The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025938	Tamlana sp. UJ94 chromosome, complete genome	4116543	146787	154236	4116543		Paenibacillus_phage(16.67%)	7	NA	NA
AUS04094.1|146787_147333_-	metal-dependent hydrolase	NA	D0R7I3	Paenibacillus_phage	44.5	3.7e-23
AUS04095.1|147541_148474_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	46.6	3.7e-23
AUS04096.1|148882_151087_-	ATP-dependent DNA helicase RecQ	NA	A0A2K9L021	Tupanvirus	39.0	6.4e-90
AUS04097.1|151291_152257_+	D-arabinose 5-phosphate isomerase	NA	A0A1Z1LYZ3	Serratia_phage	36.1	6.5e-23
AUS04098.1|152256_153084_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	25.0	2.1e-17
AUS04099.1|153073_153421_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AUS04100.1|153495_154236_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	2.1e-21
>prophage 2
CP025938	Tamlana sp. UJ94 chromosome, complete genome	4116543	267468	328732	4116543	tRNA,transposase	Catovirus(16.67%)	47	NA	NA
AUS04192.1|267468_268797_-|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
AUS07231.1|268949_270572_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUS04193.1|270568_271258_-	hypothetical protein	NA	NA	NA	NA	NA
AUS04194.1|271437_272133_-	hypothetical protein	NA	NA	NA	NA	NA
AUS04195.1|272301_273477_-	glucose-1-phosphate thymidylyltransferase	NA	NA	NA	NA	NA
AUS04196.1|273627_273879_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
AUS04197.1|274112_274643_+	DUF4199 domain-containing protein	NA	NA	NA	NA	NA
AUS04198.1|274680_275631_+	glycosyltransferase	NA	V5USA4	Oenococcus_phage	26.0	1.0e-15
AUS07232.1|275735_277463_+	phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	39.8	6.1e-104
AUS04199.1|277462_279295_+	antibiotic ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	6.1e-54
AUS04200.1|279614_280157_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AUS04201.1|280190_280706_+	hypothetical protein	NA	NA	NA	NA	NA
AUS04202.1|280710_281151_+	sensor of ECF-type sigma factor	NA	NA	NA	NA	NA
AUS04203.1|281147_282305_-	oxidoreductase	NA	NA	NA	NA	NA
AUS04204.1|282437_283652_+	RNA methyltransferase	NA	NA	NA	NA	NA
AUS04205.1|283883_285083_+|transposase	transposase	transposase	NA	NA	NA	NA
AUS04206.1|285255_287067_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUS04207.1|287109_287466_-	diversity-generating retroelement protein bAvd family protein	NA	NA	NA	NA	NA
AUS04208.1|287499_288690_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
AUS04209.1|288828_291237_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUS04210.1|291256_291691_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUS04211.1|291801_293577_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	29.0	2.8e-48
AUS04212.1|294016_296242_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	9.7e-163
AUS04213.1|296329_297082_+	pyruvate formate-lyase 1-activating enzyme	NA	NA	NA	NA	NA
AUS04214.1|297239_298742_+	hypothetical protein	NA	NA	NA	NA	NA
AUS04215.1|298840_302533_-	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	22.7	5.4e-25
AUS04216.1|305148_305889_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	35.8	1.3e-39
AUS04217.1|305994_307194_-|transposase	transposase	transposase	NA	NA	NA	NA
AUS04218.1|307305_308640_+	peptidase M28	NA	NA	NA	NA	NA
AUS04219.1|308679_310326_+	peptidase M1	NA	NA	NA	NA	NA
AUS04220.1|311040_311451_-	DUF4293 domain-containing protein	NA	NA	NA	NA	NA
AUS04221.1|311635_313324_+	transcription termination factor Rho	NA	NA	NA	NA	NA
AUS04222.1|313470_314163_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUS04223.1|314361_315555_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	40.6	6.4e-36
AUS04224.1|315561_316530_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
AUS04225.1|316549_316909_-|transposase	transposase	transposase	NA	NA	NA	NA
AUS04226.1|317073_317454_-	hypothetical protein	NA	NA	NA	NA	NA
AUS04227.1|317643_317895_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUS04228.1|318191_319670_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L0T2	Tupanvirus	38.9	5.6e-90
AUS04229.1|320375_320588_+	hypothetical protein	NA	NA	NA	NA	NA
AUS04230.1|320931_322479_+	transporter	NA	NA	NA	NA	NA
AUS04231.1|322776_323454_+	GTP cyclohydrolase I FolE	NA	A0A218M2Y0	Acidovorax_phage	55.1	5.9e-55
AUS04232.1|323491_324973_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	29.7	5.0e-46
AUS04233.1|325023_325248_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	57.5	1.4e-16
AUS07233.1|326041_326854_-	hypothetical protein	NA	NA	NA	NA	NA
AUS04234.1|327022_327343_-	hypothetical protein	NA	NA	NA	NA	NA
AUS04235.1|327532_328732_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
CP025938	Tamlana sp. UJ94 chromosome, complete genome	4116543	1534502	1540304	4116543		Escherichia_phage(33.33%)	6	NA	NA
AUS05203.1|1534502_1535546_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	50.4	1.1e-84
AUS05204.1|1535667_1536534_+	glucose-1-phosphate thymidylyltransferase	NA	H9NC64	Sphingomonas_phage	62.4	2.5e-98
AUS05205.1|1536615_1537161_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	46.5	5.1e-41
AUS05206.1|1537160_1538006_+	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	37.2	1.1e-39
AUS05207.1|1538136_1539156_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A1V0SAI8	Catovirus	34.8	8.1e-40
AUS05208.1|1539155_1540304_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	25.7	2.5e-21
>prophage 5
CP025938	Tamlana sp. UJ94 chromosome, complete genome	4116543	1568748	1612382	4116543	protease,tRNA,transposase	uncultured_Caudovirales_phage(14.29%)	41	NA	NA
AUS05237.1|1568748_1569627_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AUS05238.1|1569828_1570800_-|transposase	transposase	transposase	NA	NA	NA	NA
AUS05239.1|1571119_1572019_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUS05240.1|1572209_1573472_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
AUS05241.1|1573464_1575042_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AUS05242.1|1575292_1576318_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
AUS05243.1|1576416_1577163_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AUS05244.1|1577167_1578517_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	40.9	3.4e-70
AUS05245.1|1578550_1579453_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
AUS05246.1|1579503_1579890_+	Sec-C motif domain protein	NA	NA	NA	NA	NA
AUS05247.1|1579897_1580890_+	porphobilinogen synthase	NA	NA	NA	NA	NA
AUS05248.1|1580924_1582094_-	hypothetical protein	NA	NA	NA	NA	NA
AUS05249.1|1582090_1583254_-	hypothetical protein	NA	NA	NA	NA	NA
AUS05250.1|1583250_1584234_-	hypothetical protein	NA	NA	NA	NA	NA
AUS05251.1|1584238_1585636_-	hypothetical protein	NA	NA	NA	NA	NA
AUS05252.1|1585828_1586917_+	hemolysin	NA	NA	NA	NA	NA
AUS05253.1|1586917_1587391_+	cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	38.7	8.7e-21
AUS05254.1|1587464_1588619_+	serine hydrolase	NA	NA	NA	NA	NA
AUS05255.1|1588611_1589325_+	3'-5' exonuclease	NA	R9ZX90	Cellulophaga_phage	40.7	5.0e-36
AUS05256.1|1589324_1591004_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	4.2e-17
AUS05257.1|1591303_1591957_-	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUS05258.1|1592035_1592389_-	four helix bundle protein	NA	NA	NA	NA	NA
AUS05259.1|1592502_1593222_-	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUS05260.1|1593466_1593925_-	rRNA methyltransferase	NA	NA	NA	NA	NA
AUS05261.1|1593958_1596298_-	penicillin-binding protein	NA	NA	NA	NA	NA
AUS05262.1|1596355_1596853_-	gliding motility lipoprotein GldH	NA	NA	NA	NA	NA
AUS05263.1|1596839_1598225_-	hypothetical protein	NA	NA	NA	NA	NA
AUS05264.1|1598440_1598671_-	ferredoxin	NA	NA	NA	NA	NA
AUS05265.1|1598670_1599915_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.5	1.2e-21
AUS05266.1|1599936_1600941_-	radical SAM protein	NA	NA	NA	NA	NA
AUS05267.1|1600944_1602009_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07284.1|1602352_1603354_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	1.1e-113
AUS05268.1|1603609_1604176_-	hypothetical protein	NA	NA	NA	NA	NA
AUS05269.1|1604195_1605539_-	hypothetical protein	NA	NA	NA	NA	NA
AUS05270.1|1605577_1605871_-	hypothetical protein	NA	NA	NA	NA	NA
AUS05271.1|1606932_1607346_+	hypothetical protein	NA	NA	NA	NA	NA
AUS05272.1|1607386_1607929_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AUS05273.1|1607928_1609377_+	hypothetical protein	NA	NA	NA	NA	NA
AUS05274.1|1609507_1610707_+|transposase	transposase	transposase	NA	NA	NA	NA
AUS05275.1|1611055_1611406_+|transposase	transposase	transposase	NA	NA	NA	NA
AUS05276.1|1611398_1612382_+|transposase	DDE transposase	transposase	A0A2R2ZGN7	Clostridioides_phage	25.1	5.1e-07
>prophage 6
CP025938	Tamlana sp. UJ94 chromosome, complete genome	4116543	1780194	1827428	4116543	protease,tRNA,transposase	Flavobacterium_phage(12.5%)	38	NA	NA
AUS05411.1|1780194_1780638_-|protease	acid protease	protease	NA	NA	NA	NA
AUS07292.1|1780723_1781491_+	hydrolase TatD	NA	NA	NA	NA	NA
AUS05412.1|1781494_1782526_+	L-asparaginase 1	NA	NA	NA	NA	NA
AUS05413.1|1782762_1783533_+	flagellar motor protein MotA	NA	NA	NA	NA	NA
AUS05414.1|1783560_1783992_+	hypothetical protein	NA	NA	NA	NA	NA
AUS07293.1|1783996_1784584_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUS05415.1|1784606_1785083_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUS05416.1|1785185_1785878_+	hypothetical protein	NA	R9W058	Flavobacterium_phage	44.7	2.0e-13
AUS05417.1|1785970_1786333_+	hypothetical protein	NA	NA	NA	NA	NA
AUS05418.1|1786592_1787198_-	hypothetical protein	NA	NA	NA	NA	NA
AUS05419.1|1787197_1788658_-	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AUS05420.1|1788831_1790031_-|transposase	transposase	transposase	NA	NA	NA	NA
AUS07294.1|1790283_1791717_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.2	1.8e-77
AUS05421.1|1791845_1794251_-	transporter	NA	NA	NA	NA	NA
AUS05422.1|1794297_1795572_-	hypothetical protein	NA	NA	NA	NA	NA
AUS05423.1|1795629_1796187_-	ribosome recycling factor	NA	NA	NA	NA	NA
AUS05424.1|1796226_1796934_-	UMP kinase	NA	NA	NA	NA	NA
AUS05425.1|1797117_1798092_-	elongation factor Ts	NA	NA	NA	NA	NA
AUS05426.1|1798177_1798948_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AUS05427.1|1799188_1799575_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
AUS05428.1|1799575_1800031_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
AUS05429.1|1800252_1801884_+	glycosyl transferase family 2	NA	A0A2K9L3Z8	Tupanvirus	27.6	2.9e-55
AUS05430.1|1802251_1804210_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	40.3	4.7e-44
AUS05431.1|1805746_1809202_-	hypothetical protein	NA	NA	NA	NA	NA
AUS05432.1|1809393_1810572_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUS05433.1|1810679_1811396_-|tRNA	tRNA (adenine-N(6)-)-methyltransferase	tRNA	NA	NA	NA	NA
AUS05434.1|1811742_1812198_+	hypothetical protein	NA	NA	NA	NA	NA
AUS07295.1|1812359_1812887_-	16S rRNA processing protein RimM	NA	NA	NA	NA	NA
AUS05435.1|1813177_1813684_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUS05436.1|1813779_1814844_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AUS05437.1|1815755_1820141_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	35.3	1.6e-188
AUS05438.1|1820298_1820868_+	methyltransferase	NA	NA	NA	NA	NA
AUS05439.1|1822135_1822453_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	47.8	1.4e-19
AUS05440.1|1822542_1823085_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	44.2	1.5e-32
AUS07296.1|1823234_1824164_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
AUS05441.1|1824798_1825782_-|transposase	DDE transposase	transposase	A0A2R2ZGN7	Clostridioides_phage	24.5	6.7e-07
AUS05442.1|1825774_1826125_-|transposase	transposase	transposase	NA	NA	NA	NA
AUS05443.1|1826474_1827428_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
>prophage 7
CP025938	Tamlana sp. UJ94 chromosome, complete genome	4116543	2372355	2432510	4116543	integrase,transposase	Cafeteria_roenbergensis_virus(30.0%)	57	2372264:2372323	2428926:2430311
2372264:2372323	attL	CATTAGTGTCCGATAAAAGATTTAAAAAGCGGGATTTCCAAGATAGGATTTCCCGCTTAT	NA	NA	NA	NA
AUS05863.1|2372355_2373555_+|transposase	transposase	transposase	NA	NA	NA	NA
AUS05864.1|2373633_2374485_-	hypothetical protein	NA	NA	NA	NA	NA
AUS05865.1|2374497_2374689_-	hypothetical protein	NA	NA	NA	NA	NA
AUS05866.1|2374743_2375037_-	transcriptional regulator	NA	NA	NA	NA	NA
AUS05867.1|2375104_2375713_-	hypothetical protein	NA	NA	NA	NA	NA
AUS05868.1|2375922_2376774_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07322.1|2376789_2377608_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.2	1.0e-45
AUS05869.1|2377931_2379731_+	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	40.1	7.9e-22
AUS05870.1|2379734_2379968_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
AUS05871.1|2380155_2381472_+	O-antigen translocase	NA	NA	NA	NA	NA
AUS05872.1|2381487_2382798_+	O-antigen translocase	NA	NA	NA	NA	NA
AUS05873.1|2382787_2383048_+	hypothetical protein	NA	NA	NA	NA	NA
AUS05874.1|2382990_2384400_+	hypothetical protein	NA	NA	NA	NA	NA
AUS05875.1|2384396_2385479_+	hypothetical protein	NA	NA	NA	NA	NA
AUS05876.1|2385494_2386436_-	glycosyltransferase family 2 protein	NA	E3T517	Cafeteria_roenbergensis_virus	29.1	2.6e-08
AUS05877.1|2386481_2387348_-	glycosyl transferase	NA	NA	NA	NA	NA
AUS05878.1|2387350_2388034_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	1.2e-23
AUS05879.1|2388222_2391243_+	hypothetical protein	NA	NA	NA	NA	NA
AUS05880.1|2391270_2392998_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUS05881.1|2393272_2393971_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUS05882.1|2394349_2394841_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AUS05883.1|2394874_2396125_-	DUF1343 domain-containing protein	NA	NA	NA	NA	NA
AUS05884.1|2396133_2397369_+	transmembrane permease	NA	NA	NA	NA	NA
AUS05885.1|2397375_2397771_-	DUF2721 domain-containing protein	NA	NA	NA	NA	NA
AUS05886.1|2397961_2399233_+	DUF2851 domain-containing protein	NA	NA	NA	NA	NA
AUS05887.1|2399268_2399496_+	PspC family transcriptional regulator	NA	NA	NA	NA	NA
AUS05888.1|2399499_2400519_+	potassium channel protein	NA	NA	NA	NA	NA
AUS07323.1|2400625_2402248_+	D-alanine glycine permease	NA	NA	NA	NA	NA
AUS05889.1|2402272_2403154_+	competence protein ComEA	NA	NA	NA	NA	NA
AUS05890.1|2403146_2404313_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUS05891.1|2404397_2404592_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AUS05892.1|2405066_2405957_+|integrase	integrase	integrase	A0A0K2CP59	Brevibacillus_phage	28.3	5.5e-24
AUS05893.1|2406072_2406375_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AUS05894.1|2407102_2408290_+	elongation factor Tu	NA	A0A146JG10	Tokyovirus	26.9	6.6e-17
AUS05895.1|2408603_2408798_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
AUS05896.1|2408822_2409377_+	transcription termination/antitermination factor NusG	NA	NA	NA	NA	NA
AUS05897.1|2409451_2409889_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
AUS05898.1|2409909_2410599_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
AUS05899.1|2410618_2411140_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
AUS05900.1|2411204_2411579_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
AUS05901.1|2411703_2415516_+	DNA-directed RNA polymerase subunit beta	NA	E3T4Z4	Cafeteria_roenbergensis_virus	26.2	5.4e-36
AUS07324.1|2415587_2419889_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	25.7	1.1e-66
AUS05902.1|2420064_2420382_+	DUF3467 domain-containing protein	NA	NA	NA	NA	NA
AUS05903.1|2420422_2420650_-	(4Fe-4S)-binding protein	NA	NA	NA	NA	NA
AUS05904.1|2420701_2422291_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	29.3	1.0e-36
AUS05905.1|2422506_2423031_+	isopentenyl-diphosphate delta-isomerase	NA	NA	NA	NA	NA
AUS05906.1|2423027_2423438_+	6-pyruvoyl tetrahydrobiopterin synthase	NA	NA	NA	NA	NA
AUS05907.1|2423569_2423836_+	hypothetical protein	NA	NA	NA	NA	NA
AUS05908.1|2424106_2424805_-	hypothetical protein	NA	NA	NA	NA	NA
AUS05909.1|2425510_2426494_-|transposase	DDE transposase	transposase	A0A2R2ZGN7	Clostridioides_phage	24.5	5.1e-07
AUS05910.1|2426486_2426837_-|transposase	transposase	transposase	NA	NA	NA	NA
AUS05911.1|2426998_2427664_+	peptidase M15	NA	NA	NA	NA	NA
AUS05912.1|2427777_2428551_-	hypothetical protein	NA	NA	NA	NA	NA
AUS05913.1|2429017_2430217_+|transposase	transposase	transposase	NA	NA	NA	NA
AUS05914.1|2430282_2431158_-	hypothetical protein	NA	NA	NA	NA	NA
2428926:2430311	attR	CATTAGTGTCCGATAAAAGATTTAAAAAGCGGGATTTCCAAGATAGGATTTCCCGCTTATTTTGTATCTTGAAGTTATCACACATCCAAGATATGAATAAAAGTAAAAACTTTAGCGGACACCCCATAATCAAACAGGTATTAAATTTCATTTTGCCCAAAGATGTTCATCGGACAGCCAAAAAGCACAACAGCGATCGCTATACCAAAAAGTTTACCACCTATGAGCATTTGGCCACTATGGTATTTACCGTGATCAGTGGCTGTAGCTCACTTCGTGAGGTTTCCAGTATTATGCTTGCCTGCGAGGGAAAGATCAACCATCTAGGACTCACGGACTTTCCAAAACGCAGTACCTTGTCAGATGCTAACAGGAGAAGAAGCTCTGAAGTATTTGCCGATATTTATCATTTACTCTACAAACGTTACCATCGCTTTTTATCGGACAGCAGACCCTTAGAACCTGCAGTGAAGAACCTTAAAATCGTTGATTCCTCGACCATCCCCCTATTTAGTGACATTCTTAAAGGTGTAGGAAGGAACCCGCTCAACGGCAAAAAGAAAGGAGGTATCAAGATGCATACTATGATAAACGCCATGGAAGACGTTCCTTGTCTGATTAAGTTTTCAAGCGCGGCCACGCACGACCACACCTTTTTAAAAGACCTGGAACTCAAGAAGGGCTCTTATGTGGTTTTTGACAAAGGGTATGTGGATTATGAGCAATACCAAAAATGGACACTGGAAGATGTTTACTTTGTGACTCGGCAAAAGGACAATGCTCGCTATACAAGCCTTGAAGAGTTTGATATCTCCAATAAAGTGGACGATGCTGTCTTAAAGGACGAAAAAATAGGGCTTACGGACAAAAACGGCAATGCTTTTTCCCTGAGGAGAATCGCTTTTTGGCACGAAAAGCACCAAAAAGTTTATGAGTTCATCACTAATAATTATGATCTTGATGCAGACAAAATAGCCGACATCTATAAAAATAGGTGGCAGATTGAGACGATGTTCAAGCGGCTTAAACAGAACTTTCCGCTAAAGTATTTTTTGGGAGACAATCAAAATGCCATCGAAATACAAATCTGGGTCAGTTTGATAATCCAGCTCATTATGCTTGTGATCCAAAGAAAAGCCCAAAGAAACTGGGCTTATTCCAATATGATGTCCGTCATACGATACCATTTGATGACATATATCGATTTGTTCAAATTCCTGAAAAACCCAGAAGCTAATTGGGAAGAGATTACAACCAAAAACATTGGGCAATTAAGCCTTTTTGACCCATAAGGAGGTTCTGTTTTCAAAATAAAGAGTGCGATCAATAAAAAAGGCCAACACCAAAGCTTTTTTAGCTAATTCTGTTTTTTATCGGACAACAATA	NA	NA	NA	NA
AUS05915.1|2431239_2431587_-	hypothetical protein	NA	NA	NA	NA	NA
AUS05916.1|2431631_2432510_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 8
CP025938	Tamlana sp. UJ94 chromosome, complete genome	4116543	2439081	2513037	4116543	integrase,transposase,protease,tail,tRNA	Acinetobacter_phage(16.67%)	56	2477435:2477451	2518819:2518835
AUS05918.1|2439081_2439426_+|transposase	transposase	transposase	NA	NA	NA	NA
AUS05919.1|2439418_2440402_+|transposase	DDE transposase	transposase	A0A2R2ZGN7	Clostridioides_phage	24.8	3.3e-06
AUS05920.1|2440569_2441769_+|transposase	transposase	transposase	NA	NA	NA	NA
AUS05921.1|2441970_2443062_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
AUS05922.1|2443072_2443981_-	GHMP kinase	NA	NA	NA	NA	NA
AUS05923.1|2444007_2445375_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
AUS05924.1|2445715_2447908_+	S9 family peptidase	NA	NA	NA	NA	NA
AUS05925.1|2447937_2449488_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	37.1	4.1e-75
AUS05926.1|2449503_2451081_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	31.2	1.2e-53
AUS05927.1|2451167_2451716_+	thioredoxin family protein	NA	NA	NA	NA	NA
AUS05928.1|2451757_2453797_-	competence protein	NA	NA	NA	NA	NA
AUS05929.1|2453820_2454396_-	hypothetical protein	NA	NA	NA	NA	NA
AUS05930.1|2454402_2455515_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AUS05931.1|2455560_2455845_-	hypothetical protein	NA	NA	NA	NA	NA
AUS05932.1|2455837_2456614_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	37.9	2.1e-43
AUS07325.1|2456792_2458943_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	29.5	1.4e-65
AUS05933.1|2458952_2460047_+	peptide transporter	NA	NA	NA	NA	NA
AUS05934.1|2460089_2460698_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
AUS05935.1|2460740_2461505_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUS05936.1|2461831_2462302_+	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
AUS05937.1|2462288_2463188_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	NA	NA	NA	NA
AUS05938.1|2463187_2463511_+	S-adenosyl-methyltransferase	NA	NA	NA	NA	NA
AUS07326.1|2463574_2465539_+	penicillin-binding protein	NA	NA	NA	NA	NA
AUS05939.1|2465535_2466999_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AUS05940.1|2467040_2468282_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AUS05941.1|2468320_2469709_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AUS05942.1|2469720_2470914_+	cell division protein FtsW	NA	NA	NA	NA	NA
AUS05943.1|2470935_2472009_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AUS05944.1|2472009_2473362_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
AUS05945.1|2473351_2474071_+	hypothetical protein	NA	NA	NA	NA	NA
AUS05946.1|2474074_2475403_+	cell division protein FtsA	NA	NA	NA	NA	NA
AUS05947.1|2475509_2477501_+	cell division protein FtsZ	NA	NA	NA	NA	NA
2477435:2477451	attL	TTTTGATGATAATGATG	NA	NA	NA	NA
AUS07327.1|2477644_2478094_+|tRNA	glutamyl-tRNA amidotransferase	tRNA	NA	NA	NA	NA
AUS05948.1|2478464_2479724_+|integrase	integrase	integrase	H7BUI8	unidentified_phage	38.9	2.6e-35
AUS05949.1|2479864_2480710_+	hypothetical protein	NA	NA	NA	NA	NA
AUS05950.1|2481087_2481288_+	hypothetical protein	NA	NA	NA	NA	NA
AUS05951.1|2481316_2481592_+	DNA-binding protein	NA	NA	NA	NA	NA
AUS05952.1|2481815_2482394_+	hypothetical protein	NA	NA	NA	NA	NA
AUS05953.1|2482390_2483104_+	ATPase	NA	NA	NA	NA	NA
AUS05954.1|2483326_2484928_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	57.7	9.5e-160
AUS05955.1|2484927_2486184_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	26.9	1.2e-29
AUS05956.1|2486346_2487258_+|protease	CAAX protease	protease	A3QSC6	Clostridium_virus	31.3	3.7e-28
AUS05957.1|2487264_2490117_+	deoxyribonuclease HsdR	NA	NA	NA	NA	NA
AUS05958.1|2490281_2491223_+	endonuclease	NA	A0A2P0VMP9	Tetraselmis_virus	34.1	2.1e-21
AUS05959.1|2491516_2491888_+	hypothetical protein	NA	NA	NA	NA	NA
AUS05960.1|2492009_2496344_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
AUS05961.1|2496407_2497610_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUS05962.1|2497612_2498029_+	transcriptional repressor	NA	NA	NA	NA	NA
AUS05963.1|2498082_2498445_+	hypothetical protein	NA	NA	NA	NA	NA
AUS05964.1|2498441_2500394_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.1	5.6e-106
AUS05965.1|2500455_2500869_+	hypothetical protein	NA	NA	NA	NA	NA
AUS05966.1|2504864_2506082_+	transporter	NA	NA	NA	NA	NA
AUS05967.1|2506175_2508674_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.3	2.8e-78
AUS05968.1|2509163_2510939_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUS05969.1|2510972_2511410_+	heavy metal transporter	NA	NA	NA	NA	NA
AUS05970.1|2511681_2513037_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
2518819:2518835	attR	TTTTGATGATAATGATG	NA	NA	NA	NA
>prophage 9
CP025938	Tamlana sp. UJ94 chromosome, complete genome	4116543	2588969	2651215	4116543	protease,tRNA,transposase	uncultured_virus(25.0%)	59	NA	NA
AUS06044.1|2588969_2590163_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	40.6	6.4e-36
AUS06045.1|2590298_2590931_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06046.1|2590935_2591430_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AUS06047.1|2591974_2592709_+	energy transducer TonB	NA	NA	NA	NA	NA
AUS06048.1|2593099_2594440_+	histidine kinase	NA	NA	NA	NA	NA
AUS06049.1|2594430_2594778_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06050.1|2594789_2595107_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06051.1|2595304_2596063_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUS06052.1|2596285_2596768_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06053.1|2597045_2597324_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06054.1|2597375_2597672_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06055.1|2599099_2599651_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06056.1|2599704_2600867_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	36.5	1.0e-30
AUS06057.1|2601717_2602710_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AUS06058.1|2602771_2603944_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06059.1|2604161_2604527_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06060.1|2604762_2606067_+	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.1	3.7e-37
AUS06061.1|2606232_2607603_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUS06062.1|2607936_2608566_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06063.1|2608674_2610039_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AUS06064.1|2610166_2611561_-	transporter	NA	NA	NA	NA	NA
AUS06065.1|2611557_2612907_-	biotin attachment protein	NA	NA	NA	NA	NA
AUS06066.1|2612916_2614575_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.2	6.8e-20
AUS06067.1|2614571_2615252_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUS06068.1|2615366_2616068_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06069.1|2616069_2616516_-	cytochrome C oxidase Cbb3	NA	NA	NA	NA	NA
AUS06070.1|2616570_2617995_-	cytochrome c oxidase accessory protein CcoG	NA	NA	NA	NA	NA
AUS06071.1|2618096_2619056_-	cytochrome C oxidase subunit III	NA	NA	NA	NA	NA
AUS06072.1|2619052_2619241_-	CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone	NA	NA	NA	NA	NA
AUS06073.1|2619260_2621453_-	cytochrome C oxidase Cbb3	NA	NA	NA	NA	NA
AUS06074.1|2621455_2621647_-	cbb3-type cytochrome oxidase assembly protein CcoS	NA	NA	NA	NA	NA
AUS07330.1|2621716_2624110_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	24.0	4.5e-41
AUS06075.1|2624219_2624897_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AUS06076.1|2624938_2625592_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06077.1|2625875_2626940_-	fibronectin type III	NA	NA	NA	NA	NA
AUS07331.1|2627088_2628219_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06078.1|2628345_2629803_+	magnesium chelatase	NA	NA	NA	NA	NA
AUS06079.1|2630036_2632118_+	glycogen debranching protein	NA	NA	NA	NA	NA
AUS06080.1|2632136_2633411_+	glycosyl transferase	NA	NA	NA	NA	NA
AUS06081.1|2633479_2634370_+	carbohydrate kinase	NA	NA	NA	NA	NA
AUS06082.1|2634658_2635087_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUS06083.1|2635514_2636018_-	YfcE family phosphodiesterase	NA	NA	NA	NA	NA
AUS06084.1|2636105_2636849_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AUS06085.1|2636849_2638619_+	antibiotic ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	6.5e-53
AUS06086.1|2638678_2638915_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06087.1|2638958_2639963_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.4	5.4e-36
AUS06088.1|2640348_2641227_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AUS06089.1|2641223_2641634_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06090.1|2641727_2642513_-	TIGR00159 family protein	NA	NA	NA	NA	NA
AUS06091.1|2642551_2643181_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06092.1|2643214_2644042_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	28.7	3.4e-20
AUS06093.1|2644146_2644692_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06094.1|2644692_2645787_+	DoxX family protein	NA	NA	NA	NA	NA
AUS06095.1|2645827_2646904_+	ABC transporter permease	NA	NA	NA	NA	NA
AUS06096.1|2646979_2647471_+	redoxin	NA	NA	NA	NA	NA
AUS06097.1|2647505_2648255_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
AUS06098.1|2648798_2649989_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUS06099.1|2650089_2650926_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AUS06100.1|2650939_2651215_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	NA	NA	NA	NA
>prophage 10
CP025938	Tamlana sp. UJ94 chromosome, complete genome	4116543	2655801	2729355	4116543	tail,integrase,transposase	uncultured_virus(21.43%)	54	2648548:2648564	2670766:2670782
2648548:2648564	attL	AAGCATTTAAAATAAAA	NA	NA	NA	NA
AUS06106.1|2655801_2656152_+|transposase	transposase	transposase	NA	NA	NA	NA
AUS06107.1|2656144_2657128_+|transposase	DDE transposase	transposase	A0A2R2ZGN7	Clostridioides_phage	24.5	6.7e-07
AUS07332.1|2657254_2658532_+|integrase	integrase	integrase	H7BUI8	unidentified_phage	41.0	1.4e-33
AUS06108.1|2658829_2659708_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AUS06109.1|2660158_2660929_+	SOS response-associated peptidase	NA	NA	NA	NA	NA
AUS06110.1|2661741_2662941_-|transposase	transposase	transposase	NA	NA	NA	NA
AUS06111.1|2663339_2664098_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06112.1|2664162_2665071_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A1V0SIN1	Klosneuvirus	27.6	4.0e-14
AUS06113.1|2665105_2667118_-	peptidase C39	NA	W8CYL7	Bacillus_phage	32.0	1.7e-49
AUS06114.1|2667136_2668330_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	40.1	1.1e-35
AUS06115.1|2668414_2668642_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06116.1|2668683_2669757_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06117.1|2670374_2671526_+	secretion protein HlyD	NA	NA	NA	NA	NA
2670766:2670782	attR	AAGCATTTAAAATAAAA	NA	NA	NA	NA
AUS06118.1|2671625_2672822_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	27.6	1.2e-26
AUS06119.1|2672912_2673647_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06120.1|2676697_2677855_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AUS06121.1|2677961_2678840_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AUS06122.1|2678995_2680648_-	hypothetical protein	NA	A0A088F7M4	Mycobacterium_phage	25.5	5.0e-15
AUS06123.1|2680651_2682169_-	DNA methyltransferase	NA	NA	NA	NA	NA
AUS06124.1|2682212_2683217_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.4	5.4e-36
AUS06125.1|2683996_2685196_-|transposase	transposase	transposase	NA	NA	NA	NA
AUS06126.1|2685285_2685504_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06127.1|2685587_2687879_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06128.1|2687896_2688190_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06129.1|2688195_2690481_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06130.1|2690480_2691131_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06131.1|2691493_2691979_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06132.1|2692327_2692552_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06133.1|2692560_2693400_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06134.1|2693399_2693867_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06135.1|2694905_2696099_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	40.6	6.4e-36
AUS07333.1|2696363_2698610_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06136.1|2698733_2699612_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AUS06137.1|2699848_2700457_+	5,6-dimethylbenzimidazole synthase	NA	NA	NA	NA	NA
AUS06138.1|2701011_2702181_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUS06139.1|2703528_2703918_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06140.1|2704536_2705739_+	exonuclease sbcCD subunit D	NA	A0A0A0PQ58	Bacillus_phage	27.1	1.5e-08
AUS06141.1|2705753_2709410_+	nuclease SbcCD subunit C	NA	G3MAB6	Bacillus_virus	23.1	1.2e-05
AUS06142.1|2709921_2710530_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06143.1|2710728_2711922_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	40.6	6.4e-36
AUS06144.1|2712435_2712672_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06145.1|2713712_2713970_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06146.1|2713950_2714265_-	thioredoxin	NA	A0A2I2L415	Orpheovirus	30.6	6.9e-06
AUS06147.1|2714278_2714917_-	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
AUS06148.1|2715218_2716685_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
AUS06149.1|2717049_2717565_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06150.1|2717578_2718319_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06151.1|2718356_2718857_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06152.1|2719313_2719547_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06153.1|2720253_2721444_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUS06154.1|2721581_2723024_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06155.1|2723036_2726147_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06156.1|2726211_2728686_-	type VI secretion system ATPase ClpV	NA	A0A248SJW6	Salicola_phage	28.1	3.8e-75
AUS06157.1|2728965_2729355_+|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 11
CP025938	Tamlana sp. UJ94 chromosome, complete genome	4116543	2791941	2878799	4116543	protease,transposase	Tetraselmis_virus(20.0%)	60	NA	NA
AUS06194.1|2791941_2794494_-|protease	Clp protease ClpC	protease	H6X3M6	Enterobacteria_phage	35.1	3.7e-126
AUS06195.1|2794754_2797298_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.4	3.4e-111
AUS06196.1|2797336_2798590_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06197.1|2798643_2799393_-	hydrolase Nlp/P60	NA	NA	NA	NA	NA
AUS06198.1|2799402_2800581_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
AUS06199.1|2800788_2802843_+	phosphohydrolase	NA	NA	NA	NA	NA
AUS06200.1|2803298_2804909_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06201.1|2806054_2808592_+	glycoside hydrolase family 2	NA	NA	NA	NA	NA
AUS06202.1|2808607_2809624_+	Zn-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
AUS06203.1|2809644_2810415_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.5	6.8e-15
AUS06204.1|2810438_2811842_+	sulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	26.4	5.0e-24
AUS06205.1|2811860_2813315_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUS06206.1|2813331_2814906_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.4	6.3e-23
AUS06207.1|2814911_2817095_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AUS06208.1|2817109_2818204_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	27.7	8.2e-30
AUS06209.1|2818213_2819260_+	galactose-1-epimerase	NA	NA	NA	NA	NA
AUS06210.1|2819302_2820334_+	rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
AUS06211.1|2820355_2821579_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AUS06212.1|2822155_2825230_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUS06213.1|2825251_2826979_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
AUS06214.1|2826992_2828552_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06215.1|2828696_2829647_+	beta-agarase	NA	NA	NA	NA	NA
AUS06216.1|2829667_2832793_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06217.1|2832961_2833816_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06218.1|2833934_2834837_+	ribokinase	NA	NA	NA	NA	NA
AUS06219.1|2834849_2836358_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06220.1|2836341_2837223_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06221.1|2837261_2838371_+	theronine dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	26.9	1.1e-08
AUS07338.1|2838474_2839236_-	beta-agarase	NA	NA	NA	NA	NA
AUS06222.1|2840013_2842248_-	beta-glucosidase BglX	NA	NA	NA	NA	NA
AUS06223.1|2842353_2843805_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUS06224.1|2843824_2844607_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUS06225.1|2844619_2845765_-	CoA transferase	NA	NA	NA	NA	NA
AUS06226.1|2845767_2846913_-	carnitine dehydratase	NA	NA	NA	NA	NA
AUS06227.1|2846923_2848081_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUS06228.1|2848207_2850742_-	beta-galactosidase	NA	NA	NA	NA	NA
AUS06229.1|2850849_2851608_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUS06230.1|2851611_2853417_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06231.1|2853528_2854329_-	acetyl esterase	NA	NA	NA	NA	NA
AUS06232.1|2854359_2855475_-	histidine kinase	NA	A0A0K0KVL7	Prochlorococcus_phage	25.7	1.2e-23
AUS06233.1|2855487_2856732_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AUS06234.1|2856738_2857047_-	2Fe-2S ferredoxin	NA	NA	NA	NA	NA
AUS06235.1|2857062_2858223_-	cytochrome P450	NA	NA	NA	NA	NA
AUS06236.1|2858424_2859279_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUS06237.1|2859606_2860887_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
AUS06238.1|2861171_2862155_-	LPS biosynthesis protein WbpP	NA	A0A2K9L0I7	Tupanvirus	51.2	4.1e-89
AUS06239.1|2862575_2863745_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUS06240.1|2864501_2867066_-	agarase	NA	NA	NA	NA	NA
AUS06241.1|2867506_2868091_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06242.1|2868168_2868663_+	heme-binding protein	NA	NA	NA	NA	NA
AUS06243.1|2868687_2870208_+	stress protein	NA	NA	NA	NA	NA
AUS06244.1|2870249_2870969_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	57.3	1.8e-30
AUS06245.1|2871973_2872213_+	transcriptional regulator	NA	NA	NA	NA	NA
AUS06246.1|2872184_2872502_+	phosphatidylinositol kinase	NA	NA	NA	NA	NA
AUS06247.1|2873598_2874798_-|transposase	transposase	transposase	NA	NA	NA	NA
AUS06248.1|2875143_2875836_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06249.1|2876021_2876975_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
AUS06250.1|2876994_2877354_-|transposase	transposase	transposase	NA	NA	NA	NA
AUS06251.1|2877404_2877995_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06252.1|2877920_2878799_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 12
CP025938	Tamlana sp. UJ94 chromosome, complete genome	4116543	3195677	3296847	4116543	tRNA,transposase	Staphylococcus_prophage(16.67%)	87	NA	NA
AUS06495.1|3195677_3196556_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AUS06496.1|3196548_3196782_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06497.1|3197081_3197756_-	ZIP family metal transporter	NA	NA	NA	NA	NA
AUS06498.1|3197805_3198537_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUS06499.1|3198710_3199868_+	RNA methyltransferase	NA	NA	NA	NA	NA
AUS06500.1|3201363_3201834_+	osmotically inducible protein OsmC	NA	NA	NA	NA	NA
AUS07354.1|3201918_3202623_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06501.1|3202687_3203236_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06502.1|3203297_3204710_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	31.3	1.5e-55
AUS07355.1|3204973_3206218_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	4.9e-31
AUS06503.1|3206394_3206637_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06504.1|3206847_3208167_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06505.1|3208970_3211208_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06506.1|3211535_3212735_-|transposase	transposase	transposase	NA	NA	NA	NA
AUS06507.1|3213405_3214959_+	LuxR family transcriptional regulator	NA	A0A2L1IVA1	Escherichia_phage	24.2	3.1e-06
AUS06508.1|3215036_3216041_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.4	5.4e-36
AUS06509.1|3216105_3216846_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	35.8	1.7e-39
AUS06510.1|3217198_3217948_-	AAA family ATPase	NA	NA	NA	NA	NA
AUS06511.1|3218030_3219035_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.4	5.4e-36
AUS06512.1|3219048_3219264_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06513.1|3219688_3219952_+	hypothetical protein	NA	NA	NA	NA	NA
AUS07356.1|3220111_3220543_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06514.1|3222222_3222954_+	SOS response-associated peptidase	NA	NA	NA	NA	NA
AUS06515.1|3223194_3224409_+	DNA polymerase IV	NA	NA	NA	NA	NA
AUS06516.1|3224520_3227475_+	DNA polymerase III subunit alpha	NA	A0A222YWW4	Streptomyces_phage	31.6	1.2e-70
AUS06517.1|3227923_3229075_-	hypothetical protein	NA	A0A1D8EXR7	Mycobacterium_phage	28.1	1.6e-15
AUS06518.1|3229245_3230415_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUS06519.1|3230468_3231479_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.2	1.2e-35
AUS06520.1|3231752_3232529_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06521.1|3232533_3233394_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06522.1|3233545_3234739_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	40.6	6.4e-36
AUS06523.1|3236054_3237217_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	36.5	1.0e-30
AUS06524.1|3237930_3238431_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07357.1|3238502_3239078_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUS06525.1|3239086_3240208_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	37.3	9.9e-31
AUS06526.1|3240314_3241511_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	27.3	4.6e-26
AUS06527.1|3241691_3241901_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06528.1|3242007_3242886_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AUS06529.1|3243308_3244502_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	40.6	6.4e-36
AUS06530.1|3244508_3246629_-	peptidase C39	NA	W8CYL7	Bacillus_phage	25.4	4.3e-35
AUS06531.1|3246621_3247149_-	redoxin	NA	NA	NA	NA	NA
AUS06532.1|3247151_3247436_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06533.1|3247480_3248677_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	27.3	2.7e-26
AUS06534.1|3248880_3249810_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06535.1|3251461_3252202_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	35.8	1.7e-39
AUS06536.1|3252283_3252604_+	DUF1810 domain-containing protein	NA	NA	NA	NA	NA
AUS06537.1|3252900_3253437_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06538.1|3253625_3254732_-	DUF4172 domain-containing protein	NA	D7RWK9	Brochothrix_phage	25.0	5.0e-11
AUS06539.1|3255020_3256358_-	DNA polymerase III subunit epsilon	NA	A0A1X9I5C8	Streptococcus_phage	33.5	9.4e-20
AUS06540.1|3256354_3257128_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUS06541.1|3257280_3258084_+	short-chain dehydrogenase/reductase	NA	NA	NA	NA	NA
AUS06542.1|3258474_3259167_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06543.1|3259705_3260947_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06544.1|3261385_3261715_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06545.1|3262019_3263012_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06546.1|3263073_3263352_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06547.1|3263361_3263649_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06548.1|3263677_3264169_-	hypothetical protein	NA	Q9JMN8	Wolbachia_phage	33.3	2.4e-13
AUS06549.1|3264610_3265882_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06550.1|3266137_3268567_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUS06551.1|3269128_3270220_-	heparan-alpha-glucosaminide N-acetyltransferase	NA	NA	NA	NA	NA
AUS06552.1|3270229_3271561_-	glucose/galactose MFS transporter	NA	NA	NA	NA	NA
AUS06553.1|3271588_3272311_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUS06554.1|3272310_3273291_-	histidine kinase	NA	NA	NA	NA	NA
AUS06555.1|3273584_3276677_+	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
AUS06556.1|3276683_3278276_+	SusD/RagB family nutrient-binding outer membrane lipoprotein	NA	NA	NA	NA	NA
AUS06557.1|3278384_3280307_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
AUS06558.1|3280335_3280665_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06559.1|3280787_3282830_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
AUS06560.1|3282833_3283688_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AUS06561.1|3284006_3284327_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06562.1|3284511_3285111_+	chemotaxis protein	NA	NA	NA	NA	NA
AUS06563.1|3285411_3285756_+	DUF3024 domain-containing protein	NA	NA	NA	NA	NA
AUS06564.1|3285748_3286195_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06565.1|3286594_3287455_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.0	1.3e-30
AUS06566.1|3287571_3287928_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AUS06567.1|3287917_3288208_+	transcriptional regulator	NA	NA	NA	NA	NA
AUS06568.1|3288373_3289536_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	36.5	1.0e-30
AUS06569.1|3289643_3290174_+	GNAT family N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	53.7	8.8e-46
AUS06570.1|3290212_3290506_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06571.1|3290817_3291996_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUS06572.1|3292004_3293093_-	AI-2E family transporter	NA	NA	NA	NA	NA
AUS06573.1|3293274_3293775_-	RNA methyltransferase	NA	NA	NA	NA	NA
AUS06574.1|3293784_3294426_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06575.1|3294432_3295137_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AUS06576.1|3295138_3295774_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06577.1|3295824_3296847_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.5	3.1e-71
>prophage 13
CP025938	Tamlana sp. UJ94 chromosome, complete genome	4116543	3518867	3533344	4116543	tail,transposase	Arthrobacter_phage(50.0%)	8	NA	NA
AUS06757.1|3518867_3520067_-|transposase	transposase	transposase	NA	NA	NA	NA
AUS06758.1|3520284_3521484_-|transposase	transposase	transposase	NA	NA	NA	NA
AUS06759.1|3521671_3523954_+	S9 family peptidase	NA	NA	NA	NA	NA
AUS06760.1|3524085_3525285_+|transposase	transposase	transposase	NA	NA	NA	NA
AUS07364.1|3525556_3526177_+|tail	phage tail protein	tail	A0A218M5J9	Arthrobacter_phage	33.3	6.1e-14
AUS06761.1|3526151_3530858_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06762.1|3531101_3532148_+|transposase	transposase	transposase	NA	NA	NA	NA
AUS06763.1|3532182_3533344_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	36.5	1.0e-30
>prophage 14
CP025938	Tamlana sp. UJ94 chromosome, complete genome	4116543	3587353	3640923	4116543	protease,transposase	Staphylococcus_prophage(20.0%)	50	NA	NA
AUS06812.1|3587353_3588004_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AUS06813.1|3588067_3588961_+	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
AUS06814.1|3589051_3590443_-	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	27.3	2.3e-29
AUS06815.1|3590669_3591263_+	DUF479 domain-containing protein	NA	NA	NA	NA	NA
AUS06816.1|3591263_3592946_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AUS06817.1|3593014_3593734_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06818.1|3594118_3594478_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06819.1|3594590_3595115_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06820.1|3595290_3598146_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	53.1	3.0e-281
AUS06821.1|3598166_3598856_+	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
AUS06822.1|3598952_3601793_+|protease	metalloprotease	protease	NA	NA	NA	NA
AUS06823.1|3601964_3604376_+	transketolase	NA	NA	NA	NA	NA
AUS06824.1|3604560_3605031_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06825.1|3605140_3605362_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06826.1|3605362_3605668_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUS06827.1|3606003_3606678_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06828.1|3606795_3607422_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06829.1|3607727_3608690_+	glycerate dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	30.2	2.2e-26
AUS06830.1|3608946_3611457_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.3	5.0e-91
AUS06831.1|3611581_3611974_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06832.1|3612062_3613193_+	recombinase	NA	A0A1P8DJJ6	Virus_Rctr41k	29.4	5.3e-24
AUS06833.1|3613336_3613756_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06834.1|3614046_3614379_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUS06835.1|3614389_3614722_+	transcriptional regulator	NA	NA	NA	NA	NA
AUS06836.1|3615392_3616463_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06837.1|3616834_3617317_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06838.1|3618442_3618736_+	addiction module toxin RelE	NA	A0A0P0ZE17	Stx2-converting_phage	37.4	1.9e-13
AUS07371.1|3618737_3619094_+	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	49.1	3.5e-22
AUS06839.1|3619310_3619556_+	MazF family transcriptional regulator	NA	NA	NA	NA	NA
AUS06840.1|3619546_3619870_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
AUS06841.1|3620211_3620415_+	transcriptional regulator	NA	NA	NA	NA	NA
AUS06842.1|3620411_3622952_+	DNA methyltransferase	NA	NA	NA	NA	NA
AUS06843.1|3623017_3623758_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	35.8	1.3e-39
AUS06844.1|3623795_3625349_-	LuxR family transcriptional regulator	NA	A0A2L1IVA1	Escherichia_phage	24.2	3.1e-06
AUS06845.1|3625600_3626770_+	hypothetical protein	NA	B3GAM1	uncultured_virus	23.4	1.4e-06
AUS06846.1|3627509_3627980_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06847.1|3628288_3628612_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06848.1|3628962_3629550_+	zeta toxin	NA	NA	NA	NA	NA
AUS06849.1|3629595_3629802_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06850.1|3630439_3630904_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUS06851.1|3630953_3631958_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	2.0e-35
AUS06852.1|3632736_3633519_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06853.1|3633682_3634420_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06854.1|3634429_3635407_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06855.1|3635638_3635938_+	hypothetical protein	NA	A0A141GEX6	Brucella_phage	45.4	8.2e-17
AUS06856.1|3635941_3636220_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	38.2	6.7e-13
AUS06857.1|3636436_3637441_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.4	5.4e-36
AUS06858.1|3637480_3638065_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06859.1|3638272_3639277_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.4	5.4e-36
AUS06860.1|3639564_3640923_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 15
CP025938	Tamlana sp. UJ94 chromosome, complete genome	4116543	3647449	3702666	4116543	transposase	Staphylococcus_prophage(40.0%)	49	NA	NA
AUS06869.1|3647449_3648310_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.3	4.5e-31
AUS06870.1|3648349_3649366_+	hypothetical protein	NA	B9U1V4	Vaccinia_virus	29.6	8.1e-32
AUS07374.1|3649639_3651532_+	alpha-glucosidase	NA	NA	NA	NA	NA
AUS06871.1|3651627_3653193_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	28.7	2.6e-45
AUS07375.1|3653247_3654432_-	galactose-1-epimerase	NA	NA	NA	NA	NA
AUS06872.1|3654460_3655954_-	L-arabinose isomerase	NA	NA	NA	NA	NA
AUS07376.1|3655975_3656677_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
AUS06873.1|3656681_3658352_-	ribulokinase	NA	NA	NA	NA	NA
AUS06874.1|3658501_3659449_-	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
AUS06875.1|3659450_3660794_-	MFS transporter	NA	NA	NA	NA	NA
AUS06876.1|3660879_3663258_-	glycosyl hydrolase	NA	NA	NA	NA	NA
AUS06877.1|3663302_3664286_-	arabinan endo-1,5-alpha-L-arabinosidase	NA	NA	NA	NA	NA
AUS06878.1|3664291_3665254_-	glycoside hydrolase	NA	NA	NA	NA	NA
AUS06879.1|3665265_3666915_-	arabinan endo-1,5-alpha-L-arabinosidase	NA	NA	NA	NA	NA
AUS06880.1|3666926_3668486_-	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
AUS06881.1|3668725_3670291_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
AUS06882.1|3670315_3673489_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUS06883.1|3673919_3674573_-	fructose-6-phosphate aldolase	NA	H8ZMU3	Synechococcus_phage	46.8	2.4e-45
AUS06884.1|3674575_3676621_-	transketolase	NA	NA	NA	NA	NA
AUS06885.1|3677219_3678098_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AUS06886.1|3678199_3678721_+	ubiquitin	NA	Q9WR81	Bovine_viral_diarrhea_virus	57.3	4.8e-20
AUS06887.1|3679081_3679942_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.3	4.5e-31
AUS06888.1|3680043_3680289_+	MazF family transcriptional regulator	NA	NA	NA	NA	NA
AUS06889.1|3680279_3680603_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
AUS06890.1|3680816_3682904_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06891.1|3682906_3683356_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06892.1|3683501_3683726_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06893.1|3684176_3684680_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06894.1|3684624_3685287_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06895.1|3685283_3686162_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AUS06896.1|3686382_3686625_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06897.1|3687032_3687512_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06898.1|3687951_3688335_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06899.1|3688589_3689594_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.4	5.4e-36
AUS06900.1|3689801_3690533_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06901.1|3690725_3690965_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AUS06902.1|3690957_3691245_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUS06903.1|3691649_3691937_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06904.1|3692821_3693826_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.4	5.4e-36
AUS06905.1|3693949_3694426_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06906.1|3694426_3695515_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06907.1|3695516_3696500_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06908.1|3696501_3697074_+	hypothetical protein	NA	A0A1V0SBY2	Catovirus	56.1	4.0e-12
AUS06909.1|3697077_3697446_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06910.1|3697456_3697678_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06911.1|3698054_3699233_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06912.1|3699528_3699981_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06913.1|3700219_3701338_+	ATPase	NA	NA	NA	NA	NA
AUS06914.1|3701472_3702666_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	40.6	6.4e-36
>prophage 16
CP025938	Tamlana sp. UJ94 chromosome, complete genome	4116543	3808516	3851788	4116543	tRNA,transposase	Chrysochromulina_ericina_virus(16.67%)	41	NA	NA
AUS06987.1|3808516_3809830_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	26.3	1.9e-17
AUS06988.1|3809909_3811205_-	aminodeoxychorismate synthase, component I	NA	S4VT78	Pandoravirus	38.5	5.9e-35
AUS06989.1|3811283_3812174_+	aldose epimerase	NA	NA	NA	NA	NA
AUS07381.1|3812260_3813616_+	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	34.0	2.6e-49
AUS06990.1|3813709_3814483_+	threonine/serine exporter	NA	NA	NA	NA	NA
AUS06991.1|3814486_3814978_+	threonine/serine exporter	NA	NA	NA	NA	NA
AUS06992.1|3815343_3815964_-	hypothetical protein	NA	NA	NA	NA	NA
AUS06993.1|3816189_3817590_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.6	1.4e-45
AUS06994.1|3817896_3818106_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06995.1|3818185_3818644_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	43.0	4.0e-23
AUS06996.1|3818697_3819270_+	hypothetical protein	NA	NA	NA	NA	NA
AUS06997.1|3819266_3819908_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.9	1.1e-29
AUS06998.1|3820066_3821026_+	oxidoreductase	NA	NA	NA	NA	NA
AUS06999.1|3821026_3821917_+	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUS07000.1|3822092_3822752_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AUS07001.1|3822851_3824219_+	exonuclease	NA	NA	NA	NA	NA
AUS07002.1|3824253_3825093_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	34.2	6.8e-08
AUS07003.1|3825281_3826067_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
AUS07004.1|3826218_3826776_+|transposase	transposase	transposase	NA	NA	NA	NA
AUS07005.1|3827264_3828461_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	27.6	9.3e-27
AUS07006.1|3828466_3828715_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07007.1|3828954_3829590_+	hypothetical protein	NA	NA	NA	NA	NA
AUS07008.1|3829660_3830854_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	40.6	6.4e-36
AUS07009.1|3830958_3831699_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	35.4	3.8e-39
AUS07010.1|3833960_3835160_+|transposase	transposase	transposase	NA	NA	NA	NA
AUS07011.1|3835225_3835549_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07012.1|3835567_3836971_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
AUS07013.1|3837581_3838412_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUS07014.1|3838652_3840458_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylate synthase	NA	NA	NA	NA	NA
AUS07015.1|3840505_3841621_-	isochorismate synthase	NA	NA	NA	NA	NA
AUS07016.1|3841626_3842052_-	thioesterase	NA	NA	NA	NA	NA
AUS07017.1|3842146_3842818_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07382.1|3842932_3843880_-	nitronate monooxygenase	NA	NA	NA	NA	NA
AUS07018.1|3844074_3844539_+	hypothetical protein	NA	NA	NA	NA	NA
AUS07383.1|3844549_3845779_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	26.9	7.1e-22
AUS07019.1|3846009_3846702_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AUS07020.1|3846851_3847382_+	hypothetical protein	NA	NA	NA	NA	NA
AUS07021.1|3847567_3848077_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07022.1|3848251_3850156_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.2	3.1e-141
AUS07023.1|3850170_3850395_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07024.1|3850909_3851788_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 17
CP025938	Tamlana sp. UJ94 chromosome, complete genome	4116543	3859940	3941365	4116543	tRNA,transposase	Cellulophaga_phage(16.67%)	54	NA	NA
AUS07031.1|3859940_3861140_+|transposase	transposase	transposase	NA	NA	NA	NA
AUS07032.1|3861205_3861487_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07033.1|3861578_3861995_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07034.1|3861994_3863047_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07035.1|3863097_3863490_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07036.1|3863519_3864395_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07037.1|3864397_3865312_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07038.1|3865339_3865936_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07039.1|3866278_3870334_-	hypothetical protein	NA	S0A5P2	Cellulophaga_phage	32.4	1.4e-34
AUS07040.1|3870582_3870972_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07384.1|3870928_3872164_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07041.1|3872283_3875016_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07042.1|3875066_3876389_-	acetylxylan esterase	NA	NA	NA	NA	NA
AUS07043.1|3876410_3878114_-	glycoside hydrolase	NA	NA	NA	NA	NA
AUS07044.1|3878145_3881070_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07045.1|3881100_3883737_-	glucan 1,4-alpha-glucosidase	NA	NA	NA	NA	NA
AUS07046.1|3883740_3885375_-	glycoside hydrolase	NA	NA	NA	NA	NA
AUS07047.1|3885636_3887115_-	pectate lyase	NA	M4SNB6	Cellulophaga_phage	33.5	5.9e-39
AUS07385.1|3887300_3888950_-	DUF5123 domain-containing protein	NA	NA	NA	NA	NA
AUS07386.1|3888966_3890781_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
AUS07048.1|3890805_3894108_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUS07049.1|3894782_3899228_-	hypothetical protein	NA	W8CYF6	Bacillus_phage	27.4	5.3e-19
AUS07050.1|3899429_3900599_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUS07051.1|3900734_3901688_-|transposase	DDE transposase	transposase	A0A2R2ZGN7	Clostridioides_phage	26.1	8.5e-07
AUS07052.1|3901713_3902061_-|transposase	transposase	transposase	NA	NA	NA	NA
AUS07053.1|3902443_3903478_+	glutamine cyclotransferase	NA	NA	NA	NA	NA
AUS07054.1|3903575_3904880_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AUS07055.1|3904881_3905901_+	cytochrome BD ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AUS07056.1|3906347_3906818_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
AUS07057.1|3906892_3909100_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
AUS07058.1|3909298_3909796_+	thiol peroxidase	NA	NA	NA	NA	NA
AUS07059.1|3909797_3910166_+	diacylglycerol kinase	NA	NA	NA	NA	NA
AUS07060.1|3910276_3912688_+	cell division protein FtsK	NA	A0A218M9A2	Mycobacterium_phage	41.2	4.9e-67
AUS07061.1|3912699_3913335_+	hypothetical protein	NA	NA	NA	NA	NA
AUS07062.1|3913342_3915364_+	YjgP/YjgQ family permease	NA	NA	NA	NA	NA
AUS07387.1|3915437_3916586_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	42.1	7.7e-71
AUS07063.1|3916852_3918052_-|transposase	transposase	transposase	NA	NA	NA	NA
AUS07064.1|3918247_3919447_-|transposase	transposase	transposase	NA	NA	NA	NA
AUS07065.1|3919625_3920795_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUS07066.1|3920872_3921664_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.3	5.4e-31
AUS07067.1|3921744_3923289_+	hypothetical protein	NA	NA	NA	NA	NA
AUS07068.1|3923299_3923716_+	hypothetical protein	NA	NA	NA	NA	NA
AUS07069.1|3924080_3925243_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	36.5	1.0e-30
AUS07070.1|3925628_3926633_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.2e-35
AUS07071.1|3926672_3927848_+|transposase	transposase	transposase	NA	NA	NA	NA
AUS07072.1|3927886_3929080_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	40.1	1.1e-35
AUS07073.1|3929308_3929890_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07074.1|3929882_3930227_-|transposase	transposase	transposase	NA	NA	NA	NA
AUS07075.1|3936276_3936468_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07076.1|3936899_3937232_+|transposase	transposase	transposase	NA	NA	NA	NA
AUS07077.1|3937241_3938225_+|transposase	DDE transposase	transposase	A0A2R2ZGN7	Clostridioides_phage	24.5	3.9e-07
AUS07078.1|3938648_3938966_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUS07388.1|3938965_3939199_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07079.1|3939430_3941365_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	37.0	8.8e-128
>prophage 18
CP025938	Tamlana sp. UJ94 chromosome, complete genome	4116543	4018711	4085158	4116543	tRNA,transposase	Tupanvirus(12.5%)	53	NA	NA
AUS07136.1|4018711_4020085_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	33.5	4.6e-46
AUS07137.1|4020227_4020695_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07138.1|4020877_4021321_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
AUS07139.1|4021334_4021631_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
AUS07140.1|4021633_4021972_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
AUS07141.1|4022179_4022875_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUS07142.1|4022906_4025360_-	primosomal protein N'	NA	NA	NA	NA	NA
AUS07143.1|4025363_4026305_-	ribonuclease BN	NA	NA	NA	NA	NA
AUS07144.1|4026403_4027264_-	nicotinate-nucleotide diphosphorylase (carboxylating)	NA	NA	NA	NA	NA
AUS07145.1|4027389_4027863_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AUS07146.1|4028164_4028515_-	transcriptional regulator	NA	NA	NA	NA	NA
AUS07147.1|4028517_4028814_-	type II toxin-antitoxin system HigB family toxin	NA	F5A3A2	Riemerella_phage	44.6	1.6e-17
AUS07148.1|4029067_4029367_-	30S ribosomal protein S30	NA	NA	NA	NA	NA
AUS07149.1|4029540_4030116_+	non-canonical purine NTP pyrophosphatase	NA	A0A220NCU0	Ugandan_cassava_brown_streak_virus	32.5	9.3e-17
AUS07150.1|4030246_4032466_+	RelA/SpoT family protein	NA	NA	NA	NA	NA
AUS07151.1|4032494_4032953_+	transcriptional repressor	NA	NA	NA	NA	NA
AUS07152.1|4032961_4034239_+	adenylosuccinate synthase	NA	A0A291AUF9	Pandoravirus	31.5	8.6e-55
AUS07153.1|4034554_4036702_+	hypothetical protein	NA	NA	NA	NA	NA
AUS07154.1|4036708_4037893_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.6	1.2e-31
AUS07155.1|4038050_4039439_+	hypothetical protein	NA	NA	NA	NA	NA
AUS07156.1|4039488_4040409_+	DUF368 domain-containing protein	NA	NA	NA	NA	NA
AUS07157.1|4040408_4041425_+	DUF368 domain-containing protein	NA	NA	NA	NA	NA
AUS07158.1|4041421_4042162_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AUS07159.1|4042266_4044261_+	DUF349 domain-containing protein	NA	NA	NA	NA	NA
AUS07160.1|4046863_4047589_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	34.8	5.1e-36
AUS07161.1|4047645_4048839_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	40.6	6.4e-36
AUS07162.1|4049572_4051192_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	23.7	1.3e-39
AUS07163.1|4051386_4052808_+	hypothetical protein	NA	NA	NA	NA	NA
AUS07164.1|4053091_4053814_-	hypothetical protein	NA	NA	NA	NA	NA
AUS07165.1|4054559_4055918_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUS07166.1|4056004_4056259_+	prevent-host-death protein	NA	NA	NA	NA	NA
AUS07167.1|4056260_4056518_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AUS07168.1|4056658_4057069_+	hypothetical protein	NA	NA	NA	NA	NA
AUS07169.1|4057270_4058173_+	flagellar biosynthesis protein FlgM	NA	NA	NA	NA	NA
AUS07170.1|4058397_4060158_+	amino acid permease	NA	NA	NA	NA	NA
AUS07171.1|4060321_4061512_-	L-glutamine--2-deoxy-scyllo-inosose aminotransferase KanB	NA	A0A2D2W2B8	Stenotrophomonas_phage	24.5	5.6e-08
AUS07172.1|4061677_4062307_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
AUS07173.1|4062841_4065946_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
AUS07174.1|4065958_4066321_-	four helix bundle protein	NA	NA	NA	NA	NA
AUS07175.1|4066395_4067517_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	44.8	1.3e-22
AUS07176.1|4067513_4068524_-	cell filamentation protein Fic	NA	Q9JMN3	Wolbachia_phage	40.7	7.7e-59
AUS07177.1|4068520_4070068_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.0	2.0e-98
AUS07178.1|4070103_4071189_-	addiction module protein	NA	D7RWK9	Brochothrix_phage	31.5	3.1e-21
AUS07179.1|4071791_4072142_+|transposase	transposase	transposase	NA	NA	NA	NA
AUS07180.1|4072134_4073118_+|transposase	DDE transposase	transposase	A0A2R2ZGN7	Clostridioides_phage	25.1	5.1e-07
AUS07181.1|4073398_4076071_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUS07182.1|4076097_4076952_-	GLPGLI family protein	NA	NA	NA	NA	NA
AUS07183.1|4077319_4078099_+	hypothetical protein	NA	NA	NA	NA	NA
AUS07184.1|4078103_4078718_+	deoxynucleoside kinase	NA	S5MMC6	Bacillus_phage	35.5	1.3e-29
AUS07185.1|4078894_4081240_-	sodium-translocating pyrophosphatase	NA	NA	NA	NA	NA
AUS07186.1|4081542_4082742_-|transposase	transposase	transposase	NA	NA	NA	NA
AUS07394.1|4083066_4083600_-	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	47.2	2.3e-25
AUS07187.1|4083958_4085158_-|transposase	transposase	transposase	NA	NA	NA	NA
