The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025599	Mycobacterium tuberculosis strain GG-45-11 chromosome, complete genome	4411469	889032	947606	4411469	transposase,bacteriocin,protease,tRNA	Burkholderia_virus(16.67%)	58	NA	NA
AUP82489.1|889032_890293_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP82490.1|890348_891443_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUP82491.1|891432_892230_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AUP82492.1|892226_893234_-	peroxidase	NA	NA	NA	NA	NA
AUP82493.1|893278_894580_+	m18 family aminopeptidase	NA	NA	NA	NA	NA
AUP82494.1|894591_894939_+	VOC family protein	NA	NA	NA	NA	NA
AUP82495.1|894932_895589_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUP85451.1|895780_898045_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	8.1e-274
AUP82496.1|898041_898671_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUP82497.1|898791_899748_+	phosphodiesterase	NA	NA	NA	NA	NA
AUP82498.1|899692_901291_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
AUP82499.1|901595_901985_+	hypothetical protein	NA	NA	NA	NA	NA
AUP82500.1|902071_903655_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
AUP82501.1|903685_904780_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
AUP82502.1|904865_905048_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
AUP82503.1|905194_906301_-	folate-binding protein	NA	NA	NA	NA	NA
AUP85452.1|906383_907253_+	4-amino-4-deoxychorismate lyase	NA	NA	NA	NA	NA
AUP82504.1|907298_907979_-	FABP family protein	NA	NA	NA	NA	NA
AUP82505.1|908141_908444_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
AUP85453.1|908445_909279_-	sulfurtransferase	NA	NA	NA	NA	NA
AUP82506.1|909571_909994_-	thioredoxin	NA	NA	NA	NA	NA
AUP82507.1|909990_910803_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
AUP85454.1|910932_911700_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
AUP82508.1|911696_912644_+	mycothiol synthase	NA	NA	NA	NA	NA
AUP82509.1|912686_913463_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
AUP82510.1|913518_914160_-	phosphate-specific transport system accessory protein PhoU	NA	NA	NA	NA	NA
AUP82511.1|914217_916272_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AUP82512.1|916437_917607_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
AUP82513.1|917694_918711_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
AUP82514.1|918872_919514_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUP85455.1|919594_920650_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
AUP82515.1|920701_921094_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP82516.1|921151_921574_-	nucleoside deaminase	NA	NA	NA	NA	NA
AUP82517.1|921535_921826_+|transposase	transposase	transposase	NA	NA	NA	NA
AUP82518.1|921930_922836_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP82519.1|922854_923670_-	TIGR04255 family protein	NA	NA	NA	NA	NA
AUP82520.1|924911_925325_+	PE family protein	NA	NA	NA	NA	NA
AUP85456.1|927590_927770_+	hypothetical protein	NA	NA	NA	NA	NA
AUP82521.1|927798_930447_-	PE family protein	NA	NA	NA	NA	NA
AUP82522.1|930914_931559_+	sensor domain-containing protein	NA	NA	NA	NA	NA
AUP82523.1|931539_932091_-	hypothetical protein	NA	NA	NA	NA	NA
AUP85457.1|932240_932894_-	hypothetical protein	NA	NA	NA	NA	NA
AUP82524.1|932964_933993_-	hypothetical protein	NA	NA	NA	NA	NA
AUP82525.1|934254_934443_-	hypothetical protein	NA	NA	NA	NA	NA
AUP82526.1|934681_935452_+	D-Ala-D-Ala dipeptidase VanX	NA	NA	NA	NA	NA
AUP82527.1|935538_936351_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP82528.1|936418_937279_-	proline iminopeptidase	NA	NA	NA	NA	NA
AUP82529.1|937366_937630_+	hypothetical protein	NA	NA	NA	NA	NA
AUP82530.1|937554_937797_+	hypothetical protein	NA	NA	NA	NA	NA
AUP85458.1|938073_939366_+	MFS transporter	NA	NA	NA	NA	NA
AUP82531.1|939349_940354_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
AUP82532.1|940417_941068_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUP82533.1|941151_942429_+	sensor histidine kinase	NA	NA	NA	NA	NA
AUP82534.1|942641_944156_-	oxidase	NA	NA	NA	NA	NA
AUP85459.1|944304_944697_+	hypothetical protein	NA	NA	NA	NA	NA
AUP85460.1|944899_946018_+	cysteine synthase CysK	NA	NA	NA	NA	NA
AUP82535.1|946017_947277_+	MFS transporter	NA	NA	NA	NA	NA
AUP85461.1|947273_947606_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP025599	Mycobacterium tuberculosis strain GG-45-11 chromosome, complete genome	4411469	1125409	1177210	4411469	transposase,integrase,protease,tRNA	Klosneuvirus(20.0%)	54	1133232:1133248	1182290:1182306
AUP82687.1|1125409_1126969_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	2.8e-100
AUP85481.1|1127054_1127849_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
AUP82688.1|1128056_1129145_+	resuscitation-promoting factor RpfB	NA	Q856D9	Mycobacterium_phage	59.4	8.2e-22
AUP82689.1|1129117_1130071_+	ribosomal RNA small subunit methyltransferase A	NA	NA	NA	NA	NA
AUP85482.1|1130156_1131077_+	4-diphosphocytidyl-2C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AUP82690.1|1131093_1131387_+	hypothetical protein	NA	NA	NA	NA	NA
AUP85483.1|1131346_1131646_-	hypothetical protein	NA	NA	NA	NA	NA
AUP82691.1|1131590_1133225_+	polyketide synthase	NA	NA	NA	NA	NA
1133232:1133248	attL	CGAGCAGACGCAAAATC	NA	NA	NA	NA
AUP82692.1|1133298_1133874_-|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUP82693.1|1133886_1134534_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AUP82694.1|1134750_1135431_-	hypothetical protein	NA	NA	NA	NA	NA
AUP82695.1|1135466_1136447_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	32.7	1.8e-44
AUP82696.1|1136538_1138026_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	NA	NA	NA	NA
AUP85484.1|1138280_1138874_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUP82697.1|1138932_1142637_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
AUP85485.1|1142636_1143614_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AUP82698.1|1143701_1144433_+	murein transglycosylase B	NA	NA	NA	NA	NA
AUP82699.1|1144529_1145819_+	enolase	NA	W6LP63	Streptococcus_phage	56.6	2.1e-133
AUP82700.1|1145823_1146510_+	septation inhibitor protein	NA	NA	NA	NA	NA
AUP85486.1|1146526_1146994_+	DUF501 domain-containing protein	NA	NA	NA	NA	NA
AUP82701.1|1146984_1147944_+	exopolyphosphatase	NA	NA	NA	NA	NA
AUP82702.1|1148183_1148396_+	hypothetical protein	NA	NA	NA	NA	NA
AUP82703.1|1148392_1149073_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.6	4.2e-24
AUP82704.1|1149069_1151652_-	sensor protein KdpD	NA	NA	NA	NA	NA
AUP82705.1|1151742_1151889_+	potassium transporter Trk	NA	NA	NA	NA	NA
AUP85487.1|1151885_1151978_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUP82706.1|1151977_1153693_+	potassium-transporting ATPase A chain	NA	NA	NA	NA	NA
AUP82707.1|1153689_1155819_+	potassium-transporting ATPase subunit B	NA	M1HRW9	Paramecium_bursaria_Chlorella_virus	26.2	3.8e-23
AUP82708.1|1155818_1156388_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AUP82709.1|1156391_1157921_-	sensor histidine kinase	NA	NA	NA	NA	NA
AUP82710.1|1157928_1158702_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.3	2.3e-34
AUP82711.1|1160509_1160794_-	ESAT-6-like protein EsxI	NA	NA	NA	NA	NA
AUP82712.1|1160820_1161117_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
AUP82713.1|1161262_1162438_-	PPE family protein	NA	NA	NA	NA	NA
AUP82714.1|1162514_1163342_-	PE family protein	NA	NA	NA	NA	NA
AUP82715.1|1163902_1164151_+	hypothetical protein	NA	NA	NA	NA	NA
AUP82716.1|1164129_1164369_-	hypothetical protein	NA	NA	NA	NA	NA
AUP82717.1|1164274_1164493_-	hypothetical protein	NA	NA	NA	NA	NA
AUP85488.1|1164537_1165020_-|transposase	IS5 family transposase	transposase	A0A1V0SLQ8	Klosneuvirus	28.7	8.1e-06
AUP82718.1|1165057_1165456_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUP85489.1|1165747_1166773_-|protease	serine protease	protease	NA	NA	NA	NA
AUP82719.1|1167019_1167643_+	hypothetical protein	NA	NA	NA	NA	NA
AUP82720.1|1167639_1168521_+	hypothetical protein	NA	NA	NA	NA	NA
AUP82721.1|1168602_1169391_-	hypothetical protein	NA	NA	NA	NA	NA
AUP82722.1|1169390_1170638_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
AUP82723.1|1171005_1172121_-	hypothetical protein	NA	NA	NA	NA	NA
AUP82724.1|1172077_1172281_-	hypothetical protein	NA	NA	NA	NA	NA
AUP82725.1|1172353_1172800_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUP85490.1|1172848_1173754_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUP82726.1|1173912_1174668_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUP85491.1|1174962_1175589_-	hypothetical protein	NA	NA	NA	NA	NA
AUP82727.1|1175655_1175838_+	hypothetical protein	NA	NA	NA	NA	NA
AUP82728.1|1176533_1176872_+|integrase	integrase	integrase	NA	NA	NA	NA
AUP82729.1|1176895_1177210_+|integrase	integrase	integrase	Q854H9	Mycobacterium_phage	53.6	1.0e-09
1182290:1182306	attR	CGAGCAGACGCAAAATC	NA	NA	NA	NA
>prophage 3
CP025599	Mycobacterium tuberculosis strain GG-45-11 chromosome, complete genome	4411469	2941159	2976525	4411469	head,terminase,integrase,tRNA,transposase,protease,capsid	Tupanvirus(11.11%)	42	2969960:2969987	2980942:2980969
AUP84197.1|2941159_2943238_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
AUP84198.1|2943346_2943574_+	hypothetical protein	NA	NA	NA	NA	NA
AUP84199.1|2943570_2944956_-	PE family protein	NA	NA	NA	NA	NA
AUP84200.1|2945300_2945801_+	DUF1990 domain-containing protein	NA	NA	NA	NA	NA
AUP84201.1|2945817_2946258_-	DoxX family membrane protein	NA	NA	NA	NA	NA
AUP85680.1|2946404_2947082_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP84202.1|2947066_2947420_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AUP84203.1|2947432_2947858_-	hypothetical protein	NA	NA	NA	NA	NA
AUP84204.1|2947854_2948529_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP84205.1|2948606_2949428_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP84206.1|2949563_2950457_+	universal stress protein	NA	NA	NA	NA	NA
AUP85681.1|2950459_2951278_-	universal stress protein	NA	NA	NA	NA	NA
AUP84207.1|2951292_2952474_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AUP84208.1|2952532_2952964_-	hypoxic response protein 1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
AUP84209.1|2953477_2954719_-	hypothetical protein	NA	NA	NA	NA	NA
AUP85682.1|2955028_2955391_+	hypothetical protein	NA	NA	NA	NA	NA
AUP84210.1|2955737_2956862_+	hypothetical protein	NA	NA	NA	NA	NA
AUP84211.1|2956863_2957403_+	archease	NA	NA	NA	NA	NA
AUP84212.1|2957542_2958841_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
AUP84213.1|2958879_2959161_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
AUP84214.1|2959305_2959791_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
AUP84215.1|2959817_2960075_-	hypothetical protein	NA	NA	NA	NA	NA
AUP84216.1|2960075_2962412_-	PE family protein	NA	NA	NA	NA	NA
AUP84217.1|2962440_2962683_+	hypothetical protein	NA	NA	NA	NA	NA
AUP84218.1|2962683_2963361_+	hypothetical protein	NA	NA	NA	NA	NA
AUP84219.1|2963556_2964213_+	DedA family protein	NA	NA	NA	NA	NA
AUP84220.1|2964375_2964822_+	STAS domain-containing protein	NA	NA	NA	NA	NA
AUP84221.1|2964996_2965329_-	YnfA family protein	NA	NA	NA	NA	NA
AUP84222.1|2965448_2965808_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP84223.1|2965909_2966368_+	cadmium-induced protein CadI	NA	NA	NA	NA	NA
AUP84224.1|2966503_2966884_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP84225.1|2966880_2968377_+	arsenical-resistance protein	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
AUP85683.1|2968566_2968803_+	DUF3018 domain-containing protein	NA	NA	NA	NA	NA
AUP84226.1|2968875_2969049_+	hypothetical protein	NA	NA	NA	NA	NA
2969960:2969987	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
AUP84227.1|2970093_2970525_+	hypothetical protein	NA	NA	NA	NA	NA
AUP84228.1|2970521_2971520_+|integrase	integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
AUP84229.1|2971533_2971998_+	hypothetical protein	NA	NA	NA	NA	NA
AUP84230.1|2971985_2972174_+	hypothetical protein	NA	NA	NA	NA	NA
AUP84231.1|2972130_2973391_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP84232.1|2973765_2975205_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
AUP85684.1|2975212_2975746_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
AUP84233.1|2975898_2976525_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980942:2980969	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 4
CP025599	Mycobacterium tuberculosis strain GG-45-11 chromosome, complete genome	4411469	3710389	3796327	4411469	transposase,tRNA	Burkholderia_virus(28.57%)	57	NA	NA
AUP84839.1|3710389_3711650_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP84840.1|3711888_3713418_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUP85788.1|3713350_3714289_-	RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
AUP84841.1|3714297_3715665_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.0	3.1e-18
AUP84842.1|3715733_3716951_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
AUP84843.1|3717046_3718555_+	MFS transporter	NA	NA	NA	NA	NA
AUP84844.1|3718551_3719703_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AUP84845.1|3719893_3720739_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
AUP85789.1|3720715_3721195_+	hypothetical protein	NA	NA	NA	NA	NA
AUP84846.1|3721213_3721654_+	Zn(2+)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUP84847.1|3721687_3722557_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
AUP84848.1|3722577_3723588_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUP84849.1|3723872_3724505_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUP84850.1|3724571_3725801_-	isocitrate dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AUP84851.1|3726083_3727433_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
AUP84852.1|3727444_3728584_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
AUP85790.1|3728580_3729312_+	methyltransferase	NA	NA	NA	NA	NA
AUP84853.1|3729320_3736892_-	PPE family protein	NA	NA	NA	NA	NA
AUP84854.1|3743154_3743412_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
AUP84855.1|3743667_3753141_-	PPE family protein	NA	NA	NA	NA	NA
AUP85792.1|3753178_3753670_-	hypothetical protein	NA	NA	NA	NA	NA
AUP85791.1|3753766_3754213_+|transposase	transposase	transposase	NA	NA	NA	NA
AUP84856.1|3754249_3755068_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP84857.1|3755284_3755521_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP84858.1|3755908_3767059_-	PPE family protein	NA	NA	NA	NA	NA
AUP84859.1|3767302_3768097_-	oxidoreductase	NA	NA	NA	NA	NA
AUP84860.1|3768178_3768550_-	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	56.4	3.3e-15
AUP84861.1|3768447_3768858_-	FAD-binding protein	NA	NA	NA	NA	NA
AUP85793.1|3768692_3768953_-	oxidoreductase	NA	NA	NA	NA	NA
AUP84862.1|3769067_3769457_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
AUP84863.1|3769470_3769764_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
AUP84864.1|3769760_3770606_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
AUP84865.1|3770729_3771005_+	antitoxin	NA	NA	NA	NA	NA
AUP84866.1|3771001_3771259_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AUP84867.1|3771300_3772491_+	oxidoreductase	NA	NA	NA	NA	NA
AUP84868.1|3772607_3772976_+	hypothetical protein	NA	NA	NA	NA	NA
AUP84869.1|3772972_3773524_-	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
AUP84870.1|3773530_3774112_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AUP84871.1|3774092_3774461_-	DUF742 domain-containing protein	NA	NA	NA	NA	NA
AUP84872.1|3774438_3774831_-	dynein regulation protein LC7	NA	NA	NA	NA	NA
AUP84873.1|3774827_3777458_-	sensor histidine kinase	NA	NA	NA	NA	NA
AUP84874.1|3777693_3778158_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AUP84875.1|3778524_3780300_+	PE family protein	NA	NA	NA	NA	NA
AUP84876.1|3780300_3780945_-	oxidoreductase	NA	NA	NA	NA	NA
AUP84877.1|3780943_3781378_+	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
AUP84878.1|3781466_3784706_-	DNA polymerase III subunit alpha	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.6e-118
AUP84879.1|3784897_3786238_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
AUP84880.1|3786279_3787455_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AUP84881.1|3787691_3788333_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUP84882.1|3788333_3788582_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUP84883.1|3788586_3790014_+	amidase	NA	NA	NA	NA	NA
AUP85794.1|3790121_3790775_+	haloacid dehalogenase	NA	NA	NA	NA	NA
AUP84884.1|3790813_3792319_-	type B diterpene cyclase	NA	NA	NA	NA	NA
AUP84885.1|3792323_3793214_-	diterpene synthase	NA	NA	NA	NA	NA
AUP84886.1|3793222_3794833_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUP84887.1|3794777_3795023_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUP84888.1|3795065_3796327_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
