The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP013867	Bordetella pertussis strain J365, complete genome	4082563	0	59497	4082563	integrase,tRNA	Natrialba_phage(12.5%)	53	44611:44670	70033:70182
AUR61307.1|0_1920_+|tRNA	tRNA uridine 5-carboxymethylaminomethyl modification protein	tRNA	NA	NA	NA	NA
AUR61308.1|1916_2609_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
AUR61309.1|2605_3403_+	chromosome partitioning protein	NA	Q8JL10	Natrialba_phage	34.9	5.6e-20
AUR61310.1|3409_4171_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AUR61311.1|4214_5132_+	chromosome partitioning protein ParB	NA	I3NLC2	Bifidobacterium_phage	38.1	1.9e-16
AUR61312.1|5124_5910_+	L-asparaginase	NA	NA	NA	NA	NA
AUR61313.1|5943_6126_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61314.1|6721_7912_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	29.2	3.1e-14
AUR61315.1|8150_8531_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
AUR61316.1|8540_9074_+	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	30.5	1.4e-11
AUR61317.1|9137_9569_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
AUR61318.1|9571_10270_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
AUR61319.1|10512_11037_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
AUR61320.1|11118_11502_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
AUR61321.1|11661_15774_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.8	2.4e-21
AUR61322.1|15773_20018_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	24.7	3.5e-68
AUR64654.1|20126_20531_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61323.1|20771_21947_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61324.1|21943_22894_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR61325.1|25401_26508_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
AUR64655.1|27624_28335_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61326.1|28331_29234_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR61327.1|29363_29663_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61328.1|29723_30158_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61329.1|30190_31408_-	thiolase	NA	NA	NA	NA	NA
AUR61330.1|31413_31911_-	dehydratase	NA	NA	NA	NA	NA
AUR61331.1|32118_33054_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR64656.1|33263_34055_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR61332.1|34097_35519_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AUR61333.1|35722_36625_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR61334.1|36621_37812_-	transporter	NA	NA	NA	NA	NA
AUR61335.1|38061_38973_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AUR61336.1|38974_41113_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUR61337.1|41109_41649_+	D,D-heptose 1,7-bisphosphate phosphatase	NA	NA	NA	NA	NA
AUR61338.1|41652_42381_+	acyl-phosphate glycerol 3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUR61339.1|42367_43261_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61340.1|43331_43727_+	glyoxalase I	NA	NA	NA	NA	NA
AUR61341.1|43736_44267_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.4	3.7e-12
AUR61342.1|44395_44575_-	hypothetical protein	NA	NA	NA	NA	NA
44611:44670	attL	CTAGCTGTGAAGATTCAATAGGTTGTATGCATGGTTCATCCGAACCGGATTTGAGAAACT	NA	NA	NA	NA
AUR61343.1|44712_45663_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR64657.1|46273_46798_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61344.1|46769_47006_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AUR61345.1|47133_48027_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61346.1|49196_50444_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
AUR61347.1|50440_51055_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
AUR61348.1|51190_52141_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR61349.1|52183_53440_+	AmpG family muropeptide MFS transporter	NA	NA	NA	NA	NA
AUR61350.1|54671_55406_-	glutamate racemase	NA	NA	NA	NA	NA
AUR61351.1|55411_56002_-	arginine transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-20
AUR61352.1|56026_56716_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUR61353.1|56712_57474_-	glutamate ABC transporter permease	NA	NA	NA	NA	NA
AUR61354.1|57553_58453_-	ABC transporter	NA	NA	NA	NA	NA
AUR61355.1|58546_59497_-|integrase	integrase	integrase	NA	NA	NA	NA
70033:70182	attR	CTAGCTGTGAAGATTCAATAGGTTGTATGCATGGTTCATCCGAACCGGATTTGAGAAACTGGAAATCGCCACCCCCCCAGTTCACTCAAGGAGCCCGGCCGGATGAACACCCATAAGCATGCCCGATTGACCTTCCTACGTCGACTCGAA	NA	NA	NA	NA
>prophage 2
CP013867	Bordetella pertussis strain J365, complete genome	4082563	70182	123122	4082563	integrase,tRNA,transposase	Planktothrix_phage(20.0%)	53	77908:77923	123514:123529
AUR61364.1|70182_71085_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR61365.1|71178_71493_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR61366.1|72685_74593_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.2	1.1e-117
AUR61367.1|74754_75375_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUR61368.1|75406_75988_-	N-acetyl-anhydromuranmyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	54.3	1.7e-05
AUR61369.1|76076_76328_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61370.1|76329_77172_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61371.1|77277_78687_+	signal recognition particle	NA	NA	NA	NA	NA
77908:77923	attL	GACGAGGCCATGATGC	NA	NA	NA	NA
AUR61372.1|78683_79634_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR64659.1|79708_80653_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR61373.1|80649_82524_-	capsular biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	26.9	2.0e-23
AUR61374.1|83871_84576_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AUR61375.1|84572_85679_-	glycosyl transferase	NA	NA	NA	NA	NA
AUR61376.1|85940_86534_-	sugar transferase	NA	NA	NA	NA	NA
AUR61377.1|86530_87718_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	NA	NA	NA	NA
AUR61378.1|87780_89040_-	glycosyltransferase WbuB	NA	NA	NA	NA	NA
AUR61379.1|89063_90152_-	UDP-N-acetyl glucosamine 2-epimerase	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	36.3	4.8e-46
AUR61380.1|90159_91260_-	aminotransferase DegT	NA	A0A2K9L0G1	Tupanvirus	29.7	3.3e-31
AUR61381.1|91263_91839_-	serine acetyltransferase	NA	NA	NA	NA	NA
AUR61382.1|91842_92895_-	oxidoreductase	NA	NA	NA	NA	NA
AUR61383.1|93025_94033_+	heptosyltransferase	NA	NA	NA	NA	NA
AUR61384.1|94034_95321_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
AUR61385.1|95337_95493_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61386.1|95517_96321_-	type III pantothenate kinase	NA	NA	NA	NA	NA
AUR61387.1|96317_97184_-	biotin--protein ligase	NA	NA	NA	NA	NA
AUR61388.1|97258_98389_+	ABC transporter permease	NA	NA	NA	NA	NA
AUR61389.1|98388_99228_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	9.1e-21
AUR61390.1|99381_99849_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61391.1|99938_100160_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61392.1|100160_100763_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61393.1|100792_101446_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUR64660.1|101656_102835_+	peptidase	NA	B6DZZ7	Stx2-converting_phage	40.5	5.8e-66
AUR61394.1|102915_103782_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
AUR61395.1|103857_104133_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61396.1|104140_104803_+	lipoate--protein ligase	NA	NA	NA	NA	NA
AUR61397.1|104864_105866_+	lipoyl synthase	NA	NA	NA	NA	NA
AUR61398.1|105880_106429_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	53.4	3.7e-47
AUR61399.1|106486_107383_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
AUR61400.1|107379_108441_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	44.8	1.6e-78
AUR61401.1|108476_109379_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR61402.1|110326_111520_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
AUR61403.1|111601_112231_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AUR61404.1|112292_112976_-	cell division protein	NA	NA	NA	NA	NA
AUR61405.1|112985_114668_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
AUR64661.1|114955_115303_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61406.1|115393_115711_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64662.1|115993_117010_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR61407.1|117085_117886_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR61408.1|117882_118758_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR61409.1|118768_120061_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR61410.1|120103_121144_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	6.0e-22
AUR61411.1|121249_122071_-	metallophosphatase	NA	NA	NA	NA	NA
AUR61412.1|122171_123122_-|integrase	integrase	integrase	NA	NA	NA	NA
123514:123529	attR	GCATCATGGCCTCGTC	NA	NA	NA	NA
>prophage 3
CP013867	Bordetella pertussis strain J365, complete genome	4082563	165944	302554	4082563	integrase,tRNA	Klosneuvirus(10.53%)	118	174244:174262	306632:306649
AUR61449.1|165944_166895_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR61450.1|168338_169241_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61451.1|169218_169848_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61452.1|170130_171561_+	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.8	5.8e-44
AUR61453.1|171594_172224_+	threonine transporter RhtB	NA	NA	NA	NA	NA
AUR61454.1|172272_173880_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	37.8	9.3e-14
AUR61455.1|173916_174588_+	hypothetical protein	NA	NA	NA	NA	NA
174244:174262	attL	GCGCGCGAGATCGCCGCCA	NA	NA	NA	NA
AUR64664.1|174669_175146_-	bacterioferritin	NA	NA	NA	NA	NA
174244:174262	attL	GCGCGCGAGATCGCCGCCA	NA	NA	NA	NA
AUR61456.1|175400_176303_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR61457.1|177418_177946_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61458.1|178037_178853_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61459.1|178913_179648_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61460.1|179685_181764_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	23.6	1.5e-27
AUR61461.1|182013_182286_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61462.1|182387_183473_+	ATP-binding protein	NA	NA	NA	NA	NA
AUR61463.1|183476_185381_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61464.1|185377_189052_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61465.1|189112_189676_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	75.3	2.6e-72
AUR61466.1|189683_190106_-	glyoxalase	NA	NA	NA	NA	NA
AUR61467.1|190133_190553_-	glyoxalase	NA	NA	NA	NA	NA
AUR61468.1|190581_190929_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64665.1|191202_191652_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61469.1|191806_194077_+	lysine decarboxylase	NA	NA	NA	NA	NA
AUR61470.1|194152_195358_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61471.1|195504_196407_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR61472.1|196509_197145_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	73.8	2.8e-83
AUR61473.1|197141_198035_+	divalent cation transporter	NA	NA	NA	NA	NA
AUR61474.1|198429_199530_+	glycine cleavage system protein T	NA	NA	NA	NA	NA
AUR61475.1|199611_199986_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
AUR61476.1|200045_202910_+	glycine dehydrogenase (aminomethyl-transferring)	NA	E3SN07	Prochlorococcus_phage	51.4	1.2e-261
AUR61477.1|203054_203795_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR61478.1|203864_205076_+	formyl-CoA transferase	NA	NA	NA	NA	NA
AUR61479.1|205104_206073_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61480.1|206734_207637_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR61481.1|207793_208117_+	PsiF repeat family protein	NA	NA	NA	NA	NA
AUR64666.1|208221_209262_-	cyclase	NA	NA	NA	NA	NA
AUR61482.1|209267_210047_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AUR61483.1|210092_210389_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61484.1|210414_210690_-	muconolactone delta-isomerase	NA	NA	NA	NA	NA
AUR61485.1|210746_211391_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUR61486.1|211390_212077_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUR64667.1|212275_213058_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR61487.1|213108_213834_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR61488.1|213865_215215_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
AUR61489.1|215326_216259_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR61490.1|216716_219512_-	peptidase S8	NA	NA	NA	NA	NA
AUR61491.1|220105_222949_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AUR61492.1|223119_223839_+	7-cyano-7-deazaguanine synthase	NA	A0A0A0RPC6	Escherichia_phage	43.9	8.0e-50
AUR61493.1|223877_224426_-	GCN5 family acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	41.7	1.2e-21
AUR61494.1|224580_225480_+	virginiamycin B lyase	NA	NA	NA	NA	NA
AUR61495.1|225504_226455_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR61496.1|226673_227369_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR61497.1|227385_228798_+	hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
AUR61498.1|228910_230341_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUR61499.1|230382_232296_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
AUR61500.1|232614_233181_+	preprotein translocase subunit SecD	NA	NA	NA	NA	NA
AUR61501.1|233271_234273_+	restriction endonuclease	NA	NA	NA	NA	NA
AUR61502.1|234387_235338_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR61503.1|235424_236375_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR61504.1|236371_237322_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR61505.1|237420_238218_-	beta-D-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
AUR61506.1|239167_239578_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUR61507.1|239827_240583_+	gamma-hydroxybutyrate dehydrogenase	NA	D2K0C8	Staphylococcus_phage	55.0	4.6e-32
AUR61508.1|240599_241343_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR61509.1|241386_242430_-	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR61510.1|242600_244703_+	hypothetical protein	NA	NA	NA	NA	NA
242713:242731	attR	TGGCGGCGATCTCGCGCGC	NA	NA	NA	NA
AUR61511.1|246113_247070_+	hypothetical protein	NA	NA	NA	NA	NA
242713:242731	attR	TGGCGGCGATCTCGCGCGC	NA	NA	NA	NA
AUR61512.1|247088_247580_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine pyrophosphokinase	NA	NA	NA	NA	NA
AUR61513.1|247576_248932_-	poly(A) polymerase	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	36.8	3.4e-25
AUR61514.1|248932_249631_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61515.1|249627_250329_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
AUR61516.1|250581_251631_+	phosphoribosylaminoimidazole synthetase	NA	Q58MH8	Prochlorococcus_phage	43.6	5.6e-68
AUR61517.1|251736_252678_-|tRNA	tRNA dimethylallyltransferase	tRNA	NA	NA	NA	NA
AUR61518.1|252674_254564_-	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	32.8	3.3e-79
AUR64668.1|254668_255289_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61519.1|255431_256817_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	30.3	4.5e-17
AUR61520.1|256747_257284_-|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein TsaE	tRNA	NA	NA	NA	NA
AUR61521.1|257435_258827_+	class II fumarate hydratase	NA	NA	NA	NA	NA
AUR61522.1|258843_259824_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61523.1|259959_260943_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR61524.1|261007_261907_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR61525.1|262013_263768_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AUR61526.1|263775_264900_-	carnitine dehydratase	NA	NA	NA	NA	NA
AUR61527.1|264913_265894_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR61528.1|266672_267575_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR61529.1|267589_267961_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61530.1|268134_268680_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUR61531.1|268805_270383_+	cytochrome d terminal oxidase subunit 1	NA	NA	NA	NA	NA
AUR61532.1|270398_271553_+	cytochrome d ubiquinol oxidase subunit 2	NA	NA	NA	NA	NA
AUR61533.1|271566_271692_+	cytochrome bd biosynthesis protein	NA	NA	NA	NA	NA
AUR61534.1|271688_273440_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.8	3.4e-09
AUR61535.1|273436_275116_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	3.6e-16
AUR61536.1|275178_275727_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.1	1.3e-28
AUR61537.1|276869_277148_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61538.1|278191_279142_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR61539.1|279419_279581_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61540.1|279588_279729_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61541.1|280247_280697_-	stringent starvation protein B	NA	NA	NA	NA	NA
AUR61542.1|280706_281318_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUR61543.1|281476_282325_-	cytochrome C	NA	NA	NA	NA	NA
AUR61544.1|282350_283733_-	cytochrome B	NA	NA	NA	NA	NA
AUR61545.1|283797_284439_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AUR61546.1|284578_285037_+	large-conductance mechanosensitive channel	NA	NA	NA	NA	NA
AUR61547.1|285061_285838_-	metal-binding protein	NA	NA	NA	NA	NA
AUR61548.1|285858_287028_+	2-alkenal reductase	NA	W5SAB9	Pithovirus	31.2	1.2e-07
AUR61549.1|287024_287975_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR61550.1|288073_288700_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61551.1|288722_289649_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
AUR61552.1|289657_291244_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR61553.1|291240_292245_-	acetylesterase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	31.5	7.5e-30
AUR61554.1|292444_293305_+	cupin	NA	NA	NA	NA	NA
AUR61555.1|293336_294338_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61556.1|294408_295218_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUR61557.1|295295_297155_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AUR61558.1|297283_298486_-	arabinose transporter permease	NA	NA	NA	NA	NA
AUR61559.1|298599_299481_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR61560.1|300983_301544_-	5'-3'-deoxyribonucleotidase	NA	A0A1E1EUN3	Acanthamoeba_castellanii_mimivirus	30.8	3.2e-14
AUR61561.1|301603_302554_-|integrase	integrase	integrase	NA	NA	NA	NA
306632:306649	attR	CGCGCGCCGCGCCGGCGG	NA	NA	NA	NA
>prophage 4
CP013867	Bordetella pertussis strain J365, complete genome	4082563	391907	449416	4082563	integrase	Orpheovirus(14.29%)	50	402106:402165	449459:449560
AUR61648.1|391907_392858_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR61649.1|392994_393912_+	reductase	NA	NA	NA	NA	NA
AUR61650.1|393908_394157_+	NrdH-redoxin	NA	NA	NA	NA	NA
AUR61651.1|394153_395359_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUR61652.1|395431_396427_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61653.1|396449_397670_-	dehydratase	NA	NA	NA	NA	NA
AUR61654.1|397666_398311_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61655.1|398307_398700_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61656.1|398588_399941_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61657.1|400041_400851_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR64673.1|401155_402109_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	5.6e-59
402106:402165	attL	CTAGCTGTGAAGATTCAATAGGTTGTATGCATGGTTCATCCGAACCGGATTTGAGAAACT	NA	NA	NA	NA
AUR61658.1|402207_403191_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR61659.1|403867_404638_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR61660.1|404634_405813_-	carnitine dehydratase	NA	NA	NA	NA	NA
AUR61661.1|405980_407687_-	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
AUR61662.1|407683_408580_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR61663.1|408620_410210_-	sulfurtransferase	NA	NA	NA	NA	NA
AUR61664.1|410259_411252_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61665.1|411320_411920_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61666.1|412380_413361_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61667.1|413436_414339_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR61668.1|414475_415390_+	transporter	NA	NA	NA	NA	NA
AUR61669.1|415386_416046_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61670.1|416135_417059_+	peptidase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	27.2	4.8e-07
AUR61671.1|417064_417520_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61672.1|417516_418620_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61673.1|418807_420427_-	dolichyl-phosphate-mannose--protein mannosyltransferase	NA	NA	NA	NA	NA
AUR61674.1|420423_421482_-	glycosyl transferase family 2	NA	I1TED8	Salmonella_phage	40.5	2.8e-59
AUR61675.1|421611_422106_+	acetyltransferase	NA	NA	NA	NA	NA
AUR61676.1|422198_423176_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR61677.1|423371_424577_+	ABC transporter permease	NA	NA	NA	NA	NA
AUR61678.1|424573_426085_+	TRAP ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR64674.1|426100_427414_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
AUR61679.1|427604_427784_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61680.1|428193_428928_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	43.8	1.4e-41
AUR61681.1|431372_432323_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR61682.1|432454_432853_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	44.3	9.0e-19
AUR61683.1|433263_433734_-	universal stress protein	NA	NA	NA	NA	NA
AUR61684.1|433822_434167_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61685.1|434266_435667_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR61686.1|437455_437974_-	methyltransferase	NA	G3MA03	Bacillus_virus	38.9	2.1e-12
AUR61687.1|438084_438840_+	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	40.8	2.9e-42
AUR61688.1|439035_440268_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUR61689.1|440260_441046_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR61690.1|441112_442084_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR61691.1|442094_443072_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR61692.1|443197_444370_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR61693.1|444396_445425_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR61694.1|445490_446684_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUR61695.1|448465_449416_-|integrase	integrase	integrase	NA	NA	NA	NA
449459:449560	attR	AGTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACAGCTAGCCGGGCGCGGCGATGGGGTCTTGCCGGGCCCCGCAGATCTCG	NA	NA	NA	NA
>prophage 5
CP013867	Bordetella pertussis strain J365, complete genome	4082563	620804	721269	4082563	terminase,integrase,tRNA,tail	uncultured_Caudovirales_phage(14.29%)	110	665796:665810	724084:724102
AUR61848.1|620804_621755_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR61849.1|622453_622837_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61850.1|622894_623497_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64681.1|623514_623916_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61851.1|624031_624943_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR61852.1|624939_625521_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AUR64682.1|626324_627050_+|tRNA	arginyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
AUR61853.1|627090_628140_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AUR61854.1|628287_628866_-	Phasin (PHA-granule associated protein)	NA	NA	NA	NA	NA
AUR61855.1|629252_630230_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR61856.1|630323_634718_-	dermonecrotic toxin	NA	NA	NA	NA	NA
AUR61857.1|634918_635767_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR61858.1|635925_636738_-	damage-inducible protein	NA	NA	NA	NA	NA
AUR61859.1|636793_637744_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR61860.1|637842_638643_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61861.1|638704_639088_+	thiol-disulfide isomerase	NA	NA	NA	NA	NA
AUR64683.1|639099_640452_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	2.1e-51
AUR61862.1|640739_641069_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61863.1|641071_641821_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61864.1|642003_642924_+	branched chain amino acid aminotransferase	NA	NA	NA	NA	NA
AUR61865.1|642970_643183_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61866.1|643205_643628_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AUR61867.1|643644_644745_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUR61868.1|644841_646359_-	peptidase	NA	NA	NA	NA	NA
AUR61869.1|646434_647274_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	48.9	1.1e-66
AUR64684.1|647295_648168_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61870.1|648258_649353_-	porin	NA	NA	NA	NA	NA
AUR61871.1|649646_650549_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR64685.1|650671_651613_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR61872.1|651696_652056_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61873.1|652437_653475_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61874.1|653791_655132_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AUR61875.1|655141_655594_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61876.1|655699_656872_+	monooxygenase	NA	NA	NA	NA	NA
AUR61877.1|656937_657963_+|tRNA	tRNA-dihydrouridine synthase B	tRNA	NA	NA	NA	NA
AUR61878.1|658003_658243_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUR61879.1|658312_659902_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.2	8.7e-65
AUR61880.1|659901_660450_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
AUR61881.1|660530_661103_+	Holliday junction ATP-dependent DNA helicase RuvA	NA	NA	NA	NA	NA
AUR61882.1|661121_662033_-	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AUR61883.1|662106_663075_-	serine dehydratase	NA	NA	NA	NA	NA
AUR61884.1|663197_664271_+	ATP-dependent DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.7	2.3e-08
AUR61885.1|664275_666096_-	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	3.1e-74
665796:665810	attL	CGACCTCGCGCGCCA	NA	NA	NA	NA
AUR61886.1|666172_667075_-|integrase	integrase	integrase	NA	NA	NA	NA
665796:665810	attL	CGACCTCGCGCGCCA	NA	NA	NA	NA
AUR61887.1|667211_667547_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61888.1|667680_668331_+	carbonate dehydratase	NA	NA	NA	NA	NA
AUR61889.1|668352_669771_-	amidase	NA	NA	NA	NA	NA
AUR61890.1|669840_670596_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64686.1|670564_671323_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUR61891.1|671333_672215_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUR61892.1|672231_672939_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.4	8.2e-07
AUR61893.1|672941_673700_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.4	4.4e-14
AUR61894.1|673909_675652_+	sulfite reductase	NA	NA	NA	NA	NA
AUR61895.1|675644_676169_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61896.1|676208_677003_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR61897.1|677170_678244_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61898.1|678342_679293_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR61899.1|679544_679751_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64687.1|679822_680434_-	repressor	NA	NA	NA	NA	NA
AUR61900.1|680913_681234_-	hypothetical protein	NA	NA	NA	NA	NA
681041:681055	attR	TGGCGCGCGAGGTCG	NA	NA	NA	NA
AUR61901.1|681226_681925_-	hypothetical protein	NA	NA	NA	NA	NA
681041:681055	attR	TGGCGCGCGAGGTCG	NA	NA	NA	NA
AUR61902.1|681939_682161_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61903.1|682178_683129_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR61904.1|683769_684255_+|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	61.5	7.3e-39
AUR61905.1|684241_685519_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	64.7	2.4e-150
AUR61906.1|685521_686940_+	hypothetical protein	NA	R9TF43	Synechococcus_phage	42.1	2.2e-99
AUR61907.1|686911_688024_+	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	49.7	2.1e-102
AUR61908.1|688029_688272_+	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	53.2	5.6e-16
AUR61909.1|688394_688997_+	hypothetical protein	NA	R9TF81	Synechococcus_phage	43.6	7.9e-27
AUR61910.1|689425_690376_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR61911.1|691050_691302_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61912.1|691364_691847_+	hypothetical protein	NA	A0A2H4JE38	uncultured_Caudovirales_phage	37.1	1.8e-13
AUR61913.1|691848_692049_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61914.1|692048_692444_+	hypothetical protein	NA	A0A2D2W284	Stenotrophomonas_phage	35.0	7.8e-07
AUR61915.1|692440_692839_+	hypothetical protein	NA	I6PCW1	Cronobacter_phage	38.0	4.2e-16
AUR61916.1|692835_693258_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61917.1|693265_693766_+	hypothetical protein	NA	A0A1I9SEX5	Klebsiella_phage	45.1	4.4e-31
AUR61918.1|694020_694539_+|tail	phage tail protein	tail	A0A1S5R1H0	Pseudomonas_phage	38.3	5.4e-24
AUR61919.1|694548_694878_+	hypothetical protein	NA	A0A2H4J121	uncultured_Caudovirales_phage	44.0	2.9e-15
AUR61920.1|694895_695186_+	hypothetical protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	45.2	3.7e-14
AUR61921.1|695211_697824_+|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	38.6	4.9e-105
AUR61922.1|697833_698193_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61923.1|698260_698794_+	hypothetical protein	NA	A5A3Q9	Burkholderia_phage	46.9	1.1e-40
AUR61924.1|698790_699180_+	hypothetical protein	NA	A0A0G3EYJ9	Achromobacter_phage	50.0	3.0e-35
AUR61925.1|699172_703129_+	hypothetical protein	NA	A0A0B5A1N2	Achromobacter_phage	40.8	3.9e-215
AUR61926.1|703133_703550_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61927.1|703768_704032_+	hypothetical protein	NA	A0A1B0V3F2	Roseobacter_phage	41.8	7.2e-09
AUR61928.1|704031_704844_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61929.1|704848_705091_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61930.1|705069_705621_+	lysozyme	NA	NA	NA	NA	NA
AUR61931.1|705620_706136_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61932.1|706132_706414_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61933.1|706413_706635_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61934.1|706963_707635_-	hypothetical protein	NA	Q5QF62	Pseudomonas_virus	39.9	4.7e-36
AUR61935.1|707562_707931_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61936.1|707990_708677_-	two-component system response regulator	NA	NA	NA	NA	NA
AUR61937.1|708657_709230_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AUR61938.1|709295_711026_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	29.4	4.6e-11
AUR61939.1|711078_711507_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUR61940.1|711509_712190_+	protein TolQ	NA	NA	NA	NA	NA
AUR61941.1|712189_712648_+	protein TolR	NA	NA	NA	NA	NA
AUR61942.1|712684_713659_+	protein TolA	NA	NA	NA	NA	NA
AUR61943.1|713675_714992_+	translocation protein TolB	NA	NA	NA	NA	NA
AUR61944.1|715023_715521_+	peptidoglycan-associated lipoprotein	NA	NA	NA	NA	NA
AUR61945.1|715607_716297_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
AUR61946.1|716296_717346_+	iron-siderophore ABC transporter permease	NA	NA	NA	NA	NA
AUR61947.1|717342_718137_+	iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	2.4e-15
AUR61948.1|718305_718656_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61949.1|718631_719189_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61950.1|720318_721269_+|integrase	integrase	integrase	NA	NA	NA	NA
724084:724102	attR	GGCCGCCGCGATCGCCGCG	NA	NA	NA	NA
>prophage 6
CP013867	Bordetella pertussis strain J365, complete genome	4082563	748194	821356	4082563	integrase	Streptococcus_phage(16.67%)	59	752251:752310	821400:821502
AUR61971.1|748194_749145_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR61972.1|749799_750897_+	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
AUR61973.1|750930_752196_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
752251:752310	attL	GCTAGGTGTGAAGATTCAATAGGTTGTATGCATGGTTCATCCGAACCGGATTTGAGAAAC	NA	NA	NA	NA
AUR61974.1|752401_753304_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR61975.1|753345_753501_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61976.1|753547_754138_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AUR64689.1|754153_756598_-	ligand-gated channel	NA	NA	NA	NA	NA
AUR61977.1|756717_757689_-	hypothetical protein	NA	NA	NA	NA	NA
AUR61978.1|757820_758345_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUR61979.1|758304_759255_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR61980.1|759476_761672_-	DNA methylase	NA	NA	NA	NA	NA
AUR64690.1|761744_762092_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUR61981.1|762274_763225_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR61982.1|763340_763784_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUR61983.1|763846_764641_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR61984.1|764806_765943_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	44.8	5.8e-63
AUR61985.1|766013_767147_-	GTPase Obg	NA	NA	NA	NA	NA
AUR61986.1|767296_767557_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
AUR61987.1|767590_767902_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AUR61988.1|768326_769475_+	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AUR61989.1|769589_770555_+	octaprenyl diphosphate synthase	NA	NA	NA	NA	NA
AUR61990.1|770823_771690_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR61991.1|771820_773869_+	hydantoinase	NA	NA	NA	NA	NA
AUR61992.1|773886_775884_+	hydantoin utilization protein B	NA	NA	NA	NA	NA
AUR61993.1|775918_777256_+	amino acid deaminase	NA	NA	NA	NA	NA
AUR61994.1|779426_780908_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUR61995.1|780923_781481_-	lysine acyltransferase	NA	NA	NA	NA	NA
AUR64691.1|781593_781773_+	hypothetical protein	NA	NA	NA	NA	NA
AUR61996.1|781857_787080_+	hemolysin	NA	NA	NA	NA	NA
AUR61997.1|787157_789296_+	peptidase C39	NA	W8CYL7	Bacillus_phage	29.2	2.7e-45
AUR61998.1|789292_790615_+	hemolysin D	NA	NA	NA	NA	NA
AUR61999.1|790616_792041_+	CyaE	NA	NA	NA	NA	NA
AUR62000.1|792131_793040_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR62001.1|793104_794019_+	ABC transporter	NA	NA	NA	NA	NA
AUR62002.1|794425_794659_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62003.1|794856_795540_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUR62004.1|795571_796300_+	arginine transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	42.4	3.4e-32
AUR62005.1|796329_797190_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
AUR62006.1|797197_797764_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62007.1|797852_798809_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR62008.1|798853_799606_-	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AUR62009.1|799602_801348_-	acetolactate synthase catalytic subunit	NA	NA	NA	NA	NA
AUR62010.1|801432_802167_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR62011.1|802483_803506_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AUR64692.1|803521_804157_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR62012.1|804388_805396_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
AUR62013.1|805436_806969_-	acetyl-CoA synthetase	NA	NA	NA	NA	NA
AUR62014.1|806965_808084_-	deacylase	NA	NA	NA	NA	NA
AUR62015.1|808080_808863_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR62016.1|808874_809738_-	ABC transporter	NA	G3M9Y6	Bacillus_virus	38.9	9.6e-34
AUR64693.1|809756_810854_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62017.1|810922_811849_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62018.1|811883_813578_-	acetolactate synthase	NA	NA	NA	NA	NA
AUR62019.1|813777_814671_-	mechanosensitive ion channel protein	NA	NA	NA	NA	NA
AUR62020.1|814818_815769_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR62021.1|815867_816524_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62022.1|816671_819380_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.0	2.8e-15
AUR62023.1|819389_820409_+	fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	35.7	1.5e-49
AUR62024.1|820405_821356_-|integrase	integrase	integrase	NA	NA	NA	NA
821400:821502	attR	GTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACACCTAGCCGGCGCGCGCCAGCAGCACCACCACGTTGGCGGCAATCCCTTC	NA	NA	NA	NA
>prophage 7
CP013867	Bordetella pertussis strain J365, complete genome	4082563	859799	913930	4082563	integrase,holin,transposase	Vibrio_phage(25.0%)	44	868090:868109	917205:917224
AUR62057.1|859799_861758_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	30.3	8.0e-28
AUR62058.1|861840_862791_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR62059.1|863011_863680_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR62060.1|863803_864910_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUR62061.1|864922_868036_+	acriflavine resistance protein B	NA	S5VTK5	Leptospira_phage	21.5	4.5e-57
AUR62062.1|868032_869526_+	RND transporter	NA	NA	NA	NA	NA
868090:868109	attL	CTGGCGCTGGCCGGCTGCGC	NA	NA	NA	NA
AUR62063.1|869540_870212_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR64697.1|870255_870708_-	azurin	NA	NA	NA	NA	NA
AUR62064.1|870890_871538_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR64698.1|871641_873690_+	hydantoinase	NA	NA	NA	NA	NA
AUR62065.1|873686_875699_+	hydantoin utilization protein B	NA	NA	NA	NA	NA
AUR62066.1|875724_877059_+	hypothetical protein	NA	NA	NA	NA	NA
AUR62067.1|877167_878160_+	hypothetical protein	NA	NA	NA	NA	NA
AUR62068.1|878226_880311_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62069.1|880335_881307_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62070.1|881435_882467_-	peptidase M14	NA	NA	NA	NA	NA
AUR62071.1|882470_883622_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
AUR62072.1|883825_884716_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR62073.1|884793_885618_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUR64699.1|885814_886831_-|transposase	transposase	transposase	NA	NA	NA	NA
AUR62074.1|887027_888011_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR62075.1|888069_889197_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AUR62076.1|889187_889562_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62077.1|889609_890998_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62078.1|891028_892018_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62079.1|892128_893361_-	methylaspartate ammonia-lyase	NA	NA	NA	NA	NA
AUR62080.1|893642_894443_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR62081.1|894465_896697_-|holin	choline transporter	holin	NA	NA	NA	NA
AUR62082.1|897484_897931_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AUR62083.1|897952_898699_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
AUR62084.1|898842_899820_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
AUR62085.1|900519_901065_+	hypothetical protein	NA	K4HZX4	Acidithiobacillus_phage	30.5	3.0e-09
AUR62086.1|901058_902276_-	threonine dehydratase	NA	NA	NA	NA	NA
AUR62087.1|902416_903367_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR62088.1|903363_904083_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62089.1|904203_906363_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
AUR62090.1|906453_906723_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
AUR64700.1|907016_907544_+	hypothetical protein	NA	NA	NA	NA	NA
AUR62091.1|907562_908342_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AUR62092.1|908509_909526_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AUR62093.1|909598_910090_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
AUR62094.1|910100_911816_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
AUR62095.1|912286_912898_+	hypothetical protein	NA	NA	NA	NA	NA
AUR62096.1|912979_913930_+|integrase	integrase	integrase	NA	NA	NA	NA
917205:917224	attR	CTGGCGCTGGCCGGCTGCGC	NA	NA	NA	NA
>prophage 8
CP013867	Bordetella pertussis strain J365, complete genome	4082563	938429	1000578	4082563	integrase,transposase	Bacillus_virus(15.38%)	57	930186:930204	1003955:1003973
930186:930204	attL	CGCCCGCCTGCTGGGCGTG	NA	NA	NA	NA
AUR62117.1|938429_939332_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR62118.1|939328_939712_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUR62119.1|939766_941581_-	metal ABC transporter permease	NA	W8CYL7	Bacillus_phage	27.9	5.7e-44
AUR64702.1|941730_942558_+	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	47.4	1.7e-67
AUR62120.1|942603_943584_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUR62121.1|943580_943793_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62122.1|943789_944971_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62123.1|945134_945869_+	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	49.2	1.9e-62
AUR62124.1|945870_948483_-	penicillin-binding protein	NA	NA	NA	NA	NA
AUR62125.1|948618_950532_-	peptidase	NA	NA	NA	NA	NA
AUR62126.1|951147_951558_-	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
AUR62127.1|951655_952741_+	DNA polymerase IV	NA	NA	NA	NA	NA
AUR62128.1|952839_953790_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR62129.1|953786_954761_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62130.1|954885_955797_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.6	4.4e-05
AUR64703.1|956073_956466_-	hypothetical protein	NA	A0A0R6PJ17	Moraxella_phage	45.0	4.8e-25
AUR62131.1|956595_957546_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR62132.1|957575_957758_-	hypothetical protein	NA	A0A1L2JY37	Aeribacillus_phage	56.1	3.7e-12
AUR62133.1|958530_959712_-	MFS transporter	NA	NA	NA	NA	NA
AUR62134.1|959927_960605_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AUR62135.1|960601_961327_-	bifunctional 3-demethylubiquinol 3-O-methyltransferase/2-polyprenyl-6-hydroxyphenol methylase	NA	NA	NA	NA	NA
AUR62136.1|961452_962034_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62137.1|962404_965086_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.5	3.2e-104
AUR64704.1|965088_966219_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	44.0	4.9e-78
AUR62138.1|966211_967297_+	chorismate mutase	NA	NA	NA	NA	NA
AUR62139.1|967383_968283_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
AUR62140.1|968279_969608_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUR62141.1|969622_970294_+	cytidylate kinase	NA	NA	NA	NA	NA
AUR62142.1|970481_972197_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
AUR62143.1|972198_972558_+	integration host factor subunit beta	NA	NA	NA	NA	NA
AUR62144.1|972749_973064_+	hypothetical protein	NA	NA	NA	NA	NA
AUR62145.1|973106_974327_+	hypothetical protein	NA	NA	NA	NA	NA
AUR62146.1|974323_975265_+	hypothetical protein	NA	A0A2H4N7X4	Lake_Baikal_phage	28.1	1.5e-16
AUR62147.1|975261_976251_+	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	E3SJ87	Synechococcus_phage	34.4	2.2e-26
AUR64705.1|976540_976870_+	hypothetical protein	NA	NA	NA	NA	NA
AUR62148.1|976968_977919_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR62149.1|977999_978911_+	cysteine synthase	NA	A0A1X9I5K7	Streptococcus_phage	38.8	8.0e-47
AUR62150.1|978971_980117_-	murein transglycosylase	NA	NA	NA	NA	NA
AUR62151.1|980136_981051_+	deacetylase	NA	A0A2K9KZC4	Tupanvirus	34.7	9.8e-45
AUR62152.1|981122_981872_+	electron transporter RnfB	NA	NA	NA	NA	NA
AUR62153.1|981871_982801_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AUR62154.1|983044_984871_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR62155.1|984953_985595_+	peroxidase	NA	NA	NA	NA	NA
AUR62156.1|985784_986819_+	sulfate transporter subunit	NA	NA	NA	NA	NA
AUR62157.1|986834_987038_+	hypothetical protein	NA	NA	NA	NA	NA
AUR62158.1|987059_987734_+	sulfate ABC transporter permease	NA	NA	NA	NA	NA
AUR62159.1|987848_988631_+	sulfate ABC transporter permease	NA	NA	NA	NA	NA
AUR62160.1|988655_989720_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	3.8e-24
AUR64706.1|990517_991426_+	sulfate adenylyltransferase	NA	NA	NA	NA	NA
AUR62161.1|992913_994188_+	radical SAM protein	NA	NA	NA	NA	NA
AUR62162.1|994341_994722_+	hypothetical protein	NA	NA	NA	NA	NA
AUR62163.1|994729_995602_-	multidrug DMT transporter permease	NA	NA	NA	NA	NA
AUR62164.1|995907_996288_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AUR62165.1|996537_997224_+	coenzyme A pyrophosphatase	NA	NA	NA	NA	NA
AUR62166.1|997319_998222_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR62167.1|998374_999424_+	aldo/keto reductase	NA	NA	NA	NA	NA
AUR64707.1|999561_1000578_-|transposase	transposase	transposase	NA	NA	NA	NA
1003955:1003973	attR	CACGCCCAGCAGGCGGGCG	NA	NA	NA	NA
>prophage 9
CP013867	Bordetella pertussis strain J365, complete genome	4082563	1024382	1071934	4082563	integrase,tRNA,transposase	Yellowstone_lake_phycodnavirus(20.0%)	43	1011016:1011045	1049554:1049583
1011016:1011045	attL	GGTGCCAGTCCCCCTGCGGGGACAGGCACC	NA	NA	NA	NA
AUR62181.1|1024382_1025285_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR62182.1|1025431_1026334_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR62183.1|1026480_1027431_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR62184.1|1027529_1028270_-	16S rRNA methyltransferase	NA	NA	NA	NA	NA
AUR62185.1|1028464_1030501_+	transketolase	NA	NA	NA	NA	NA
AUR62186.1|1030518_1031529_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AUR62187.1|1031646_1032840_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
AUR62188.1|1032869_1033643_-	enoyl-ACP reductase	NA	NA	NA	NA	NA
AUR62189.1|1033639_1034830_-	acetate kinase	NA	NA	NA	NA	NA
AUR62190.1|1034855_1035794_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AUR64710.1|1035790_1038139_-	3-hydroxyalkanoate synthetase	NA	NA	NA	NA	NA
AUR62191.1|1038293_1038935_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUR62192.1|1040448_1040997_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUR62193.1|1041015_1041501_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AUR62194.1|1041678_1042617_+	cytochrome C biogenesis protein	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	24.1	5.6e-11
AUR62195.1|1042619_1042937_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AUR62196.1|1042982_1043927_+	hypothetical protein	NA	NA	NA	NA	NA
AUR62197.1|1045607_1046258_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
AUR62198.1|1046311_1046647_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64711.1|1046661_1047504_+	peptidase	NA	A0A292GJG6	Xanthomonas_phage	36.1	2.6e-15
AUR62199.1|1047520_1047802_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62200.1|1047875_1048139_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AUR62201.1|1048382_1049333_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR62202.1|1049631_1050369_-	flagellar biosynthesis sigma factor	NA	NA	NA	NA	NA
1049554:1049583	attR	GGTGCCTGTCCCCGCAGGGGGACTGGCACC	NA	NA	NA	NA
AUR62203.1|1050804_1051128_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR62204.1|1051162_1051723_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR62205.1|1051843_1052719_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
AUR62206.1|1052731_1053679_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
AUR62207.1|1053780_1054074_+	two-component system response regulator	NA	NA	NA	NA	NA
AUR62208.1|1054100_1056158_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
AUR62209.1|1056172_1056673_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
AUR62210.1|1056746_1058453_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	1.4e-12
AUR62211.1|1059316_1060369_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
AUR62212.1|1060421_1060811_+	two-component system response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	33.3	5.7e-10
AUR62213.1|1060819_1061452_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
AUR64712.1|1061551_1062568_-|transposase	transposase	transposase	NA	NA	NA	NA
AUR64713.1|1063398_1064406_+	aldo/keto reductase	NA	NA	NA	NA	NA
AUR62214.1|1064402_1066046_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
AUR62215.1|1066042_1066930_-	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
AUR62216.1|1067070_1067544_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
AUR62217.1|1067533_1068556_-	phosphate starvation-inducible protein PhoH	NA	A0A0S0MVD6	Pseudomonas_phage	45.4	8.7e-50
AUR62218.1|1068552_1069980_-|tRNA	tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase MiaB	tRNA	NA	NA	NA	NA
AUR64714.1|1070917_1071934_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
CP013867	Bordetella pertussis strain J365, complete genome	4082563	1382433	1448882	4082563	integrase,transposase	uncultured_Caudovirales_phage(40.0%)	58	1414398:1414457	1448883:1449032
AUR62453.1|1382433_1383384_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR62454.1|1383449_1383629_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62455.1|1383745_1384501_-	permease	NA	NA	NA	NA	NA
AUR62456.1|1384487_1385633_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62457.1|1386540_1387491_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR62458.1|1387481_1387682_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62459.1|1387678_1388881_-	cardiolipin synthase B	NA	NA	NA	NA	NA
AUR62460.1|1388877_1389636_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62461.1|1390053_1390662_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AUR62462.1|1391617_1394218_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AUR62463.1|1394205_1397625_-	nuclease	NA	NA	NA	NA	NA
AUR62464.1|1397632_1398538_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR64744.1|1398676_1399255_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
AUR62465.1|1399251_1400163_+	malyl-CoA thiolesterase	NA	NA	NA	NA	NA
AUR64745.1|1400176_1400857_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR62466.1|1401058_1403098_+	acetyl-CoA synthetase	NA	NA	NA	NA	NA
AUR62467.1|1403116_1404103_+	hypothetical protein	NA	NA	NA	NA	NA
AUR62468.1|1404128_1404926_+	citryl-CoA lyase	NA	NA	NA	NA	NA
AUR62469.1|1404922_1406116_+	formyl-CoA transferase	NA	NA	NA	NA	NA
AUR62470.1|1406112_1407075_+	hypothetical protein	NA	NA	NA	NA	NA
AUR62471.1|1407092_1408133_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUR62472.1|1408120_1408729_-	isopropylmalate isomerase	NA	NA	NA	NA	NA
AUR62473.1|1410317_1411313_+	hypothetical protein	NA	NA	NA	NA	NA
AUR62474.1|1411332_1412511_+	mandelate racemase	NA	NA	NA	NA	NA
AUR62475.1|1412521_1413439_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AUR62476.1|1413494_1414445_-|integrase	integrase	integrase	NA	NA	NA	NA
1414398:1414457	attL	TTCGAGTCGACGTAGGAAGGTCAATCGGGCATGCTTATGGGTGTTCATCCGGCCGGGCTC	NA	NA	NA	NA
AUR62477.1|1414543_1415314_-	ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	9.8e-30
AUR62478.1|1415310_1415991_-	cysteine ABC transporter permease	NA	NA	NA	NA	NA
AUR62479.1|1416057_1416846_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR64746.1|1417092_1418109_-|transposase	transposase	transposase	NA	NA	NA	NA
AUR62480.1|1418414_1419569_+	flagellar biosynthetic protein FlhB	NA	NA	NA	NA	NA
AUR62481.1|1424074_1424557_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62482.1|1424574_1424865_-	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
AUR64747.1|1424991_1425702_-	flagellar biosynthesis protein FlgA	NA	NA	NA	NA	NA
AUR62483.1|1425885_1426293_+	flagellar biosynthesis protein FlgB	NA	NA	NA	NA	NA
AUR62484.1|1426305_1426725_+	flagellar basal-body rod protein FlgC	NA	NA	NA	NA	NA
AUR62485.1|1426772_1427477_+	flagellar basal body rod modification protein	NA	NA	NA	NA	NA
AUR62486.1|1427542_1428964_+	flagellar biosynthesis protein FlgE	NA	NA	NA	NA	NA
AUR62487.1|1429002_1429767_+	flagellar biosynthesis protein FlgF	NA	NA	NA	NA	NA
AUR62488.1|1429810_1430596_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
AUR62489.1|1430595_1431285_+	flagellar basal body L-ring protein	NA	NA	NA	NA	NA
AUR62490.1|1431287_1432421_+	flagellar biosynthesis protein FlgI	NA	NA	NA	NA	NA
AUR62491.1|1432438_1433461_+	flagellar biosynthesis protein FlgJ	NA	A0A088F6W1	Sulfitobacter_phage	31.4	1.9e-12
AUR62492.1|1433530_1435177_+	flagellar biosynthesis protein FlgK	NA	NA	NA	NA	NA
AUR62493.1|1435210_1436743_+	flagellar biosynthesis protein FlgL	NA	NA	NA	NA	NA
AUR62494.1|1436821_1438642_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.6	6.4e-11
AUR62495.1|1438762_1440382_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.3	1.5e-08
AUR62496.1|1440560_1442003_+	chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	41.8	1.0e-35
AUR64748.1|1442219_1443236_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR62497.1|1443282_1444071_-	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
AUR62498.1|1444093_1444363_-	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
AUR62499.1|1444379_1445168_-	flagellar biosynthesis protein flip	NA	NA	NA	NA	NA
AUR62500.1|1445179_1445521_-	flagellar assembly protein FliO	NA	NA	NA	NA	NA
AUR62501.1|1445531_1446032_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AUR62502.1|1446024_1447035_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AUR62503.1|1447037_1447610_-	flagellar basal body protein FliL	NA	NA	NA	NA	NA
AUR62504.1|1447751_1447964_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62505.1|1447979_1448882_-|integrase	integrase	integrase	NA	NA	NA	NA
1448883:1449032	attR	TTCGAGTCGACGTAGGAAGGTCAATCGGGCATGCTTATGGGTGTTCATCCGGCCGGGCTCCTTGAGTGAACTGGGGGGGTGGCGATTTCCAGTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACACCTAG	NA	NA	NA	NA
>prophage 11
CP013867	Bordetella pertussis strain J365, complete genome	4082563	1477101	1515692	4082563	protease,integrase	Emiliania_huxleyi_virus(14.29%)	35	1485394:1485411	1518376:1518393
AUR62531.1|1477101_1478436_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AUR62532.1|1478488_1480825_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AUR64751.1|1480950_1481514_+	outer membrane protein chaperone	NA	NA	NA	NA	NA
AUR62533.1|1481522_1482614_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AUR62534.1|1482685_1483141_+	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ	NA	NA	NA	NA	NA
AUR62535.1|1483141_1483936_+	acyl-[acyl-carrier-protein]--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AUR62536.1|1483932_1485114_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AUR62537.1|1485100_1485706_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	40.2	8.8e-26
1485394:1485411	attL	CGCCGTGGCCGGCCTGGC	NA	NA	NA	NA
AUR62538.1|1485702_1486476_+	RNA methyltransferase	NA	NA	NA	NA	NA
AUR62539.1|1486487_1487315_-	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AUR62540.1|1487476_1489840_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.9	2.2e-165
AUR62541.1|1489907_1490627_-	glutamine amidotransferase	NA	NA	NA	NA	NA
AUR62542.1|1490750_1491176_+	NfeD-like family protein 1	NA	NA	NA	NA	NA
AUR62543.1|1491210_1492113_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR62544.1|1492278_1493205_+	stomatin 2	NA	NA	NA	NA	NA
AUR62545.1|1493270_1494428_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.2	2.3e-14
AUR62546.1|1494408_1494876_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	45.1	6.2e-27
AUR62547.1|1495023_1495974_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR62548.1|1495990_1496425_+	cyclase	NA	NA	NA	NA	NA
AUR62549.1|1496414_1496765_+	electron transporter	NA	NA	NA	NA	NA
AUR62550.1|1496961_1498116_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR62551.1|1498112_1499285_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR62552.1|1499332_1500226_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
AUR62553.1|1500271_1500709_+	thioesterase	NA	NA	NA	NA	NA
AUR62554.1|1500768_1501458_+	hypothetical protein	NA	NA	NA	NA	NA
AUR62555.1|1501467_1502370_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR62556.1|1502516_1503467_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR62557.1|1503565_1504528_-	transaldolase	NA	H6WFR1	Cyanophage	29.2	7.5e-11
AUR62558.1|1504754_1505909_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.4	3.3e-53
AUR62559.1|1505919_1509162_+	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
AUR62560.1|1510184_1510829_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
AUR62561.1|1510839_1511739_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR62562.1|1511786_1512872_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	6.4e-27
AUR62563.1|1512868_1514563_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR62564.1|1514741_1515692_+|integrase	integrase	integrase	NA	NA	NA	NA
1518376:1518393	attR	CGCCGTGGCCGGCCTGGC	NA	NA	NA	NA
>prophage 13
CP013867	Bordetella pertussis strain J365, complete genome	4082563	1657126	1728232	4082563	integrase	Ectocarpus_siliculosus_virus(11.11%)	55	1679223:1679241	1732803:1732821
AUR62690.1|1657126_1658077_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR62691.1|1658098_1659319_+	YggW family oxidoreductase	NA	NA	NA	NA	NA
AUR62692.1|1659504_1660917_+	glutamine synthetase	NA	NA	NA	NA	NA
AUR62693.1|1660980_1662048_+	PAS domain-containing sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.5	1.1e-05
AUR62694.1|1662047_1663535_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
AUR64759.1|1663544_1664489_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR62695.1|1664648_1665347_+	quercetin 2,3-dioxygenase	NA	NA	NA	NA	NA
AUR62696.1|1665424_1666330_+	pirin	NA	NA	NA	NA	NA
AUR62697.1|1666349_1667252_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR62698.1|1667398_1668193_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	29.4	8.3e-16
AUR62699.1|1668197_1669868_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AUR62700.1|1669991_1671041_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR62701.1|1671362_1672139_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AUR62702.1|1672203_1673106_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR62703.1|1674399_1675203_+	2,5-diketo-D-gluconic acid reductase	NA	A0A2H4PQR8	Staphylococcus_phage	32.4	2.0e-33
AUR62704.1|1677896_1678283_+	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AUR62705.1|1678298_1680389_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
1679223:1679241	attL	GCCATCGCCGCCGCGCAGG	NA	NA	NA	NA
AUR62706.1|1680440_1681394_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	26.5	7.2e-14
AUR64760.1|1681408_1682296_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR62707.1|1682433_1683960_+	methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUR64761.1|1684058_1684559_+	DNA starvation/stationary phase protection protein	NA	W5S6G8	Pithovirus	35.5	6.4e-14
AUR62708.1|1684882_1686838_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
AUR62709.1|1687005_1689090_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64762.1|1689116_1689542_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62710.1|1690757_1691528_+	polyhydroxyalkanoate biosynthesis repressor PhaR	NA	NA	NA	NA	NA
AUR62711.1|1691527_1692268_+	sugar ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUR62712.1|1692309_1693479_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
AUR62713.1|1693510_1695595_+	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AUR62714.1|1695591_1696482_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
AUR62715.1|1696478_1697576_+	capsule biosynthesis protein CapA	NA	NA	NA	NA	NA
AUR62716.1|1697598_1698888_+	Vi polysaccharide biosynthesis protein VipA/TviB	NA	NA	NA	NA	NA
AUR62717.1|1698899_1699925_+	Vi polysaccharide biosynthesis protein VipB/TviC	NA	A0A2K9L4U8	Tupanvirus	44.2	4.7e-72
AUR62718.1|1699921_1701979_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
AUR62719.1|1701992_1703168_+	capsule biosynthesis protein CapA	NA	NA	NA	NA	NA
AUR62720.1|1703249_1704200_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR62721.1|1704258_1705032_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR62722.1|1705024_1706581_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
AUR62723.1|1706577_1707528_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR62724.1|1708854_1709457_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR62725.1|1709696_1710398_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUR62726.1|1710391_1711174_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.8	2.0e-09
AUR62727.1|1711358_1712309_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR62728.1|1712407_1713145_-	hypothetical protein	NA	A0A0S4KZH7	Pseudomonas_phage	46.6	4.1e-41
AUR62729.1|1713334_1714093_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR62730.1|1714139_1715129_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR62731.1|1715306_1716275_-	phenol degradation protein meta	NA	NA	NA	NA	NA
AUR62732.1|1717814_1718783_+	AAA family ATPase	NA	NA	NA	NA	NA
AUR62733.1|1718791_1719733_+	MoxR protein	NA	NA	NA	NA	NA
AUR64763.1|1720206_1721217_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64764.1|1721207_1722722_+	hypothetical protein	NA	NA	NA	NA	NA
AUR62734.1|1722718_1724065_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64765.1|1724067_1725102_+	haloacid dehalogenase	NA	NA	NA	NA	NA
AUR62735.1|1725151_1726777_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	52.2	2.0e-149
AUR62736.1|1726870_1727350_+	hypothetical protein	NA	NA	NA	NA	NA
AUR62737.1|1727329_1728232_-|integrase	integrase	integrase	NA	NA	NA	NA
1732803:1732821	attR	CCTGCGCGGCGGCGATGGC	NA	NA	NA	NA
>prophage 14
CP013867	Bordetella pertussis strain J365, complete genome	4082563	1749071	1810419	4082563	integrase,tRNA	uncultured_Caudovirales_phage(12.5%)	54	1787922:1787981	1811529:1811928
AUR62753.1|1749071_1750022_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR62754.1|1750130_1750319_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64769.1|1750315_1751038_-	NADPH-dependent FMN reductase	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	1.3e-87
AUR62755.1|1751476_1752664_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64770.1|1752667_1753018_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUR62756.1|1753251_1754664_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62757.1|1754767_1755739_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR62758.1|1755752_1756466_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR62759.1|1756470_1757388_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR62760.1|1757494_1757791_+	hypothetical protein	NA	NA	NA	NA	NA
AUR62761.1|1757889_1758840_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR62762.1|1759998_1762932_+	cation:proton antiporter	NA	NA	NA	NA	NA
AUR62763.1|1762931_1763276_+	cation:proton antiporter	NA	NA	NA	NA	NA
AUR62764.1|1763272_1764901_+	cation:proton antiporter	NA	NA	NA	NA	NA
AUR62765.1|1764900_1765377_+	pesticidal protein Cry1Ia	NA	NA	NA	NA	NA
AUR62766.1|1765376_1765658_+	cation:proton antiporter	NA	NA	NA	NA	NA
AUR62767.1|1765654_1765981_+	cation:proton antiporter	NA	NA	NA	NA	NA
AUR62768.1|1766136_1767087_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR62769.1|1767130_1767673_+	hypothetical protein	NA	NA	NA	NA	NA
AUR62770.1|1767770_1768619_+	hydrolase	NA	NA	NA	NA	NA
AUR64771.1|1768668_1769118_+	cytidine deaminase	NA	S4VYT2	Pandoravirus	38.2	2.0e-06
AUR62771.1|1769114_1770116_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
AUR62772.1|1770128_1770923_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR62773.1|1770971_1772873_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUR62774.1|1772869_1773493_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62775.1|1773619_1774744_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUR62776.1|1775124_1776729_+	ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	28.9	1.2e-53
AUR62777.1|1776884_1777661_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.2	1.2e-30
AUR62778.1|1777745_1778744_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR62779.1|1778740_1779514_+	ABC transporter permease	NA	NA	NA	NA	NA
AUR62780.1|1780498_1781449_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR62781.1|1781472_1781937_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A0K2FLI9	Brevibacillus_phage	32.4	3.9e-05
AUR62782.1|1782083_1783292_+	nitric oxide dioxygenase	NA	NA	NA	NA	NA
AUR62783.1|1783335_1783773_+	BadM/Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AUR62784.1|1783891_1785181_+	D-amino acid dehydrogenase small subunit	NA	NA	NA	NA	NA
AUR62785.1|1787921_1788824_-|integrase	integrase	integrase	NA	NA	NA	NA
1787922:1787981	attL	CTAGCTGTGAACTGTCAATAGGTTGTATTCGTCCAGGTTGAGTCTGGAGATGGGTACAGC	NA	NA	NA	NA
AUR62786.1|1788970_1789987_-	glycine cleavage system protein T	NA	NA	NA	NA	NA
AUR62787.1|1790165_1791200_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
AUR62788.1|1791196_1791823_+	thymidylate kinase	NA	A0A1L2BX49	Bacteriophage	35.1	1.6e-22
AUR62789.1|1791819_1792872_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
AUR62790.1|1792921_1793692_+	DNAase	NA	NA	NA	NA	NA
AUR62791.1|1793742_1794579_+	hypothetical protein	NA	NA	NA	NA	NA
AUR62792.1|1794774_1795515_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR62793.1|1795589_1796333_+	glutamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR62794.1|1796994_1797768_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	3.1e-31
AUR62795.1|1798905_1800195_+	glutamate dehydrogenase	NA	NA	NA	NA	NA
AUR62796.1|1801805_1803053_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
AUR62797.1|1803062_1804772_-	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	27.3	5.9e-35
AUR62798.1|1804768_1805707_-	citrate lyase subunit beta	NA	NA	NA	NA	NA
AUR62799.1|1805703_1806987_-	C4-dicarboxylate ABC transporter permease	NA	NA	NA	NA	NA
AUR62800.1|1806990_1807473_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUR62801.1|1807473_1808460_-	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR62802.1|1808632_1809352_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR62803.1|1809468_1810419_-|integrase	integrase	integrase	NA	NA	NA	NA
1811529:1811928	attR	GCTGTACCCATCTCCAGACTCAACCTGGACGAATACAACCTATTGACAGTTCACAGCTAGGCGTGCTGGGCCTGATCCTCGATCCGCTTTTCTCGATGCTGCCGCTGACGCGCGCCATCGGCGAGGTGACCTGGAGCGCCAACAACGAATTCCTGCTGGTCGCCATCCCGCTGTTCATCATGCTGGGCGAGGTGCTGCTGCGCGCCGGTTTTGCCGAACGCATGTATGCCGCCATGAGCCTGTAGCTGTCCTGGCTGCCGGGCGGGCTGATGCACGCCAACATCGGCGCCTCCACGCTGTTCTCCGCCACATCCGGCTCCAGCGTGGCCACCGCCGCCACGGTGGGCACGGTAGCGATCCCGCAGATCAAGAAGTACGGCTACAACGAGCCGCTGTTCCT	NA	NA	NA	NA
>prophage 15
CP013867	Bordetella pertussis strain J365, complete genome	4082563	1992653	2062305	4082563	integrase,tRNA	Staphylococcus_phage(16.67%)	58	2040629:2040654	2067452:2067477
AUR62932.1|1992653_1995311_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.0	3.3e-173
AUR64784.1|1995388_1996546_-	transporter	NA	NA	NA	NA	NA
AUR62933.1|1996587_1997100_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUR62934.1|1997222_1997660_-	DNA-binding protein	NA	NA	NA	NA	NA
AUR62935.1|1997984_1998887_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR62936.1|1999033_1999936_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR62937.1|2000189_2001995_+	sulfate transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.5	2.2e-19
AUR62938.1|2002108_2002276_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AUR62939.1|2002339_2002576_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AUR64785.1|2002944_2004096_-	transporter	NA	NA	NA	NA	NA
AUR62940.1|2005707_2006610_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR62941.1|2007061_2008063_+	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR62942.1|2008235_2009093_+	ABC transporter permease	NA	NA	NA	NA	NA
AUR62943.1|2009089_2010352_+	glycine/betaine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.6	6.8e-28
AUR62944.1|2010452_2010827_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AUR62945.1|2010899_2012087_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUR62946.1|2012171_2012942_+	spermidine synthase	NA	NA	NA	NA	NA
AUR62947.1|2013055_2013820_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR62948.1|2013770_2015072_+	malonyl-CoA decarboxylase	NA	NA	NA	NA	NA
AUR62949.1|2015068_2015875_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR62950.1|2017619_2018591_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR62951.1|2018747_2019260_+	superoxide dismutase	NA	Q9MC02	Salmonella_phage	52.3	1.8e-43
AUR62952.1|2019418_2020393_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR62953.1|2021393_2022188_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	25.7	5.1e-05
AUR64786.1|2022213_2023020_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AUR62954.1|2023130_2023721_+	hypothetical protein	NA	NA	NA	NA	NA
AUR62955.1|2023731_2024910_+	hypothetical protein	NA	NA	NA	NA	NA
AUR62956.1|2025012_2025387_+	DNA-binding protein	NA	NA	NA	NA	NA
AUR62957.1|2025639_2026971_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUR62958.1|2027037_2030268_+	acriflavine resistance protein B	NA	NA	NA	NA	NA
AUR62959.1|2031758_2032505_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AUR62960.1|2032589_2033051_+	ACP synthase	NA	NA	NA	NA	NA
AUR62961.1|2033088_2034147_+	beta-hexosaminidase	NA	NA	NA	NA	NA
AUR62962.1|2034109_2035939_+	excinuclease ABC subunit C	NA	NA	NA	NA	NA
AUR62963.1|2035978_2036551_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AUR62964.1|2036720_2037689_+	MFS transporter	NA	NA	NA	NA	NA
AUR62965.1|2037698_2038040_+	hypothetical protein	NA	NA	NA	NA	NA
AUR62966.1|2037975_2038797_-	preQ(1) synthase	NA	A0A2I7SAX1	Vibrio_phage	37.6	4.1e-42
AUR62967.1|2039115_2040438_+	isocitrate lyase	NA	NA	NA	NA	NA
2040629:2040654	attL	GTGCCTGTCCCCGCCGGGACAGGCAC	NA	NA	NA	NA
AUR62968.1|2040797_2041433_+	hypothetical protein	NA	NA	NA	NA	NA
AUR62969.1|2041392_2042295_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR62970.1|2043213_2044086_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR62971.1|2044163_2045303_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR62972.1|2045661_2046918_+	ring-hydroxylating oxygenase subunit alpha	NA	NA	NA	NA	NA
AUR62973.1|2046923_2047451_+	ring-hydroxylating dioxygenase subunit beta	NA	NA	NA	NA	NA
AUR62974.1|2047455_2048274_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR62975.1|2048273_2048996_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUR62976.1|2049017_2049332_+	2Fe-2S ferredoxin	NA	NA	NA	NA	NA
AUR62977.1|2049349_2050498_+	carnitine dehydratase	NA	NA	NA	NA	NA
AUR62978.1|2050528_2051404_-	esterase	NA	NA	NA	NA	NA
AUR62979.1|2051400_2052720_-	acyl--CoA ligase	NA	NA	NA	NA	NA
AUR62980.1|2052792_2053989_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUR62981.1|2053999_2055487_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62982.1|2055727_2057554_-	hypothetical protein	NA	NA	NA	NA	NA
AUR62983.1|2058081_2058981_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR62984.1|2059118_2060084_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR62985.1|2060182_2061133_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR62986.1|2061354_2062305_+|integrase	integrase	integrase	NA	NA	NA	NA
2067452:2067477	attR	GTGCCTGTCCCGGCGGGGACAGGCAC	NA	NA	NA	NA
>prophage 16
CP013867	Bordetella pertussis strain J365, complete genome	4082563	2073801	2116228	4082563	integrase,transposase	Erysipelothrix_phage(20.0%)	41	2107928:2107945	2117558:2117575
AUR63000.1|2073801_2074752_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63001.1|2074738_2075743_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63002.1|2075889_2076186_-	MFS transporter	NA	NA	NA	NA	NA
AUR63003.1|2076360_2077713_+	glutathione reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	2.9e-45
AUR64787.1|2077855_2078872_-|transposase	transposase	transposase	NA	NA	NA	NA
AUR64788.1|2080851_2081865_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AUR63004.1|2081951_2082857_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR63005.1|2083013_2083358_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63006.1|2083515_2083974_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
AUR63007.1|2083987_2086204_+	aldehyde oxidase	NA	NA	NA	NA	NA
AUR63008.1|2086200_2087262_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63009.1|2087290_2088265_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUR63010.1|2088216_2089035_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.8	2.3e-16
AUR63011.1|2089047_2089656_-	peptidase S16	NA	NA	NA	NA	NA
AUR63012.1|2089830_2090226_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63013.1|2090244_2091684_+	disulfide bond formation protein DsbA	NA	A0A0M3UL24	Mycobacterium_phage	37.4	7.4e-55
AUR63014.1|2091712_2092060_+	aldehyde-activating protein	NA	NA	NA	NA	NA
AUR63015.1|2092078_2092981_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR64789.1|2093103_2093583_+	acetyltransferase	NA	NA	NA	NA	NA
AUR63016.1|2093681_2094632_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR63017.1|2094715_2096533_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	2.3e-37
AUR63018.1|2096606_2097254_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63019.1|2097266_2098196_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63020.1|2098365_2098830_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63021.1|2099077_2099758_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR63022.1|2099806_2101498_+	sulfate transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.3	5.0e-42
AUR63023.1|2101513_2102065_-	ATPase	NA	NA	NA	NA	NA
AUR63024.1|2102061_2102433_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUR63025.1|2102545_2103382_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUR63026.1|2103392_2103872_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63027.1|2104014_2104194_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63028.1|2104323_2105298_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUR63029.1|2105428_2105785_+	RNA signal recognition particle	NA	NA	NA	NA	NA
AUR64790.1|2105774_2106650_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
AUR63030.1|2106748_2107633_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR63031.1|2107654_2108950_-	hypothetical protein	NA	NA	NA	NA	NA
2107928:2107945	attL	GCCCAGCGCCTGCAGGGC	NA	NA	NA	NA
AUR63032.1|2109898_2110549_+	NAD(P)H dehydrogenase	NA	NA	NA	NA	NA
AUR64791.1|2110636_2112157_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUR63033.1|2112414_2114280_+	AAA family ATPase	NA	NA	NA	NA	NA
AUR63034.1|2114363_2115227_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63035.1|2115325_2116228_-|integrase	integrase	integrase	NA	NA	NA	NA
2117558:2117575	attR	GCCCAGCGCCTGCAGGGC	NA	NA	NA	NA
>prophage 17
CP013867	Bordetella pertussis strain J365, complete genome	4082563	2122246	2175092	4082563	protease,integrase,tRNA	Klosneuvirus(25.0%)	49	2141524:2141541	2169275:2169292
AUR63042.1|2122246_2123149_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63043.1|2123363_2124338_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64792.1|2124334_2124478_+	cbb3-type cytochrome oxidase maturation protein	NA	NA	NA	NA	NA
AUR63044.1|2126099_2126762_+	peptidase S41	NA	NA	NA	NA	NA
AUR63045.1|2126764_2126941_+	cytochrome oxidase	NA	NA	NA	NA	NA
AUR63046.1|2126937_2127876_+	cytochrome oxidase subunit III	NA	NA	NA	NA	NA
AUR63047.1|2127967_2129458_+	cytochrome c oxidase accessory protein CcoG	NA	NA	NA	NA	NA
AUR63048.1|2129543_2129696_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63049.1|2129709_2129949_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63050.1|2130044_2130788_+	permease	NA	NA	NA	NA	NA
AUR64793.1|2130820_2131321_+	GCN5 family acetyltransferase	NA	NA	NA	NA	NA
AUR63051.1|2131419_2132343_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.6	1.6e-23
AUR63052.1|2132339_2133101_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUR64794.1|2133116_2134199_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63053.1|2134401_2135352_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR63054.1|2135498_2136401_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR63055.1|2137058_2137358_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63056.1|2137767_2140050_-	RNA polymerase sigma factor 70	NA	A0A2I7SAT0	Vibrio_phage	30.1	3.2e-36
AUR63057.1|2140735_2142766_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.9	1.0e-65
2141524:2141541	attL	GGCGCGCCAGCTCGCGTT	NA	NA	NA	NA
AUR63058.1|2142785_2142998_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AUR63059.1|2143275_2143815_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AUR63060.1|2143928_2145224_-	adenylosuccinate synthetase	NA	A0A160ER07	Powai_lake_megavirus	33.5	3.0e-63
AUR63061.1|2145300_2146458_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
AUR63062.1|2146641_2147541_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
AUR63063.1|2147559_2148864_-	HflK protein	NA	NA	NA	NA	NA
AUR63064.1|2148829_2149936_-	GTPase HflX	NA	NA	NA	NA	NA
AUR63065.1|2150023_2150260_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
AUR63066.1|2150398_2151469_-	histidinol-phosphate aminotransferase	NA	A0A1X6WGT4	Pacmanvirus	25.7	2.5e-15
AUR63067.1|2151472_2152828_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AUR64795.1|2152854_2154012_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AUR63068.1|2154017_2154656_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64796.1|2154657_2155953_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AUR63069.1|2156002_2157289_-	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase	NA	NA	NA	NA	NA
AUR63070.1|2157304_2157811_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63071.1|2157807_2158956_-	23S rRNA (adenine(2503)-C2)-methyltransferase	NA	NA	NA	NA	NA
AUR63072.1|2158983_2159409_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.2	2.1e-21
AUR63073.1|2159731_2162614_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	3.7e-138
AUR63074.1|2162706_2163462_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63075.1|2164227_2165577_+	histidine kinase	NA	NA	NA	NA	NA
AUR63076.1|2165723_2166626_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR63077.1|2166724_2167675_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR63078.1|2167748_2168222_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63079.1|2168247_2169456_+	class V aminotransferase	NA	NA	NA	NA	NA
2169275:2169292	attR	AACGCGAGCTGGCGCGCC	NA	NA	NA	NA
AUR63080.1|2169452_2170226_-|tRNA	tRNA (guanine-N1)-methyltransferase	tRNA	NA	NA	NA	NA
AUR63081.1|2170225_2170849_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUR63082.1|2171014_2171275_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUR63083.1|2171578_2172160_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63084.1|2172226_2172481_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63085.1|2172467_2175092_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.4	1.7e-81
>prophage 18
CP013867	Bordetella pertussis strain J365, complete genome	4082563	2202875	2258064	4082563	protease,integrase	Lake_Baikal_phage(25.0%)	52	2220008:2220067	2258065:2258209
AUR63106.1|2202875_2203826_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63107.1|2204026_2204836_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR63108.1|2205008_2205911_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR63109.1|2205907_2206801_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AUR63110.1|2206925_2207120_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AUR63111.1|2207119_2207461_-	2Fe-2S ferredoxin	NA	NA	NA	NA	NA
AUR63112.1|2207470_2209333_-	molecular chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.4	3.0e-101
AUR63113.1|2209462_2209975_-	co-chaperone HscB	NA	NA	NA	NA	NA
AUR63114.1|2209977_2210301_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	52.8	6.8e-25
AUR63115.1|2210302_2210713_-	scaffolding protein	NA	A0A218MKD1	uncultured_virus	79.0	7.5e-53
AUR63116.1|2210750_2211962_-	cysteine desulfurase	NA	NA	NA	NA	NA
AUR63117.1|2211979_2212492_-	DNA-binding protein	NA	NA	NA	NA	NA
AUR63118.1|2212707_2213199_-	protein tyrosine phosphatase	NA	NA	NA	NA	NA
AUR63119.1|2213451_2215488_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AUR63120.1|2215565_2216768_+	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AUR63121.1|2216896_2217547_+	LexA family transcriptional regulator	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	3.3e-10
AUR63122.1|2217773_2218703_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AUR63123.1|2218748_2219108_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63124.1|2219104_2220007_-|integrase	integrase	integrase	NA	NA	NA	NA
2220008:2220067	attL	TTCGAGTCGACGTAGGAAGGTCAATCGGGCATGCTTATGGGTGTTCATCCGGCCGGGCTC	NA	NA	NA	NA
AUR63125.1|2220625_2220838_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63126.1|2220855_2221587_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63127.1|2221621_2222263_-	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUR63128.1|2222255_2222924_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUR63129.1|2225136_2225913_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUR63130.1|2225934_2227092_-	thiolase	NA	NA	NA	NA	NA
AUR63131.1|2227088_2227520_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63132.1|2227516_2228314_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR63133.1|2228333_2228789_-	oxidoreductase	NA	NA	NA	NA	NA
AUR63134.1|2228801_2229773_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR63135.1|2229838_2231062_-	CoA-transferase	NA	NA	NA	NA	NA
AUR63136.1|2231289_2232240_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR63137.1|2232364_2234818_-	DNA-binding protein	NA	A0A0R6PGP8	Moraxella_phage	52.0	1.5e-220
AUR63138.1|2235006_2236311_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.8	3.2e-129
AUR63139.1|2236415_2237069_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	57.5	6.8e-56
AUR63140.1|2237071_2238382_-	trigger factor	NA	NA	NA	NA	NA
AUR63141.1|2238578_2239139_+	hypothetical protein	NA	K4K6D8	Caulobacter_phage	33.7	1.0e-23
AUR63142.1|2239250_2239451_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.4	7.4e-14
AUR63143.1|2239796_2240363_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63144.1|2240446_2240650_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.1	1.6e-16
AUR63145.1|2240956_2241277_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63146.1|2241318_2241600_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63147.1|2241674_2242931_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AUR63148.1|2243313_2243643_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63149.1|2245213_2246035_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AUR63150.1|2246034_2247174_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AUR63151.1|2247180_2248077_+	ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUR63152.1|2248091_2249999_+	ABC transporter	NA	A0A2K9L0W2	Tupanvirus	31.8	1.1e-66
AUR63153.1|2250358_2252971_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUR63154.1|2253023_2255324_-	DNA helicase II	NA	A7KV33	Bacillus_phage	35.9	9.9e-110
AUR63155.1|2255320_2256529_-	aminotransferase	NA	NA	NA	NA	NA
AUR63156.1|2256790_2257165_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63157.1|2257161_2258064_-|integrase	integrase	integrase	NA	NA	NA	NA
2258065:2258209	attR	TTCGAGTCGACGTAGGAAGGTCAATCGGGCATGCTTATGGGTGTTCATCCGGCCGGGCTCCTTGAGTGAACTGGGGGGGTGGCGATTTCCAGTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACA	NA	NA	NA	NA
>prophage 19
CP013867	Bordetella pertussis strain J365, complete genome	4082563	2261219	2315489	4082563	integrase,tRNA,transposase	Klosneuvirus(15.38%)	47	2258761:2258780	2325062:2325081
2258761:2258780	attL	GCGCGCGCCAGCCGCGCCGC	NA	NA	NA	NA
AUR63159.1|2261219_2264081_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.5	1.0e-71
AUR63160.1|2264083_2264590_+	signal peptidase II	NA	NA	NA	NA	NA
AUR63161.1|2264694_2265903_+	phosphopantothenate synthase	NA	Q9HH70	Methanothermobacter_phage	30.0	3.8e-36
AUR63162.1|2265904_2266843_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63163.1|2267004_2267478_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUR63164.1|2267474_2268425_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63165.1|2268535_2268976_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63166.1|2269104_2270334_-	lytic transglycosylase	NA	NA	NA	NA	NA
AUR63167.1|2270372_2271194_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63168.1|2271247_2272399_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63169.1|2272490_2272961_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63170.1|2275529_2278079_+	cyanophycin synthetase	NA	NA	NA	NA	NA
AUR63171.1|2278149_2280723_+	cyanophycin synthetase	NA	NA	NA	NA	NA
AUR63172.1|2280988_2281189_+	general stress protein CsbD	NA	NA	NA	NA	NA
AUR63173.1|2281220_2281382_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63174.1|2281439_2281778_+	phospholipid-binding protein	NA	NA	NA	NA	NA
AUR63175.1|2281926_2282829_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63176.1|2282975_2283878_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63177.1|2284700_2285369_+	arylesterase	NA	NA	NA	NA	NA
AUR64799.1|2285350_2287306_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUR63178.1|2287548_2288298_+	glycerophosphoryl diester phosphodiesterase	NA	A0A2H4PGQ5	Escherichia_phage	27.8	1.5e-14
AUR63179.1|2288310_2289174_+	competence protein ComJ	NA	NA	NA	NA	NA
AUR63180.1|2289177_2290593_-	dihydrolipoamide dehydrogenase	NA	NA	NA	NA	NA
AUR63181.1|2290726_2291455_-	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	56.8	9.6e-43
AUR63182.1|2291593_2291794_-	heavy metal transporter	NA	NA	NA	NA	NA
AUR63183.1|2291969_2292368_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AUR63184.1|2292391_2293792_-	23S rRNA methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	26.5	7.3e-31
AUR63185.1|2293910_2294663_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63186.1|2294951_2295551_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63187.1|2295655_2296435_-	3'-5' exonuclease	NA	NA	NA	NA	NA
AUR63188.1|2296431_2297316_-	peptidase	NA	A0A292GJG6	Xanthomonas_phage	49.5	4.6e-15
AUR63189.1|2297333_2298113_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.9	4.8e-32
AUR63190.1|2298097_2298856_-	stationary phase survival protein SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.2	1.4e-68
AUR64800.1|2298993_2299629_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUR64801.1|2299896_2300913_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR63191.1|2301010_2302051_-|tRNA	tRNA threonylcarbamoyl adenosine modification protein TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.3	6.1e-91
AUR63192.1|2302185_2303478_+	guanine permease	NA	A0A0R6PHV4	Moraxella_phage	36.0	1.7e-66
AUR63193.1|2304837_2305221_+	thioredoxin	NA	V9SJ74	Achromobacter_phage	25.8	8.1e-09
AUR63194.1|2305238_2305826_-	thymidylate synthase	NA	A0A1X9I5T8	Streptococcus_phage	35.8	4.7e-16
AUR63195.1|2305863_2306814_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63196.1|2306912_2307473_-	L-2,4-diaminobutyric acid acetyltransferase	NA	NA	NA	NA	NA
AUR63197.1|2307469_2308015_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUR63198.1|2308210_2309239_+	silent information regulator protein Sir2	NA	NA	NA	NA	NA
AUR63199.1|2309279_2310620_+	hypothetical protein	NA	A0A1V0SKB7	Klosneuvirus	22.8	8.8e-18
AUR63200.1|2310728_2311733_+	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR63201.1|2311839_2314440_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUR63202.1|2314586_2315489_+|integrase	integrase	integrase	NA	NA	NA	NA
2325062:2325081	attR	GCGCGCGCCAGCCGCGCCGC	NA	NA	NA	NA
>prophage 20
CP013867	Bordetella pertussis strain J365, complete genome	4082563	2354648	2418178	4082563	protease,integrase	uncultured_Caudovirales_phage(11.11%)	50	2381187:2381203	2419965:2419981
AUR63239.1|2354648_2355551_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR63240.1|2355852_2356329_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
AUR63241.1|2356952_2358590_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	8.8e-12
AUR63242.1|2358620_2359934_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	67.1	2.1e-149
AUR64808.1|2360094_2360385_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63243.1|2360485_2361808_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR63244.1|2361804_2362707_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63245.1|2362853_2363756_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63246.1|2363885_2364269_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63247.1|2364333_2365356_-	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR63248.1|2365384_2366206_-	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
AUR64809.1|2366231_2367929_-	phosphonate ABC transporter permease	NA	NA	NA	NA	NA
AUR63249.1|2367993_2369070_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.8	1.2e-28
AUR63250.1|2369229_2370093_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR63251.1|2370123_2370693_+	phosphohydrolase	NA	NA	NA	NA	NA
AUR63252.1|2370709_2371561_-	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
AUR63253.1|2372618_2373500_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
AUR63254.1|2373574_2374564_-	quinone oxidoreductase	NA	NA	NA	NA	NA
AUR63255.1|2374626_2375577_-	multidrug DMT transporter permease	NA	NA	NA	NA	NA
AUR63256.1|2375639_2376497_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63257.1|2376556_2377045_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUR63258.1|2378617_2379808_+	hemolysin D	NA	NA	NA	NA	NA
AUR63259.1|2379804_2381391_+	multidrug resistance protein B	NA	NA	NA	NA	NA
2381187:2381203	attL	CGGCGCCGGCATGTCGC	NA	NA	NA	NA
AUR63260.1|2381409_2382477_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
AUR64810.1|2382581_2384111_-	DNA-binding protein	NA	A0A1X9I5H2	Streptococcus_phage	25.4	3.0e-14
AUR63261.1|2384545_2386120_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR63262.1|2386227_2387244_+	ABC transporter permease	NA	NA	NA	NA	NA
AUR63263.1|2387240_2388080_+	ABC transporter permease	NA	NA	NA	NA	NA
AUR63264.1|2388090_2389722_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	2.7e-21
AUR63265.1|2389718_2390621_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63266.1|2390811_2392086_+	4-aminobutyrate aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.9	1.6e-24
AUR63267.1|2392115_2392406_+	cupin	NA	NA	NA	NA	NA
AUR64811.1|2392478_2393492_+	acetylpolyamine aminohydrolase	NA	A0A2K9L4C2	Tupanvirus	35.2	1.7e-42
AUR63268.1|2393511_2394774_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
AUR63269.1|2394776_2395700_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63270.1|2395696_2397190_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUR63271.1|2397200_2398133_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
AUR63272.1|2398350_2399640_+	aminotransferase	NA	A0A1C9EHH3	Mycobacterium_phage	22.5	1.8e-07
AUR64812.1|2399674_2401018_-	sodium:alanine symporter	NA	NA	NA	NA	NA
AUR63273.1|2401090_2402611_-	ATP-binding protein	NA	A0A248XCZ8	Klebsiella_phage	44.9	1.7e-78
AUR63274.1|2402765_2403497_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63275.1|2403594_2404905_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AUR63276.1|2404920_2405832_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AUR64813.1|2405828_2406416_+	nicotinate-nicotinamide nucleotide adenylyltransferase	NA	NA	NA	NA	NA
AUR63277.1|2406477_2406864_+	ribosome silencing factor	NA	NA	NA	NA	NA
AUR63278.1|2406875_2407346_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AUR63279.1|2407357_2407981_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AUR63280.1|2408001_2410749_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AUR63281.1|2417025_2417241_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63282.1|2417227_2418178_+|integrase	integrase	integrase	NA	NA	NA	NA
2419965:2419981	attR	CGGCGCCGGCATGTCGC	NA	NA	NA	NA
>prophage 21
CP013867	Bordetella pertussis strain J365, complete genome	4082563	2563119	2616703	4082563	protease,integrase,tRNA	Salmonella_phage(22.22%)	47	2600309:2600327	2624970:2624988
AUR63402.1|2563119_2564022_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63403.1|2564168_2564951_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
AUR63404.1|2565039_2566266_-	transporter	NA	NA	NA	NA	NA
AUR63405.1|2566991_2568377_+	alcaligin biosynthesis protein	NA	NA	NA	NA	NA
AUR63406.1|2568395_2569001_+	siderophore biosynthesis protein	NA	NA	NA	NA	NA
AUR63407.1|2568997_2570854_+	IucA/IucC family protein	NA	NA	NA	NA	NA
AUR63408.1|2570850_2571651_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63409.1|2571665_2572859_+	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUR63410.1|2572926_2573901_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR63411.1|2574023_2575247_+	multidrug transporter	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
AUR63412.1|2575357_2577562_+	porin	NA	NA	NA	NA	NA
AUR63413.1|2577856_2578516_+	antibiotic resistance protein	NA	NA	NA	NA	NA
AUR63414.1|2578523_2578730_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63415.1|2579068_2579824_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63416.1|2579839_2580001_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63417.1|2580094_2580610_+	hypothetical protein	NA	T1SAR8	Salmonella_phage	44.6	5.1e-06
AUR63418.1|2580882_2581200_+	virulence factor	NA	NA	NA	NA	NA
AUR63419.1|2581387_2581624_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63420.1|2581914_2583270_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.5	1.6e-83
AUR63421.1|2583316_2584657_-	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	38.9	1.6e-75
AUR63422.1|2584758_2585391_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUR63423.1|2585390_2587760_-	cell division protein FtsK	NA	S5VNE3	Mycobacterium_phage	48.0	7.6e-81
AUR63424.1|2587792_2588752_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	40.2	3.1e-57
AUR63425.1|2588738_2589425_+	DNA mismatch repair protein MutS	NA	NA	NA	NA	NA
AUR63426.1|2589421_2589754_+	multidrug transporter	NA	NA	NA	NA	NA
AUR63427.1|2589917_2590820_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR63428.1|2590966_2591869_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR63429.1|2591865_2593932_-	cation acetate symporter	NA	NA	NA	NA	NA
AUR63430.1|2593931_2594204_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63431.1|2594988_2596773_+	ATPase	NA	NA	NA	NA	NA
AUR63432.1|2596796_2598962_+	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	27.1	1.2e-24
AUR63433.1|2598972_2599572_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AUR63434.1|2599637_2602352_+	histidine kinase	NA	NA	NA	NA	NA
2600309:2600327	attL	CGAACTGGCGCTGCGCCGC	NA	NA	NA	NA
AUR63435.1|2602393_2603089_+	two-component system response regulator	NA	NA	NA	NA	NA
AUR63436.1|2603097_2604000_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63437.1|2604146_2605388_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63438.1|2605537_2606518_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63439.1|2606716_2607973_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	1.2e-11
AUR63440.1|2608175_2608601_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63441.1|2608642_2609005_-	cytochrome	NA	NA	NA	NA	NA
AUR63442.1|2609017_2609371_-	cytochrome C	NA	NA	NA	NA	NA
AUR63443.1|2609537_2610488_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR64824.1|2610580_2611468_+	ATP-binding protein	NA	NA	NA	NA	NA
AUR63444.1|2611489_2612662_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63445.1|2612665_2613208_-	acetyltransferase	NA	NA	NA	NA	NA
AUR63446.1|2613245_2613620_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63447.1|2613952_2616703_+|protease	zinc protease	protease	A0A2K9LA15	Tupanvirus	28.1	1.5e-19
2624970:2624988	attR	CGAACTGGCGCTGCGCCGC	NA	NA	NA	NA
>prophage 22
CP013867	Bordetella pertussis strain J365, complete genome	4082563	2690166	2730787	4082563	integrase,tRNA	Salmonella_phage(33.33%)	41	2686099:2686117	2731375:2731393
2686099:2686117	attL	GCGCCGTCGAGCAGCTTGC	NA	NA	NA	NA
AUR63512.1|2690166_2691069_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63513.1|2691227_2691410_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
AUR63514.1|2691509_2692103_-	twin-arginine translocation pathway signal	NA	NA	NA	NA	NA
AUR63515.1|2692289_2693381_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63516.1|2693880_2694291_-	transcriptional regulator	NA	NA	NA	NA	NA
AUR63517.1|2694349_2694679_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	42.2	2.7e-13
AUR63518.1|2694696_2697114_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUR63519.1|2697126_2698149_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.6	1.0e-26
AUR63520.1|2698223_2698583_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AUR63521.1|2698598_2698796_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AUR63522.1|2699131_2700034_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63523.1|2700276_2700726_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	S4TNT3	Salmonella_phage	67.2	3.7e-45
AUR63524.1|2700722_2701673_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63525.1|2701783_2703232_+	2-aminoadipate aminotransferase	NA	NA	NA	NA	NA
AUR63526.1|2703346_2703592_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63527.1|2703779_2704682_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR63528.1|2704926_2705640_-	methyltransferase type 11	NA	NA	NA	NA	NA
AUR63529.1|2705762_2705990_-	GCN5 family acetyltransferase	NA	NA	NA	NA	NA
AUR63530.1|2706284_2706923_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63531.1|2707031_2708066_+	hydrolase	NA	NA	NA	NA	NA
AUR63532.1|2708062_2708965_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63533.1|2709428_2709953_-	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	32.9	6.5e-09
AUR63534.1|2710424_2711486_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUR63535.1|2711569_2713204_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	2.9e-15
AUR63536.1|2713205_2714009_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUR63537.1|2714037_2714997_-	ABC transporter	NA	NA	NA	NA	NA
AUR63538.1|2715000_2716515_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR63539.1|2716551_2717556_-	peptidase M20	NA	NA	NA	NA	NA
AUR63540.1|2717987_2718458_-	histidine kinase	NA	NA	NA	NA	NA
AUR63541.1|2718493_2719105_-	RhtB family transporter	NA	NA	NA	NA	NA
AUR63542.1|2719135_2719759_-	transcriptional regulator	NA	NA	NA	NA	NA
AUR63543.1|2719839_2721372_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR63544.1|2721406_2722624_-	MFS transporter	NA	NA	NA	NA	NA
AUR63545.1|2722691_2723723_-	alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	27.8	1.8e-26
AUR63546.1|2723719_2724889_-	amine oxidase	NA	NA	NA	NA	NA
AUR63547.1|2724882_2725563_-	anti-sigma factor	NA	NA	NA	NA	NA
AUR63548.1|2725724_2726567_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR63549.1|2726729_2727701_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUR63550.1|2727872_2728751_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63551.1|2728773_2729844_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63552.1|2729884_2730787_-|integrase	integrase	integrase	NA	NA	NA	NA
2731375:2731393	attR	GCGCCGTCGAGCAGCTTGC	NA	NA	NA	NA
>prophage 23
CP013867	Bordetella pertussis strain J365, complete genome	4082563	2786300	2859170	4082563	integrase,tRNA,transposase	Moraxella_phage(16.67%)	59	2792312:2792371	2841996:2842092
AUR63597.1|2786300_2786717_-|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUR63598.1|2786827_2787460_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
AUR63599.1|2787488_2787932_+	6-carboxy-5,6,7,8-tetrahydropterin synthase	NA	NA	NA	NA	NA
AUR63600.1|2787953_2789045_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR64836.1|2789099_2789888_-	class II aldolase	NA	NA	NA	NA	NA
AUR63601.1|2790035_2790656_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUR63602.1|2790795_2791269_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
2792312:2792371	attL	TGTGAAGATTCAATAGGTTGTATGCATGGTTCATCCGAACCGGATTTGAGAAACTGGAAA	NA	NA	NA	NA
AUR63603.1|2792408_2793359_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR63604.1|2793355_2801017_-	adhesin	NA	A0A0R6PJK4	Moraxella_phage	30.9	7.3e-24
AUR63605.1|2801257_2805304_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	67.4	6.3e-160
AUR63606.1|2805661_2806198_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUR63607.1|2806194_2807493_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUR63608.1|2807572_2808601_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUR63609.1|2808909_2809812_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR63610.1|2809808_2810759_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63611.1|2811075_2811681_+	fimbrial protein	NA	NA	NA	NA	NA
AUR63612.1|2811734_2813048_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
AUR63613.1|2813122_2813593_-	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
AUR63614.1|2813592_2814381_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR63615.1|2814391_2816044_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUR63616.1|2816131_2817082_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR64837.1|2818243_2818750_-	phenylacetate-CoA oxygenase subunit PaaJ	NA	NA	NA	NA	NA
AUR63617.1|2818746_2819511_-	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
AUR63618.1|2819526_2819811_-	phenylacetate-CoA oxygenase subunit PaaB	NA	NA	NA	NA	NA
AUR63619.1|2819875_2820865_-	phenylacetate-CoA oxygenase	NA	NA	NA	NA	NA
AUR63620.1|2821036_2821966_+	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
AUR63621.1|2821937_2822624_-	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AUR63622.1|2822657_2823203_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	37.7	2.1e-26
AUR63623.1|2823247_2824513_+	peptidase M48	NA	NA	NA	NA	NA
AUR63624.1|2824509_2825412_+	GTPase RsgA	NA	NA	NA	NA	NA
AUR63625.1|2826593_2827538_-	peptide ABC transporter	NA	NA	NA	NA	NA
AUR63626.1|2827632_2829150_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR63627.1|2829191_2830820_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AUR63628.1|2830927_2831809_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR63629.1|2832069_2832297_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63630.1|2834921_2835296_+	endonuclease	NA	F4YXR7	Roseobacter_phage	54.4	2.1e-25
AUR63631.1|2835320_2835659_-	transcriptional regulator	NA	NA	NA	NA	NA
AUR63632.1|2835702_2837337_-	NAD synthetase	NA	A0A2L0UZF5	Agrobacterium_phage	36.6	8.3e-87
AUR63633.1|2837375_2838722_-	mechanosensitive ion channel protein MscS	NA	NA	NA	NA	NA
AUR64838.1|2838829_2840251_+	argininosuccinate lyase	NA	NA	NA	NA	NA
AUR63634.1|2840320_2840905_-	nitroreductase	NA	NA	NA	NA	NA
AUR63635.1|2841007_2841958_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63636.1|2842092_2843199_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
2841996:2842092	attR	TTTCCAGTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACATCTAGTCGTCTATCTTGTTGGGTTCAATAAGAAATAA	NA	NA	NA	NA
AUR63637.1|2843209_2844307_+	cyclic pyranopterin phosphate synthase MoaA	NA	NA	NA	NA	NA
AUR63638.1|2844451_2845657_-	molybdopterin biosynthesis protein MoeA	NA	NA	NA	NA	NA
AUR63639.1|2845663_2846185_-	molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
AUR64839.1|2846181_2846664_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
AUR63640.1|2846669_2846921_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
AUR63641.1|2846901_2847387_-	cyclic pyranopterin monophosphate synthase accessory protein	NA	NA	NA	NA	NA
AUR63642.1|2847522_2850984_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63643.1|2851001_2851886_+	carboxymethylenebutenolidase	NA	NA	NA	NA	NA
AUR63644.1|2851895_2852327_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64840.1|2852573_2853077_+	peroxiredoxin	NA	M1I839	Pelagibacter_phage	44.1	1.8e-24
AUR63645.1|2853154_2854555_+	MFS transporter	NA	NA	NA	NA	NA
AUR63646.1|2854629_2855505_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64841.1|2855501_2856509_-	biotin synthase	NA	NA	NA	NA	NA
AUR63647.1|2856976_2857282_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63648.1|2857372_2857963_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR64842.1|2858153_2859170_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
CP013867	Bordetella pertussis strain J365, complete genome	4082563	2862361	2929124	4082563	protease,integrase	uncultured_Mediterranean_phage(28.57%)	50	2873290:2873349	2929125:2929227
AUR63651.1|2862361_2863264_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR63652.1|2863410_2864313_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR63653.1|2864309_2865104_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
AUR63654.1|2865135_2865840_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUR63655.1|2865914_2866715_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63656.1|2866711_2867119_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
AUR63657.1|2867115_2867757_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AUR64843.1|2867749_2869750_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AUR63658.1|2871010_2872342_+	arabinose ABC transporter permease	NA	NA	NA	NA	NA
AUR63659.1|2872338_2873241_-|integrase	integrase	integrase	NA	NA	NA	NA
2873290:2873349	attL	CCGGCCGGGCTCCTTGAGTGAACTGGGGGGGTGGCGATTTCCAGTTTCTCAAATCCGGTT	NA	NA	NA	NA
AUR63660.1|2874995_2875262_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63661.1|2875969_2876308_+	transcriptional regulator	NA	NA	NA	NA	NA
AUR63662.1|2877636_2879916_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AUR63663.1|2880861_2881464_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR63664.1|2881560_2882850_+	MFS transporter	NA	NA	NA	NA	NA
AUR63665.1|2882907_2883639_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.4e-12
AUR63666.1|2883635_2884439_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.5	7.9e-14
AUR63667.1|2884435_2885524_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUR63668.1|2885520_2886450_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR63669.1|2886598_2887744_-	branched chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR63670.1|2887765_2888668_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63671.1|2889046_2892868_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUR63672.1|2893024_2893693_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63673.1|2893697_2895371_-	paraquat-inducible protein B	NA	NA	NA	NA	NA
AUR63674.1|2895389_2896709_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AUR63675.1|2896713_2899029_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	4.1e-164
AUR64844.1|2899084_2901253_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
AUR64845.1|2901249_2905815_-	alpha-2-macroglobulin	NA	NA	NA	NA	NA
AUR63676.1|2906528_2906843_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.8	1.2e-10
AUR63677.1|2907070_2907316_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	76.6	1.3e-20
AUR63678.1|2907437_2907929_+	hypothetical protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	4.8e-14
AUR63679.1|2908028_2909234_-	beta-ketoadipyl CoA thiolase	NA	NA	NA	NA	NA
AUR63680.1|2909349_2910747_-	chloride channel protein EriC	NA	NA	NA	NA	NA
AUR63681.1|2910863_2911442_-	superoxide dismutase	NA	NA	NA	NA	NA
AUR63682.1|2911514_2912906_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	32.0	1.4e-29
AUR63683.1|2913073_2914024_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63684.1|2914304_2914925_+	flagellar motor protein MotA	NA	NA	NA	NA	NA
AUR63685.1|2914921_2915335_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUR63686.1|2915331_2916375_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AUR63687.1|2916430_2916619_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63688.1|2916628_2917393_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AUR63689.1|2917483_2918140_+	adenylate kinase	NA	NA	NA	NA	NA
AUR63690.1|2918231_2918990_+	3-hydroxy-2-methylbutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR63691.1|2919015_2920617_+	murein biosynthesis protein MurJ	NA	NA	NA	NA	NA
AUR63692.1|2920817_2921822_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUR63693.1|2921922_2922186_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUR63694.1|2922303_2923080_-	5-keto-4-deoxy-D-glucarate aldolase	NA	NA	NA	NA	NA
AUR63695.1|2923670_2924621_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR63696.1|2927004_2928117_-	malate dehydrogenase	NA	NA	NA	NA	NA
AUR63697.1|2928173_2929124_-|integrase	integrase	integrase	NA	NA	NA	NA
2929125:2929227	attR	CCGGCCGGGCTCCTTGAGTGAACTGGGGGGGTGGCGATTTCCAGTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACAGCTAGG	NA	NA	NA	NA
>prophage 25
CP013867	Bordetella pertussis strain J365, complete genome	4082563	2951503	3003201	4082563	integrase	Staphylococcus_phage(25.0%)	45	2997647:2997706	3013784:3014822
AUR63720.1|2951503_2952367_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63721.1|2952562_2954035_-	magnesium transporter	NA	NA	NA	NA	NA
AUR63722.1|2954045_2954456_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUR63723.1|2954519_2955566_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63724.1|2955672_2956551_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR63725.1|2956564_2957761_-	amidohydrolase	NA	NA	NA	NA	NA
AUR63726.1|2957822_2959514_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	28.1	9.4e-33
AUR63727.1|2959510_2960413_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63728.1|2960581_2961478_-	inositol monophosphatase	NA	NA	NA	NA	NA
AUR63729.1|2963755_2965981_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AUR63730.1|2966145_2967234_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	8.7e-32
AUR63731.1|2967190_2967844_+	DL-methionine transporter permease subunit	NA	NA	NA	NA	NA
AUR63732.1|2967891_2968689_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR63733.1|2969268_2970171_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR63734.1|2970251_2971400_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUR63735.1|2971456_2972407_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63736.1|2972505_2972811_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AUR63737.1|2972839_2973274_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63738.1|2973275_2974520_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63739.1|2974516_2975227_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR64847.1|2975241_2976153_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63740.1|2976515_2976920_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63741.1|2976916_2977375_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63742.1|2977381_2978290_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64848.1|2978286_2979153_+	ABC transporter permease	NA	NA	NA	NA	NA
AUR63743.1|2979139_2979967_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUR63744.1|2979977_2981105_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	1.2e-23
AUR63745.1|2983462_2984725_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR63746.1|2984731_2985484_+	DNA-binding protein	NA	NA	NA	NA	NA
AUR63747.1|2985535_2985721_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64849.1|2985996_2986461_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AUR63748.1|2986540_2987152_+	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AUR63749.1|2987296_2989405_+	hypothetical protein	NA	NA	NA	NA	NA
AUR63750.1|2989401_2990352_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63751.1|2990455_2991076_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR64850.1|2991179_2991920_+	oxidoreductase	NA	NA	NA	NA	NA
AUR63752.1|2993054_2994179_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63753.1|2994224_2994593_-	hypothetical protein	NA	NA	NA	NA	NA
AUR63754.1|2994834_2995737_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR63755.1|2996820_2997363_-	hypothetical protein	NA	NA	NA	NA	NA
2997647:2997706	attL	CTAGCTGTGAAGATTCAATAGGTTGTATGCATGGTTCATCCGAACCGGATTTGAGAAACT	NA	NA	NA	NA
AUR63756.1|2997796_2998699_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR63757.1|2998695_2999604_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR63758.1|2999730_3000567_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0P0BXC9	Ostreococcus_lucimarinus_virus	33.3	1.6e-33
AUR63759.1|3001079_3002189_+	porin	NA	NA	NA	NA	NA
AUR63760.1|3002250_3003201_-|integrase	integrase	integrase	NA	NA	NA	NA
3013784:3014822	attR	AGTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACAGCTAGGGAACTGGCATTCATCATGGCTCCTTCAAACAATGGGATTCGACAGCATGACTCCACTGTAGACCTTGCCATGATTGGAAGGTCAAGCGTCCGCGGCGCGCGGCGCCGTGCGCCCTACGCCAGATGCGTGACGAAATAGATCTTCTTGACGTGGCGGTCCACTTCCCAGCGGCCGGTATAGCCTTCGGGCATGATGAAGGCGTCGCCCGCCTTGACCGCGTGGACCGTGCCGTCCGGGTCCACCAGGCGCGCCTCGCCCTCGATGATGTGGCAGTACTCGATGTAGCCGGTGGTGTTGGACTGGAAGCTGCCGCTGGTGCTCTCCCACACGCCGGACTCGACCTTCCCCTGCCCGCCCTCGAAGGCGGTCACCGTGCGAAACGACGCGTCGCCGGCTATGGGCCGGCTGGGCTTGCCCGCCACCGGGTTGATCATGGGGCCCGTATCGATGCGGACCAGGCGCGATTTGTCGTGTTGCGGCATGGGTTCCCTTTGCAAGTTCACTGGAAGGCCAGCGCCGCCACTGCGGCGCCCGGAATCGGACTATAGCCAATCACGGCTCCGACAGGCGCGGCGCGCCCGCCGCGGGCCTCTATATGCCTAAAGCGTATAAACACCAGCCTAAAATTTCATGGAAAACCCTAGTTTTAGTATGCGAAACTCAGGTCAAACTCCGTTCTGGAAAAAAAAAACTACTTTTCCGGGATTTCGCAGTTTTCATGAGCACGTTATTTCGCCGCGCGCCGCGTACCATCATTGCTGCCCGCGATTGACCTCGCACTCTACCGACCACGACACCATCGGCATGCCCAACCTGAACCTCAGCCTCGACCATACCGGATTGATCGTCTTCAAGCTGGAAGACGCGCGCCAGGCCTTCGAACGCCTGGGCTTCACCCTCACGCCGCGCAGCATGCACGCCGGCGCGCTGACCCCGGGCGGCCCGGTGGTGCCCTGGGGATCGGGCAACCATTGCGCC	NA	NA	NA	NA
>prophage 27
CP013867	Bordetella pertussis strain J365, complete genome	4082563	3384245	3504442	4082563	integrase,tRNA,transposase	Acinetobacter_phage(18.75%)	104	3396529:3396554	3506030:3506046
AUR64062.1|3384245_3385148_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR64063.1|3385552_3386197_-	urease accessory protein UreG	NA	NA	NA	NA	NA
AUR64064.1|3386221_3386806_-	Urease accessory protein UreF	NA	NA	NA	NA	NA
AUR64065.1|3386906_3387524_-	urease accessory protein UreE	NA	NA	NA	NA	NA
AUR64066.1|3387526_3389242_-	urease subunit alpha	NA	NA	NA	NA	NA
AUR64067.1|3389238_3389547_-	urease subunit beta	NA	NA	NA	NA	NA
AUR64872.1|3389563_3390181_-	urease accessory protein UreJ	NA	NA	NA	NA	NA
AUR64068.1|3390225_3390528_-	urease subunit gamma	NA	NA	NA	NA	NA
AUR64069.1|3390628_3391483_-	urease accessory protein ureD	NA	NA	NA	NA	NA
AUR64070.1|3392754_3393162_-	aldehyde-activating protein	NA	NA	NA	NA	NA
AUR64071.1|3393531_3394326_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR64072.1|3394426_3395662_+	methylaspartate ammonia-lyase	NA	NA	NA	NA	NA
AUR64073.1|3395730_3396747_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
3396529:3396554	attL	GGCCTGCTGGCGCCGGCCGGCACGCC	NA	NA	NA	NA
AUR64074.1|3396758_3398135_+	hypothetical protein	NA	NA	NA	NA	NA
3396529:3396554	attL	GGCCTGCTGGCGCCGGCCGGCACGCC	NA	NA	NA	NA
AUR64075.1|3398131_3399328_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64076.1|3399324_3400863_-	SpoVR family protein	NA	NA	NA	NA	NA
AUR64077.1|3400859_3402119_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64078.1|3404059_3404962_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR64079.1|3405776_3406871_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64080.1|3406863_3408198_-	CoA ligase	NA	NA	NA	NA	NA
AUR64081.1|3408151_3408835_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR64082.1|3408860_3410024_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR64083.1|3410020_3411022_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR64084.1|3411021_3411894_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR64085.1|3411890_3412640_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	1.9e-09
AUR64086.1|3412636_3413428_-	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	29.4	1.7e-08
AUR64087.1|3413424_3414564_-	ABC transporter	NA	NA	NA	NA	NA
AUR64088.1|3414839_3415625_+	3-hydroxy-2-methylbutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR64089.1|3415658_3416441_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR64090.1|3416444_3416834_+	DNA-binding protein	NA	NA	NA	NA	NA
AUR64091.1|3417973_3418837_+	3-alpha,7-alpha, 12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR64092.1|3418872_3419961_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64093.1|3419957_3420860_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR64094.1|3421261_3424240_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64095.1|3425166_3426045_+	fatty acid desaturase	NA	NA	NA	NA	NA
AUR64096.1|3426080_3426413_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64097.1|3426391_3427030_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64098.1|3427009_3427912_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR64099.1|3428222_3428465_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64100.1|3428623_3428944_+	hypothetical protein	NA	A0A1V0S9J5	Catovirus	45.3	2.4e-14
AUR64101.1|3429090_3429993_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR64102.1|3429989_3430457_-	ribonuclease H	NA	J9Q745	Salmonella_phage	50.7	5.6e-36
AUR64103.1|3430499_3431270_-	methyltransferase type 11	NA	NA	NA	NA	NA
AUR64104.1|3431290_3432091_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AUR64105.1|3432101_3433511_+	lytic transglycosylase	NA	NA	NA	NA	NA
AUR64106.1|3433605_3434391_+	enoyl-ACP reductase	NA	NA	NA	NA	NA
AUR64873.1|3434630_3435647_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR64107.1|3435754_3436147_-	osmotically inducible protein OsmC	NA	NA	NA	NA	NA
AUR64108.1|3436284_3436965_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64109.1|3436969_3437941_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
3437160:3437185	attR	GGCGTGCCGGCCGGCGCCAGCAGGCC	NA	NA	NA	NA
AUR64110.1|3438036_3438939_-|integrase	integrase	integrase	NA	NA	NA	NA
3437160:3437185	attR	GGCGTGCCGGCCGGCGCCAGCAGGCC	NA	NA	NA	NA
AUR64111.1|3440491_3441193_+	two-component system response regulator	NA	W8CYM9	Bacillus_phage	36.6	5.6e-32
AUR64112.1|3441192_3442617_+	ATPase	NA	NA	NA	NA	NA
AUR64113.1|3443686_3445027_-	transmembrane cytochrome oxidase	NA	NA	NA	NA	NA
AUR64114.1|3445142_3446906_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	50.0	5.0e-162
AUR64115.1|3447017_3447896_+	septum formation inhibitor	NA	NA	NA	NA	NA
AUR64116.1|3448008_3448824_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
AUR64117.1|3448827_3449079_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
AUR64874.1|3449163_3450180_-|transposase	transposase	transposase	NA	NA	NA	NA
AUR64118.1|3450510_3450732_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AUR64875.1|3453092_3453959_-	multidrug DMT transporter	NA	NA	NA	NA	NA
AUR64119.1|3454507_3455716_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR64120.1|3455795_3457367_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR64121.1|3457484_3458420_-	glycosyl transferase	NA	NA	NA	NA	NA
AUR64122.1|3458608_3459553_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	8.4e-07
AUR64123.1|3459621_3459792_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64124.1|3460120_3465838_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	39.5	1.0e-195
AUR64125.1|3465843_3466971_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	37.8	3.8e-38
AUR64126.1|3467026_3467653_+	aminobenzoate synthetase	NA	NA	NA	NA	NA
AUR64876.1|3467924_3468941_+|transposase	transposase	transposase	NA	NA	NA	NA
AUR64127.1|3469036_3469747_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUR64877.1|3469743_3470733_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR64128.1|3470828_3472460_+	acyl-CoA synthetase	NA	NA	NA	NA	NA
AUR64129.1|3472462_3473200_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR64130.1|3473355_3474228_-	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
AUR64131.1|3474577_3475717_+	MFS transporter	NA	NA	NA	NA	NA
AUR64132.1|3475713_3476373_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AUR64133.1|3476444_3477077_+	pyridoxine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AUR64134.1|3477106_3477625_+	flavin reductase	NA	NA	NA	NA	NA
AUR64135.1|3477635_3478745_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUR64136.1|3478791_3479646_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
AUR64137.1|3479647_3480550_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR64138.1|3481772_3482723_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR64139.1|3482821_3483955_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64140.1|3483991_3484240_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64141.1|3484479_3485469_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR64142.1|3485644_3486433_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	53.0	5.1e-66
AUR64143.1|3486429_3487461_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.7	7.4e-73
AUR64144.1|3487479_3488043_-	anthranilate synthase	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	1.1e-65
AUR64145.1|3488098_3489619_-	anthranilate synthase	NA	S4VT78	Pandoravirus	32.1	9.0e-43
AUR64146.1|3489882_3490587_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AUR64147.1|3490594_3491323_-	ribulose phosphate epimerase	NA	NA	NA	NA	NA
AUR64148.1|3491437_3491812_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
AUR64149.1|3491854_3493144_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64150.1|3493140_3494310_+	ubiquinone biosynthesis protein UbiH	NA	NA	NA	NA	NA
AUR64151.1|3494336_3495146_+	disulfide bond formation protein DsbC	NA	NA	NA	NA	NA
AUR64152.1|3495205_3496141_+	hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	27.7	6.4e-15
AUR64153.1|3496153_3497104_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR64154.1|3497202_3498165_-|tRNA	tRNA 2-thiocytidine biosynthesis protein TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	64.5	4.6e-93
AUR64155.1|3498196_3498556_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AUR64156.1|3498680_3499583_+	oxidoreductase	NA	G3MA85	Bacillus_virus	24.0	1.9e-08
AUR64878.1|3499584_3501351_-	peptidase M61	NA	NA	NA	NA	NA
AUR64157.1|3501391_3502168_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR64158.1|3503491_3504442_-|integrase	integrase	integrase	NA	NA	NA	NA
3506030:3506046	attR	CGCTGGACCTGCTGCCG	NA	NA	NA	NA
>prophage 28
CP013867	Bordetella pertussis strain J365, complete genome	4082563	3519380	3577453	4082563	integrase,tRNA	Planktothrix_phage(12.5%)	49	3517181:3517198	3581585:3581602
3517181:3517198	attL	CGCCGGCGCTCGAACCCG	NA	NA	NA	NA
AUR64171.1|3519380_3520331_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR64172.1|3520459_3521593_-	peptidase	NA	NA	NA	NA	NA
AUR64173.1|3521636_3522542_-	hydrolase	NA	NA	NA	NA	NA
AUR64174.1|3522544_3524245_-	hypothetical protein	NA	G9BWD6	Planktothrix_phage	32.7	1.0e-15
AUR64175.1|3524241_3525162_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUR64176.1|3525169_3526147_-	ABC transporter permease	NA	NA	NA	NA	NA
AUR64177.1|3526205_3527165_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
AUR64178.1|3529214_3529451_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64179.1|3529577_3530441_-	ADP-dependent (S)-NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
AUR64180.1|3530529_3531351_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR64181.1|3531430_3532168_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR64182.1|3532164_3533157_-	2-nitropropane dioxygenase	NA	NA	NA	NA	NA
AUR64881.1|3533309_3533933_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUR64183.1|3533977_3535126_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUR64184.1|3537497_3538400_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR64185.1|3538740_3539691_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR64186.1|3539837_3540740_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR64187.1|3541036_3541534_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64188.1|3541576_3543352_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64189.1|3543359_3544226_+	copper resistance protein	NA	NA	NA	NA	NA
AUR64190.1|3544232_3544958_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR64191.1|3545127_3545358_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64192.1|3545422_3545617_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64193.1|3546136_3546907_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR64194.1|3547220_3547811_+	cysteine dioxygenase	NA	NA	NA	NA	NA
AUR64195.1|3547844_3549173_-	amidase	NA	NA	NA	NA	NA
AUR64196.1|3549247_3550393_-	transporter	NA	NA	NA	NA	NA
AUR64197.1|3550504_3551503_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR64198.1|3551465_3551900_+	carbon monoxide dehydrogenase	NA	NA	NA	NA	NA
AUR64199.1|3553416_3554301_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64200.1|3554297_3555503_-	cardiolipin synthase B	NA	NA	NA	NA	NA
AUR64201.1|3555499_3556360_-	endonuclease	NA	NA	NA	NA	NA
AUR64202.1|3556472_3558263_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	25.5	6.5e-08
AUR64882.1|3558303_3558948_-	hypothetical protein	NA	A0A2I7S9X1	Vibrio_phage	28.4	8.5e-11
AUR64203.1|3558969_3559278_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
AUR64883.1|3559443_3560730_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64204.1|3565065_3566280_-	phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
AUR64205.1|3566385_3567375_+	D-arabinose 5-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	37.7	4.3e-38
AUR64206.1|3567371_3567980_+	phenylphosphate carboxylase subunit delta	NA	E3T535	Cafeteria_roenbergensis_virus	26.1	5.2e-10
AUR64207.1|3567992_3568622_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AUR64208.1|3568618_3569239_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR64209.1|3569270_3570062_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	9.5e-20
AUR64210.1|3570415_3570637_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64211.1|3570913_3571369_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AUR64212.1|3571387_3572314_+	serine kinase	NA	NA	NA	NA	NA
AUR64213.1|3572367_3573654_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUR64214.1|3574584_3575457_+	RNase adaptor protein RapZ	NA	A0A1P8D5W0	Corynebacterium_phage	34.5	2.4e-08
AUR64215.1|3575453_3576404_+	hypothetical protein	NA	F5B3X9	Synechococcus_phage	47.2	6.9e-17
AUR64216.1|3576502_3577453_+|integrase	integrase	integrase	NA	NA	NA	NA
3581585:3581602	attR	CGGGTTCGAGCGCCGGCG	NA	NA	NA	NA
>prophage 29
CP013867	Bordetella pertussis strain J365, complete genome	4082563	3709625	3752796	4082563	integrase,tRNA	Streptococcus_phage(11.11%)	41	3747635:3747653	3753419:3753437
AUR64325.1|3709625_3710528_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR64326.1|3710675_3711578_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR64327.1|3711574_3712210_-	lysine transporter LysE	NA	NA	NA	NA	NA
AUR64328.1|3712339_3713239_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR64329.1|3713334_3713826_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64330.1|3713872_3714838_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR64331.1|3715971_3717213_+	2-aminoadipate aminotransferase	NA	A0A1X9I5H2	Streptococcus_phage	24.9	1.9e-14
AUR64332.1|3717326_3718343_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	43.8	3.5e-75
AUR64333.1|3718377_3718854_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64334.1|3718996_3719905_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
AUR64335.1|3720018_3721131_-	DNA processing protein DprA	NA	S6BFL3	Thermus_phage	35.0	1.9e-21
AUR64892.1|3721231_3721717_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUR64336.1|3721853_3723104_+	kynureninase	NA	NA	NA	NA	NA
AUR64337.1|3723205_3723718_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.3	8.5e-22
AUR64338.1|3723864_3724767_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR64339.1|3724832_3725771_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-09
AUR64340.1|3725793_3726420_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AUR64341.1|3726416_3727073_-	HAD family hydrolase	NA	NA	NA	NA	NA
AUR64342.1|3727069_3727672_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64343.1|3727678_3728266_-	LOG family protein	NA	A0A2I2L3F0	Orpheovirus	23.3	1.1e-07
AUR64344.1|3728446_3729016_+	bacterioferritin	NA	NA	NA	NA	NA
AUR64345.1|3729086_3730406_-	ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AUR64346.1|3730512_3730704_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AUR64347.1|3730955_3732245_+	glycine/D-amino acid oxidase	NA	NA	NA	NA	NA
AUR64348.1|3732399_3733395_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64349.1|3733479_3734154_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUR64350.1|3734150_3735053_-|integrase	integrase	integrase	NA	NA	NA	NA
AUR64351.1|3735262_3736504_+	ornithine--oxo-acid aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	25.2	4.0e-25
AUR64352.1|3736500_3737445_+	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	33.3	9.5e-27
AUR64353.1|3737563_3738514_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR64354.1|3738473_3739403_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64355.1|3739456_3739792_-	alkylhydroperoxidase	NA	NA	NA	NA	NA
AUR64356.1|3739836_3740601_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUR64357.1|3740624_3741365_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR64358.1|3741372_3742926_-	long-chain fatty acid--CoA ligase	NA	A0A2K9L3I8	Tupanvirus	22.6	1.5e-13
AUR64359.1|3742960_3743938_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64360.1|3744210_3744792_-	ureidoglycolate hydrolase	NA	NA	NA	NA	NA
AUR64361.1|3744843_3751977_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
3747635:3747653	attL	GCGACCCGCAGCGTGCCGG	NA	NA	NA	NA
AUR64362.1|3752192_3752324_-	entericidin	NA	NA	NA	NA	NA
AUR64893.1|3752355_3752481_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64363.1|3752589_3752796_-|integrase	integrase	integrase	NA	NA	NA	NA
3753419:3753437	attR	GCGACCCGCAGCGTGCCGG	NA	NA	NA	NA
>prophage 30
CP013867	Bordetella pertussis strain J365, complete genome	4082563	3758731	3795407	4082563	integrase	Burkholderia_phage(11.11%)	38	3791368:3791427	3795497:3795645
AUR64370.1|3758731_3759634_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR64371.1|3759644_3760286_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64372.1|3760452_3760695_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64373.1|3760841_3761744_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR64374.1|3761779_3762247_+	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	71.3	2.1e-43
AUR64375.1|3762480_3762858_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64376.1|3762854_3763037_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64377.1|3763040_3764027_+	DNA recombinase	NA	H9C0R8	Aeromonas_phage	57.3	2.0e-67
AUR64378.1|3764023_3764671_+	exonuclease	NA	A0A0U2BXF3	Paracoccus_phage	41.4	2.0e-31
AUR64379.1|3764728_3765256_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64380.1|3765292_3766477_+	hypothetical protein	NA	A0A291L9X3	Bordetella_phage	37.8	1.5e-24
AUR64381.1|3766487_3766829_+	hypothetical protein	NA	A0A0H5ARN8	Pseudomonas_phage	45.3	1.0e-10
AUR64382.1|3766821_3766941_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64383.1|3766941_3767142_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64384.1|3767138_3768128_-|integrase	integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	44.4	4.4e-75
AUR64385.1|3769614_3771585_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64386.1|3771826_3772225_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64387.1|3772233_3773157_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUR64388.1|3773662_3774565_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR64389.1|3774795_3776487_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
AUR64390.1|3776535_3776808_-	membrane protein insertion efficiency factor	NA	A0A2H4PQM5	Staphylococcus_phage	52.2	7.0e-15
AUR64391.1|3776804_3777176_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AUR64392.1|3777271_3777406_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AUR64393.1|3777811_3779221_+	chromosomal replication initiation protein DnaA	NA	NA	NA	NA	NA
AUR64394.1|3779223_3780333_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	32.6	1.2e-41
AUR64395.1|3780427_3782881_+	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.3e-112
AUR64396.1|3782999_3783791_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUR64397.1|3783910_3785338_+	amidase	NA	NA	NA	NA	NA
AUR64894.1|3785376_3786348_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUR64398.1|3786432_3786636_+	hypothetical protein	NA	NA	NA	NA	NA
AUR64399.1|3786766_3787930_+	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUR64400.1|3788017_3788863_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUR64401.1|3790467_3791370_+|integrase	integrase	integrase	NA	NA	NA	NA
3791368:3791427	attL	TAGCTGTGAAGATTCAATAGGTTGTATGCATGGTTCATCCGAACCGGATTTGAGAAACTG	NA	NA	NA	NA
AUR64402.1|3791516_3792419_+|integrase	integrase	integrase	NA	NA	NA	NA
AUR64403.1|3792415_3792760_-	hypothetical protein	NA	NA	NA	NA	NA
AUR64404.1|3792973_3793348_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AUR64405.1|3793422_3794481_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
AUR64406.1|3794504_3795407_-|integrase	integrase	integrase	NA	NA	NA	NA
3795497:3795645	attR	CAGTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACAGCTACCTGCCCAAGCTGGTCAGCGGCGAACACGTGGGCGCGCTGGCCATGAGCGAGCCGGGCGCGGGGTCCGATGTGGTCAGCATGCGCCTGC	NA	NA	NA	NA
