUS16632.1|2131928_2132306_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	38.5	1.1e-15
AUS16633.1|2132343_2133297_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.3	2.4e-62
AUS16634.1|2133563_2134700_-	aspartate phosphatase	NA	A0A1P8CWN8	Bacillus_phage	47.6	1.9e-93
>prophage 10
CP025939	Bacillus velezensis strain 10075 chromosome, complete genome	4326822	2185782	2201266	4326822	coat,tRNA	Anomala_cuprea_entomopoxvirus(50.0%)	22	NA	NA
AUS16687.1|2185782_2186139_+|tRNA	tRNA-Val4	tRNA	NA	NA	NA	NA
AUS16688.1|2186596_2187772_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
AUS16689.1|2187764_2188886_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AUS16690.1|2189255_2189978_+	esterase family protein	NA	NA	NA	NA	NA
AUS16691.1|2190003_2190519_+	hypothetical protein	NA	NA	NA	NA	NA
AUS16692.1|2190523_2190955_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUS16693.1|2191113_2191347_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AUS16694.1|2191347_2192085_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.7	1.1e-27
AUS16695.1|2192077_2192800_+	ABC transporter permease	NA	NA	NA	NA	NA
AUS16696.1|2192786_2193581_-	subclass B1 metallo-beta-lactamase	NA	NA	NA	NA	NA
AUS16697.1|2193649_2193904_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16698.1|2194024_2196310_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	33.3	2.4e-84
AUS16699.1|2196378_2196633_-	sporulation protein	NA	NA	NA	NA	NA
AUS16700.1|2196799_2196961_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
AUS16701.1|2197052_2197250_-	hypothetical protein	NA	NA	NA	NA	NA
AUS18751.1|2197536_2197893_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
AUS16702.1|2198063_2198450_+|coat	spore coat protein	coat	NA	NA	NA	NA
AUS16703.1|2198487_2198802_+|coat	spore coat protein	coat	NA	NA	NA	NA
AUS16704.1|2198894_2199395_+|coat	spore coat protein	coat	NA	NA	NA	NA
AUS16705.1|2199545_2200028_+|coat	spore coat protein	coat	NA	NA	NA	NA
AUS16706.1|2200173_2200617_+|coat	spore coat protein	coat	NA	NA	NA	NA
AUS16707.1|2200675_2201266_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 11
CP025939	Bacillus velezensis strain 10075 chromosome, complete genome	4326822	2451658	2527679	4326822	tRNA,portal,integrase,tail,protease,holin,capsid	Bacillus_phage(35.42%)	90	2449186:2449201	2500414:2500429
2449186:2449201	attL	CTTTTCGTTTCTTAAA	NA	NA	NA	NA
AUS16953.1|2451658_2452141_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
AUS18763.1|2452177_2453089_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16954.1|2453165_2454326_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AUS16955.1|2454410_2455034_+	hypothetical protein	NA	NA	NA	NA	NA
AUS18764.1|2455386_2455590_+	transcriptional regulator	NA	NA	NA	NA	NA
AUS16956.1|2455586_2456054_+	hypothetical protein	NA	NA	NA	NA	NA
AUS16957.1|2456074_2456344_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
AUS16958.1|2456518_2457655_-	alkanesulfonate monooxygenase, FMNH(2)-dependent	NA	NA	NA	NA	NA
AUS16959.1|2457679_2458513_-	ABC transporter permease	NA	NA	NA	NA	NA
AUS16960.1|2458512_2459502_-	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUS16961.1|2459517_2460285_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	3.6e-32
AUS16962.1|2460261_2460462_+	hypothetical protein	NA	NA	NA	NA	NA
AUS16963.1|2460507_2461443_-	2-amino-3-carboxymuconate-6-semialdehyde decarboxylase	NA	NA	NA	NA	NA
AUS16964.1|2461699_2463145_+	catalase	NA	A0A2K9L0T1	Tupanvirus	41.7	8.1e-110
AUS16965.1|2463216_2464182_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUS16966.1|2464174_2465161_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.8	5.1e-15
AUS16967.1|2465157_2466063_-	ABC transporter permease	NA	NA	NA	NA	NA
AUS16968.1|2466075_2467032_-	ABC transporter permease	NA	NA	NA	NA	NA
AUS16969.1|2467100_2468822_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUS16970.1|2468824_2469004_-	FbpB family small basic protein	NA	NA	NA	NA	NA
AUS18765.1|2469263_2470619_+	FAD-binding oxidoreductase	NA	S4VRT3	Pandoravirus	40.5	2.5e-44
AUS16971.1|2470659_2472432_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
AUS16972.1|2472713_2473412_-	peptidase E	NA	NA	NA	NA	NA
AUS16973.1|2473496_2475173_-	sodium:proton antiporter	NA	NA	NA	NA	NA
AUS16974.1|2475657_2476446_-	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	29.8	8.3e-16
AUS16975.1|2476605_2476818_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUS16976.1|2476863_2477199_+	YolD-like family protein	NA	O64030	Bacillus_phage	34.7	2.6e-11
AUS16977.1|2477214_2477775_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16978.1|2477867_2478125_-|holin	holin	holin	A0A0U4JE55	Bacillus_phage	57.6	5.0e-23
AUS16979.1|2478146_2479058_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	92.7	2.8e-161
AUS16980.1|2479134_2479344_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	45.1	2.6e-09
AUS16981.1|2479367_2479553_-	XkdX family protein	NA	NA	NA	NA	NA
AUS18766.1|2479722_2481111_-	DUF2479 domain-containing protein	NA	M4ZRP1	Bacillus_phage	51.3	1.9e-60
AUS16982.1|2481156_2483721_-	peptidase G2	NA	D6R401	Bacillus_phage	71.4	0.0e+00
AUS16983.1|2483735_2485136_-	endopeptidase	NA	A6M966	Geobacillus_virus	30.9	1.2e-38
AUS16984.1|2485147_2486572_-|tail	phage tail protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	43.2	2.0e-60
AUS16985.1|2486578_2489377_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	39.8	6.2e-98
AUS16986.1|2489377_2489614_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16987.1|2489709_2490081_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16988.1|2490138_2490693_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	58.4	4.0e-49
AUS16989.1|2490717_2491107_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16990.1|2491113_2491521_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	53.7	6.1e-31
AUS16991.1|2491517_2491838_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16992.1|2491853_2492240_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.8	3.5e-20
AUS16993.1|2492254_2492473_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16994.1|2492475_2492730_-	hypothetical protein	NA	NA	NA	NA	NA
AUS16995.1|2492781_2493885_-	hypothetical protein	NA	A0A2I7S650	Vibrio_phage	29.4	1.4e-32
AUS16996.1|2493896_2494568_-|protease	Clp protease ClpB	protease	A0A2H4IZP8	uncultured_Caudovirales_phage	48.5	1.1e-16
AUS16997.1|2494660_2495485_-|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	52.4	3.5e-73
AUS16998.1|2495484_2497116_-|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	55.9	6.2e-167
AUS16999.1|2497118_2497550_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	50.4	6.5e-31
AUS17000.1|2497566_2499321_-	hypothetical protein	NA	A0A2H4J484	uncultured_Caudovirales_phage	71.2	2.4e-249
AUS17001.1|2499403_2499952_+|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.1	3.1e-38
AUS18767.1|2500149_2500365_-	hypothetical protein	NA	NA	NA	NA	NA
AUS17002.1|2500894_2501161_-	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	55.2	1.0e-18
2500414:2500429	attR	CTTTTCGTTTCTTAAA	NA	NA	NA	NA
AUS17003.1|2501276_2501720_-	hypothetical protein	NA	NA	NA	NA	NA
AUS17004.1|2502702_2502933_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUS17005.1|2503400_2503601_+	hypothetical protein	NA	NA	NA	NA	NA
AUS17006.1|2503706_2504144_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	68.8	9.8e-51
AUS17007.1|2504274_2504454_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	81.4	1.3e-22
AUS17008.1|2504469_2504844_+	hypothetical protein	NA	NA	NA	NA	NA
AUS17009.1|2504942_2505752_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	61.2	2.2e-96
AUS17010.1|2505939_2506740_-	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	54.6	7.0e-71
AUS17011.1|2506827_2507379_-	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	47.8	7.3e-19
AUS17012.1|2507308_2507698_-	RNA polymerase subunit sigma	NA	A0A0N9RZI0	Paenibacillus_phage	45.0	1.0e-19
AUS17013.1|2507745_2508924_-	SAM-dependent methyltransferase	NA	A0A0N9ST12	Paenibacillus_phage	65.3	1.4e-144
AUS17014.1|2509039_2509432_+	hypothetical protein	NA	NA	NA	NA	NA
AUS17015.1|2509414_2509990_-	dephospho-CoA kinase	NA	M4HPU2	Bacillus_phage	38.9	5.4e-33
AUS17016.1|2511233_2511434_-	hypothetical protein	NA	NA	NA	NA	NA
AUS17017.1|2511448_2512015_-	hypothetical protein	NA	A0A142F1S8	Bacillus_phage	59.8	5.7e-27
AUS17018.1|2512220_2513003_-	thymidylate synthase (FAD)	NA	A0A142F1S2	Bacillus_phage	68.9	8.6e-90
AUS17019.1|2513003_2513564_-	HNH endonuclease	NA	B5LPN5	Bacillus_virus	50.3	3.2e-38
AUS17020.1|2513478_2513841_-	alpha/beta hydrolase	NA	A0A2H4IZM2	uncultured_Caudovirales_phage	68.7	6.8e-42
AUS17021.1|2514094_2515078_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	78.0	5.8e-144
AUS17022.1|2515074_2515326_-	hypothetical protein	NA	NA	NA	NA	NA
AUS17023.1|2515313_2516696_-	ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	78.6	2.2e-213
AUS17024.1|2516846_2517533_-	HNH endonuclease	NA	L0LCB9	Bacillus_phage	57.7	3.5e-47
AUS18768.1|2517630_2518308_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A217ER63	Bacillus_phage	84.4	3.1e-104
AUS17025.1|2518342_2518699_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	56.8	7.7e-30
AUS17026.1|2518703_2518889_-	hypothetical protein	NA	NA	NA	NA	NA
AUS17027.1|2518885_2519125_-	hypothetical protein	NA	NA	NA	NA	NA
AUS17028.1|2519130_2519352_-	hypothetical protein	NA	NA	NA	NA	NA
AUS17029.1|2519351_2519717_-	hypothetical protein	NA	A0A140HLL8	Bacillus_phage	37.7	1.8e-13
AUS17030.1|2519716_2520250_-	hypothetical protein	NA	A0A2H4IZL3	uncultured_Caudovirales_phage	44.0	1.9e-32
AUS17031.1|2520403_2521465_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	53.1	7.8e-78
AUS17032.1|2521465_2522377_-	hypothetical protein	NA	A0A0K2CNU9	Brevibacillus_phage	55.5	4.3e-85
AUS17033.1|2522376_2524533_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	53.2	6.0e-210
AUS17034.1|2526182_2526452_-	hypothetical protein	NA	NA	NA	NA	NA
AUS17035.1|2526451_2526889_-	hypothetical protein	NA	NA	NA	NA	NA
AUS17036.1|2526923_2527679_-	single-stranded DNA-binding protein	NA	A0A0N9SJW5	Paenibacillus_phage	51.1	1.0e-55
>prophage 12
CP025939	Bacillus velezensis strain 10075 chromosome, complete genome	4326822	2531332	2541786	4326822	integrase	Bacillus_phage(45.45%)	17	2522161:2522175	2551491:2551505
2522161:2522175	attL	GCGTATATTCATAGA	NA	NA	NA	NA
AUS17041.1|2531332_2532328_-	DNA primase	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	45.9	1.8e-71
AUS17042.1|2532462_2533881_-	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	51.1	2.2e-128
AUS17043.1|2533895_2534222_-	hypothetical protein	NA	NA	NA	NA	NA
AUS17044.1|2534308_2534821_-	hypothetical protein	NA	NA	NA	NA	NA
AUS17045.1|2534821_2535040_-	hypothetical protein	NA	NA	NA	NA	NA
AUS17046.1|2535040_2535349_-	hypothetical protein	NA	F8WPL8	Bacillus_phage	48.5	5.5e-16
AUS17047.1|2535345_2536128_-	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	54.2	8.6e-74
AUS17048.1|2537056_2537437_-	hypothetical protein	NA	R4JDR8	Bacillus_phage	87.8	5.7e-63
AUS17049.1|2537455_2537824_-	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	45.7	2.8e-22
AUS17050.1|2537951_2538344_-	hypothetical protein	NA	R4JGJ3	Bacillus_phage	47.4	1.6e-07
AUS17051.1|2538336_2538531_-	hypothetical protein	NA	NA	NA	NA	NA
AUS17052.1|2538527_2538743_-	hypothetical protein	NA	NA	NA	NA	NA
AUS17053.1|2538739_2538949_-	hypothetical protein	NA	NA	NA	NA	NA
AUS17054.1|2538996_2539320_-	hypothetical protein	NA	A0A0S2MUA3	Bacillus_phage	35.8	4.4e-08
AUS17055.1|2539706_2540126_-	helix-turn-helix domain-containing protein	NA	A0A2H4IZR0	uncultured_Caudovirales_phage	58.7	2.7e-34
AUS17056.1|2540132_2540585_-	hypothetical protein	NA	A0A1P8CX70	Bacillus_phage	33.1	2.5e-09
AUS17057.1|2540727_2541786_-|integrase	integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	26.7	2.2e-16
2551491:2551505	attR	GCGTATATTCATAGA	NA	NA	NA	NA
>prophage 13
CP025939	Bacillus velezensis strain 10075 chromosome, complete genome	4326822	3202835	3252091	4326822	coat,protease	Staphylococcus_phage(15.38%)	49	NA	NA
AUS17671.1|3202835_3203495_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AUS17672.1|3203600_3203789_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AUS17673.1|3203826_3204246_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUS17674.1|3204629_3206009_+	amino acid permease	NA	NA	NA	NA	NA
AUS17675.1|3206073_3206574_-	YwgA family protein	NA	NA	NA	NA	NA
AUS17676.1|3206613_3207915_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.5	1.0e-23
AUS17677.1|3208074_3208299_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
AUS17678.1|3208501_3209275_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
AUS17679.1|3209574_3209850_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AUS17680.1|3209850_3210405_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
AUS17681.1|3210502_3211423_+	Spermidine/putrescine import ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.6	1.3e-36
AUS17682.1|3212361_3213198_-	hypothetical protein	NA	NA	NA	NA	NA
AUS17683.1|3213188_3213986_-	hypothetical protein	NA	NA	NA	NA	NA
AUS17684.1|3213954_3214878_-	hypothetical protein	NA	NA	NA	NA	NA
AUS17685.1|3214926_3215106_-	hypothetical protein	NA	NA	NA	NA	NA
AUS17686.1|3215258_3216122_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
AUS17687.1|3216168_3217068_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.7e-07
AUS17688.1|3217183_3218161_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
AUS17689.1|3218197_3219169_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AUS17690.1|3219425_3220190_+	heme-binding protein	NA	NA	NA	NA	NA
AUS17691.1|3220309_3221089_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AUS17692.1|3221105_3222305_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AUS17693.1|3222317_3223499_-	MFS transporter	NA	NA	NA	NA	NA
AUS17694.1|3223495_3224914_-	alanine-anticapsin ligase BacD	NA	NA	NA	NA	NA
AUS17695.1|3224931_3225693_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	6.3e-21
AUS17696.1|3225689_3226400_-	bacilysin biosynthesis protein BacB	NA	NA	NA	NA	NA
AUS17697.1|3226389_3227004_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
AUS17698.1|3228625_3229828_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	26.1	7.1e-27
AUS17699.1|3229860_3231279_-	amino acid permease	NA	NA	NA	NA	NA
AUS17700.1|3231303_3232986_-	peptidase M20	NA	NA	NA	NA	NA
AUS17701.1|3233057_3234605_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUS17702.1|3234812_3236099_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
AUS17703.1|3236330_3237266_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	9.8e-24
AUS17704.1|3237267_3237966_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.8	3.2e-35
AUS17705.1|3238157_3239024_-	protein liaG	NA	NA	NA	NA	NA
AUS17706.1|3239044_3239749_-	bacitracin ABC transporter permease	NA	NA	NA	NA	NA
AUS18799.1|3239814_3240741_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	45.9	1.1e-43
AUS17707.1|3241062_3241518_-|coat	spore coat protein	coat	NA	NA	NA	NA
AUS17708.1|3241514_3242363_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	5.4e-37
AUS17709.1|3242383_3243331_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.9	1.3e-68
AUS17710.1|3243333_3244071_-	glucose-1-phosphate thymidylyltransferase	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
AUS17711.1|3244098_3245103_-|coat	spore coat protein	coat	NA	NA	NA	NA
AUS17712.1|3245104_3245848_-|coat	spore coat protein	coat	NA	NA	NA	NA
AUS17713.1|3245837_3246959_-|coat	spore coat protein	coat	NA	NA	NA	NA
AUS17714.1|3246958_3247822_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUS17715.1|3247822_3248992_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	2.5e-37
AUS17716.1|3249014_3250439_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
AUS17717.1|3250443_3251214_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.3	4.4e-06
AUS17718.1|3251494_3252091_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
>prophage 14
CP025939	Bacillus velezensis strain 10075 chromosome, complete genome	4326822	4210724	4220615	4326822		Synechococcus_phage(50.0%)	9	NA	NA
AUS18566.1|4210724_4212017_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
AUS18567.1|4212092_4212812_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	44.7	1.3e-47
AUS18568.1|4212811_4213066_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	34.6	2.1e-05
AUS18569.1|4213062_4213746_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AUS18570.1|4213729_4215958_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.7	7.2e-158
AUS18571.1|4215933_4217364_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
AUS18572.1|4217455_4218496_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.4	4.8e-64
AUS18573.1|4218492_4219080_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	7.7e-27
AUS18574.1|4219076_4220615_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.5	3.3e-77
>prophage 1
CP025940	Bacillus velezensis strain 10075 plasmid unnamed, complete sequence	13003	0	12952	13003		Bacillus_phage(60.0%)	18	NA	NA
AUS18847.1|748_967_-	hypothetical protein	NA	NA	NA	NA	NA
AUS18848.1|980_2087_-	hypothetical protein	NA	Q9ZXE1	Bacillus_phage	40.5	9.5e-10
AUS18849.1|2087_2873_-	hypothetical protein	NA	B6RT59	Bacillus_virus	31.8	3.1e-07
AUS18850.1|2841_3666_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A160LKR7	Bacillus_phage	50.8	2.7e-49
AUS18851.1|3674_4427_-	hypothetical protein	NA	NA	NA	NA	NA
AUS18852.1|4413_4710_-	hypothetical protein	NA	NA	NA	NA	NA
AUS18853.1|4858_5038_-	hypothetical protein	NA	S5YC89	Bacillus_phage	47.4	2.5e-05
AUS18854.1|5050_5374_-	hypothetical protein	NA	NA	NA	NA	NA
AUS18855.1|5640_5889_-	hypothetical protein	NA	B6RT50	Bacillus_virus	39.7	3.7e-07
AUS18856.1|5948_7007_-	cytoplasmic protein	NA	S5Z7D7	Bacillus_phage	60.3	2.2e-120
AUS18857.1|7322_7964_-	hypothetical protein	NA	S5YPG1	Bacillus_phage	65.6	1.2e-78
AUS18858.1|7941_8199_-	hypothetical protein	NA	NA	NA	NA	NA
AUS18859.1|8240_8780_-	hypothetical protein	NA	B6RT44	Bacillus_virus	38.0	1.4e-14
AUS18860.1|8782_9046_-	hypothetical protein	NA	NA	NA	NA	NA
AUS18861.1|9208_11323_-	DNA polymerase	NA	B6RT37	Bacillus_virus	43.7	1.3e-153
AUS18862.1|11323_12127_-	hypothetical protein	NA	NA	NA	NA	NA
AUS18863.1|12180_12417_-	hypothetical protein	NA	NA	NA	NA	NA
AUS18864.1|12484_12952_-	hypothetical protein	NA	A0A160LKT4	Bacillus_phage	60.9	6.5e-45
