The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025597	Mycobacterium tuberculosis strain GG-36-11 chromosome, complete genome	4411469	889044	947617	4411469	transposase,protease,bacteriocin,tRNA	Burkholderia_virus(16.67%)	59	NA	NA
AUP67069.1|889044_890305_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP67070.1|890360_891455_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUP67071.1|891444_892242_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AUP67072.1|892238_893246_-	peroxidase	NA	NA	NA	NA	NA
AUP67073.1|893290_894592_+	m18 family aminopeptidase	NA	NA	NA	NA	NA
AUP67074.1|894603_894951_+	VOC family protein	NA	NA	NA	NA	NA
AUP67075.1|894944_895601_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUP70038.1|895792_898057_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	8.1e-274
AUP67076.1|898053_898683_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUP67077.1|898803_899760_+	phosphodiesterase	NA	NA	NA	NA	NA
AUP67078.1|899704_901303_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
AUP67079.1|901607_901997_+	hypothetical protein	NA	NA	NA	NA	NA
AUP67080.1|902083_903667_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
AUP67081.1|903697_904792_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
AUP67082.1|904877_905060_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
AUP67083.1|905206_906313_-	folate-binding protein	NA	NA	NA	NA	NA
AUP70039.1|906395_907265_+	4-amino-4-deoxychorismate lyase	NA	NA	NA	NA	NA
AUP67084.1|907310_907991_-	FABP family protein	NA	NA	NA	NA	NA
AUP67085.1|908153_908456_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
AUP70040.1|908457_909291_-	sulfurtransferase	NA	NA	NA	NA	NA
AUP67086.1|909583_910006_-	thioredoxin	NA	NA	NA	NA	NA
AUP67087.1|910002_910815_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
AUP70041.1|910944_911712_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
AUP67088.1|911708_912656_+	mycothiol synthase	NA	NA	NA	NA	NA
AUP67089.1|912698_913475_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
AUP67090.1|913530_914172_-	phosphate-specific transport system accessory protein PhoU	NA	NA	NA	NA	NA
AUP67091.1|914229_916284_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AUP67092.1|916449_917619_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
AUP67093.1|917706_918723_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
AUP67094.1|918884_919526_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUP70042.1|919606_920662_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
AUP67095.1|920713_921106_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP67096.1|921163_921586_-	nucleoside deaminase	NA	NA	NA	NA	NA
AUP67097.1|921547_921838_+|transposase	transposase	transposase	NA	NA	NA	NA
AUP67098.1|921942_922848_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP67099.1|922866_923682_-	TIGR04255 family protein	NA	NA	NA	NA	NA
AUP67100.1|924923_925337_+	PE family protein	NA	NA	NA	NA	NA
AUP67101.1|925333_927583_+	PE family protein	NA	NA	NA	NA	NA
AUP67102.1|927601_927781_+	hypothetical protein	NA	NA	NA	NA	NA
AUP67103.1|927809_930458_-	PE family protein	NA	NA	NA	NA	NA
AUP67104.1|930925_931570_+	sensor domain-containing protein	NA	NA	NA	NA	NA
AUP67105.1|931550_932102_-	hypothetical protein	NA	NA	NA	NA	NA
AUP70043.1|932251_932905_-	hypothetical protein	NA	NA	NA	NA	NA
AUP67106.1|932975_934004_-	hypothetical protein	NA	NA	NA	NA	NA
AUP67107.1|934265_934454_-	hypothetical protein	NA	NA	NA	NA	NA
AUP67108.1|934692_935463_+	D-Ala-D-Ala dipeptidase VanX	NA	NA	NA	NA	NA
AUP67109.1|935549_936362_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP67110.1|936429_937290_-	proline iminopeptidase	NA	NA	NA	NA	NA
AUP67111.1|937377_937641_+	hypothetical protein	NA	NA	NA	NA	NA
AUP67112.1|937565_937808_+	hypothetical protein	NA	NA	NA	NA	NA
AUP70044.1|938084_939377_+	hypothetical protein	NA	NA	NA	NA	NA
AUP67113.1|939360_940365_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
AUP67114.1|940428_941079_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUP67115.1|941162_942440_+	sensor histidine kinase	NA	NA	NA	NA	NA
AUP67116.1|942652_944167_-	oxidase	NA	NA	NA	NA	NA
AUP70045.1|944315_944708_+	hypothetical protein	NA	NA	NA	NA	NA
AUP70046.1|944910_946029_+	cysteine synthase CysK	NA	NA	NA	NA	NA
AUP67117.1|946028_947288_+	MFS transporter	NA	NA	NA	NA	NA
AUP70047.1|947284_947617_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP025597	Mycobacterium tuberculosis strain GG-36-11 chromosome, complete genome	4411469	1125435	1177237	4411469	transposase,protease,integrase,tRNA	Klosneuvirus(20.0%)	53	1133258:1133274	1182317:1182333
AUP67267.1|1125435_1126995_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	2.8e-100
AUP70069.1|1127080_1127875_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
AUP67268.1|1128082_1129171_+	resuscitation-promoting factor RpfB	NA	Q856D9	Mycobacterium_phage	59.4	8.2e-22
AUP67269.1|1129143_1130097_+	ribosomal RNA small subunit methyltransferase A	NA	NA	NA	NA	NA
AUP70070.1|1130182_1131103_+	4-diphosphocytidyl-2C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AUP67270.1|1131119_1131413_+	hypothetical protein	NA	NA	NA	NA	NA
AUP70071.1|1131372_1131672_-	hypothetical protein	NA	NA	NA	NA	NA
AUP67271.1|1131616_1133251_+	polyketide synthase	NA	NA	NA	NA	NA
1133258:1133274	attL	CGAGCAGACGCAAAATC	NA	NA	NA	NA
AUP67272.1|1133324_1133900_-|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUP67273.1|1133912_1134560_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AUP67274.1|1134776_1135457_-	hypothetical protein	NA	NA	NA	NA	NA
AUP67275.1|1135492_1136473_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	32.7	1.8e-44
AUP67276.1|1136564_1138052_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	NA	NA	NA	NA
AUP70072.1|1138306_1138900_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUP67277.1|1138958_1142663_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
AUP70073.1|1142662_1143640_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AUP67278.1|1143727_1144459_+	murein transglycosylase B	NA	NA	NA	NA	NA
AUP67279.1|1144555_1145845_+	enolase	NA	W6LP63	Streptococcus_phage	56.6	2.1e-133
AUP67280.1|1145849_1146536_+	septation inhibitor protein	NA	NA	NA	NA	NA
AUP70074.1|1146552_1147020_+	DUF501 domain-containing protein	NA	NA	NA	NA	NA
AUP67281.1|1147010_1147970_+	exopolyphosphatase	NA	NA	NA	NA	NA
AUP67282.1|1148209_1148422_+	hypothetical protein	NA	NA	NA	NA	NA
AUP67283.1|1148418_1149099_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.6	4.2e-24
AUP67284.1|1149095_1151678_-	sensor protein KdpD	NA	NA	NA	NA	NA
AUP67285.1|1151768_1151915_+	potassium transporter Trk	NA	NA	NA	NA	NA
AUP70075.1|1151911_1152004_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUP67286.1|1152003_1153719_+	potassium-transporting ATPase A chain	NA	NA	NA	NA	NA
AUP67287.1|1153715_1155845_+	potassium-transporting ATPase subunit B	NA	M1HRW9	Paramecium_bursaria_Chlorella_virus	26.2	3.8e-23
AUP67288.1|1155844_1156414_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AUP67289.1|1156417_1157947_-	sensor histidine kinase	NA	NA	NA	NA	NA
AUP67290.1|1157954_1158728_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.3	2.3e-34
AUP67291.1|1160535_1160820_-	ESAT-6-like protein EsxI	NA	NA	NA	NA	NA
AUP67292.1|1160846_1161143_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
AUP67293.1|1161288_1162464_-	PPE family protein	NA	NA	NA	NA	NA
AUP67294.1|1162540_1163368_-	PE family protein	NA	NA	NA	NA	NA
AUP67295.1|1163928_1164177_+	hypothetical protein	NA	NA	NA	NA	NA
AUP67296.1|1164155_1164395_-	hypothetical protein	NA	NA	NA	NA	NA
AUP67297.1|1164300_1164519_-	hypothetical protein	NA	NA	NA	NA	NA
AUP70076.1|1164563_1165046_-|transposase	IS5 family transposase	transposase	A0A1V0SLQ8	Klosneuvirus	28.7	8.1e-06
AUP67298.1|1165083_1165482_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUP70077.1|1165773_1166799_-|protease	serine protease	protease	NA	NA	NA	NA
AUP67299.1|1167045_1167669_+	hypothetical protein	NA	NA	NA	NA	NA
AUP67300.1|1168629_1169418_-	hypothetical protein	NA	NA	NA	NA	NA
AUP67301.1|1169417_1170665_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
AUP67302.1|1171032_1172148_-	hypothetical protein	NA	NA	NA	NA	NA
AUP67303.1|1172104_1172308_-	hypothetical protein	NA	NA	NA	NA	NA
AUP67304.1|1172380_1172827_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUP70078.1|1172875_1173781_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUP67305.1|1173939_1174695_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUP70079.1|1174989_1175616_-	hypothetical protein	NA	NA	NA	NA	NA
AUP67306.1|1175682_1175865_+	hypothetical protein	NA	NA	NA	NA	NA
AUP67307.1|1176560_1176899_+|integrase	integrase	integrase	NA	NA	NA	NA
AUP67308.1|1176922_1177237_+|integrase	integrase	integrase	Q854H9	Mycobacterium_phage	53.6	1.0e-09
1182317:1182333	attR	CGAGCAGACGCAAAATC	NA	NA	NA	NA
>prophage 3
CP025597	Mycobacterium tuberculosis strain GG-36-11 chromosome, complete genome	4411469	2941158	2976524	4411469	capsid,transposase,terminase,integrase,protease,tRNA,head	Tupanvirus(11.11%)	42	2969959:2969986	2980941:2980968
AUP68779.1|2941158_2943237_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
AUP68780.1|2943345_2943573_+	hypothetical protein	NA	NA	NA	NA	NA
AUP70265.1|2943569_2944955_-	PE family protein	NA	NA	NA	NA	NA
AUP68781.1|2945299_2945800_+	DUF1990 domain-containing protein	NA	NA	NA	NA	NA
AUP68782.1|2945816_2946257_-	DoxX family membrane protein	NA	NA	NA	NA	NA
AUP70266.1|2946403_2947081_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP68783.1|2947065_2947419_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AUP68784.1|2947431_2947857_-	hypothetical protein	NA	NA	NA	NA	NA
AUP68785.1|2947853_2948528_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP68786.1|2948605_2949427_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP68787.1|2949562_2950456_+	universal stress protein	NA	NA	NA	NA	NA
AUP70267.1|2950458_2951277_-	universal stress protein	NA	NA	NA	NA	NA
AUP68788.1|2951291_2952473_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AUP68789.1|2952531_2952963_-	hypoxic response protein 1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
AUP68790.1|2953476_2954718_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUP70268.1|2955027_2955390_+	hypothetical protein	NA	NA	NA	NA	NA
AUP68791.1|2955736_2956861_+	hypothetical protein	NA	NA	NA	NA	NA
AUP68792.1|2956862_2957402_+	archease	NA	NA	NA	NA	NA
AUP68793.1|2957541_2958840_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
AUP68794.1|2958878_2959160_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
AUP68795.1|2959304_2959790_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
AUP68796.1|2959816_2960074_-	hypothetical protein	NA	NA	NA	NA	NA
AUP68797.1|2960074_2962411_-	PE family protein	NA	NA	NA	NA	NA
AUP68798.1|2962439_2962682_+	hypothetical protein	NA	NA	NA	NA	NA
AUP68799.1|2962682_2963360_+	hypothetical protein	NA	NA	NA	NA	NA
AUP68800.1|2963555_2964212_+	DedA family protein	NA	NA	NA	NA	NA
AUP68801.1|2964374_2964821_+	STAS domain-containing protein	NA	NA	NA	NA	NA
AUP68802.1|2964995_2965328_-	YnfA family protein	NA	NA	NA	NA	NA
AUP68803.1|2965447_2965807_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP68804.1|2965908_2966367_+	cadmium-induced protein CadI	NA	NA	NA	NA	NA
AUP68805.1|2966502_2966883_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP68806.1|2966879_2968376_+	arsenical-resistance protein	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
AUP70269.1|2968565_2968802_+	DUF3018 domain-containing protein	NA	NA	NA	NA	NA
AUP68807.1|2968874_2969048_+	hypothetical protein	NA	NA	NA	NA	NA
2969959:2969986	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
AUP68808.1|2970092_2970524_+	hypothetical protein	NA	NA	NA	NA	NA
AUP68809.1|2970520_2971519_+|integrase	integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
AUP68810.1|2971532_2971997_+	hypothetical protein	NA	NA	NA	NA	NA
AUP68811.1|2971984_2972173_+	hypothetical protein	NA	NA	NA	NA	NA
AUP68812.1|2972129_2973390_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP68813.1|2973764_2975204_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
AUP70270.1|2975211_2975745_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
AUP68814.1|2975897_2976524_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980941:2980968	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 4
CP025597	Mycobacterium tuberculosis strain GG-36-11 chromosome, complete genome	4411469	3710389	3796327	4411469	transposase,tRNA	Burkholderia_virus(28.57%)	57	NA	NA
AUP69418.1|3710389_3711650_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP69419.1|3711888_3713418_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUP70378.1|3713350_3714289_-	RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
AUP69420.1|3714297_3715665_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.0	3.1e-18
AUP69421.1|3715733_3716951_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
AUP69422.1|3717046_3718555_+	MFS transporter	NA	NA	NA	NA	NA
AUP69423.1|3718551_3719703_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AUP69424.1|3719893_3720739_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
AUP70379.1|3720715_3721195_+	hypothetical protein	NA	NA	NA	NA	NA
AUP69425.1|3721213_3721654_+	Zn(2+)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUP69426.1|3721687_3722557_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
AUP69427.1|3722577_3723588_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUP69428.1|3723872_3724505_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUP69429.1|3724571_3725801_-	isocitrate dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AUP69430.1|3726083_3727433_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
AUP69431.1|3727444_3728584_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
AUP70380.1|3728580_3729312_+	methyltransferase	NA	NA	NA	NA	NA
AUP69432.1|3729320_3736892_-	PPE family protein	NA	NA	NA	NA	NA
AUP69433.1|3743154_3743412_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
AUP69434.1|3743667_3753141_-	PPE family protein	NA	NA	NA	NA	NA
AUP70382.1|3753178_3753670_-	hypothetical protein	NA	NA	NA	NA	NA
AUP70381.1|3753766_3754213_+|transposase	transposase	transposase	NA	NA	NA	NA
AUP69435.1|3754249_3755068_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP69436.1|3755284_3755521_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP69437.1|3755908_3767059_-	PPE family protein	NA	NA	NA	NA	NA
AUP69438.1|3767302_3768097_-	oxidoreductase	NA	NA	NA	NA	NA
AUP69439.1|3768178_3768550_-	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	56.4	3.3e-15
AUP69440.1|3768447_3768858_-	FAD-binding protein	NA	NA	NA	NA	NA
AUP70383.1|3768692_3768953_-	oxidoreductase	NA	NA	NA	NA	NA
AUP69441.1|3769067_3769457_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
AUP69442.1|3769470_3769764_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
AUP69443.1|3769760_3770606_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
AUP69444.1|3770729_3771005_+	antitoxin	NA	NA	NA	NA	NA
AUP69445.1|3771001_3771259_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AUP69446.1|3771300_3772491_+	oxidoreductase	NA	NA	NA	NA	NA
AUP69447.1|3772607_3772976_+	hypothetical protein	NA	NA	NA	NA	NA
AUP69448.1|3772972_3773524_-	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
AUP69449.1|3773530_3774112_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AUP70384.1|3774092_3774461_-	DUF742 domain-containing protein	NA	NA	NA	NA	NA
AUP69450.1|3774438_3774831_-	dynein regulation protein LC7	NA	NA	NA	NA	NA
AUP69451.1|3774827_3777458_-	sensor histidine kinase	NA	NA	NA	NA	NA
AUP69452.1|3777693_3778158_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AUP69453.1|3778524_3780300_+	PE family protein	NA	NA	NA	NA	NA
AUP69454.1|3780300_3780945_-	oxidoreductase	NA	NA	NA	NA	NA
AUP69455.1|3780943_3781378_+	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
AUP69456.1|3781466_3784706_-	DNA polymerase III subunit alpha	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.6e-118
AUP69457.1|3784897_3786238_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
AUP69458.1|3786279_3787455_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AUP69459.1|3787691_3788333_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUP69460.1|3788333_3788582_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUP69461.1|3788586_3790014_+	amidase	NA	NA	NA	NA	NA
AUP70385.1|3790121_3790775_+	haloacid dehalogenase	NA	NA	NA	NA	NA
AUP69462.1|3790813_3792319_-	type B diterpene cyclase	NA	NA	NA	NA	NA
AUP69463.1|3792323_3793214_-	diterpene synthase	NA	NA	NA	NA	NA
AUP69464.1|3793222_3794833_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUP69465.1|3794777_3795023_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUP69466.1|3795065_3796327_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
