The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025596	Mycobacterium tuberculosis strain GG-27-11 chromosome, complete genome	4411443	888961	947525	4411443	tRNA,bacteriocin,protease,transposase	Burkholderia_virus(16.67%)	59	NA	NA
AUP62931.1|888961_890222_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP62932.1|890277_891372_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUP62933.1|891361_892159_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AUP62934.1|892155_893163_-	peroxidase	NA	NA	NA	NA	NA
AUP62935.1|893207_894509_+	m18 family aminopeptidase	NA	NA	NA	NA	NA
AUP62936.1|894520_894868_+	VOC family protein	NA	NA	NA	NA	NA
AUP62937.1|894861_895518_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUP65889.1|895709_897974_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.2	1.8e-273
AUP62938.1|897970_898600_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUP62939.1|898720_899677_+	phosphodiesterase	NA	NA	NA	NA	NA
AUP62940.1|899621_901220_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
AUP62941.1|901524_901914_+	hypothetical protein	NA	NA	NA	NA	NA
AUP62942.1|902000_903584_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
AUP62943.1|903614_904709_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
AUP62944.1|904794_904977_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
AUP62945.1|905123_906230_-	folate-binding protein	NA	NA	NA	NA	NA
AUP65890.1|906312_907182_+	4-amino-4-deoxychorismate lyase	NA	NA	NA	NA	NA
AUP62946.1|907227_907908_-	FABP family protein	NA	NA	NA	NA	NA
AUP62947.1|908070_908373_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
AUP65891.1|908374_909208_-	sulfurtransferase	NA	NA	NA	NA	NA
AUP62948.1|909500_909923_-	thioredoxin	NA	NA	NA	NA	NA
AUP62949.1|909919_910732_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
AUP65892.1|910861_911629_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
AUP62950.1|911625_912573_+	mycothiol synthase	NA	NA	NA	NA	NA
AUP62951.1|912615_913392_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
AUP62952.1|913447_914089_-	phosphate-specific transport system accessory protein PhoU	NA	NA	NA	NA	NA
AUP62953.1|914146_916201_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AUP62954.1|916366_917536_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
AUP62955.1|917623_918640_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
AUP62956.1|918801_919443_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUP65893.1|919523_920579_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
AUP62957.1|920630_921023_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP62958.1|921080_921503_-	nucleoside deaminase	NA	NA	NA	NA	NA
AUP62959.1|921464_921755_+|transposase	transposase	transposase	NA	NA	NA	NA
AUP62960.1|921859_922765_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP62961.1|922783_923599_-	TIGR04255 family protein	NA	NA	NA	NA	NA
AUP62962.1|924840_925254_+	PE family protein	NA	NA	NA	NA	NA
AUP62963.1|925250_927500_+	PE family protein	NA	NA	NA	NA	NA
AUP65894.1|927518_927698_+	hypothetical protein	NA	NA	NA	NA	NA
AUP62964.1|927726_930366_-	PE family protein	NA	NA	NA	NA	NA
AUP62965.1|930833_931478_+	sensor domain-containing protein	NA	NA	NA	NA	NA
AUP62966.1|931458_932010_-	hypothetical protein	NA	NA	NA	NA	NA
AUP65895.1|932159_932813_-	hypothetical protein	NA	NA	NA	NA	NA
AUP62967.1|932883_933912_-	hypothetical protein	NA	NA	NA	NA	NA
AUP62968.1|934173_934362_-	hypothetical protein	NA	NA	NA	NA	NA
AUP62969.1|934600_935371_+	D-Ala-D-Ala dipeptidase VanX	NA	NA	NA	NA	NA
AUP62970.1|935457_936270_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP62971.1|936337_937198_-	proline iminopeptidase	NA	NA	NA	NA	NA
AUP62972.1|937285_937549_+	hypothetical protein	NA	NA	NA	NA	NA
AUP62973.1|937473_937716_+	hypothetical protein	NA	NA	NA	NA	NA
AUP65896.1|937992_939285_+	MFS transporter	NA	NA	NA	NA	NA
AUP62974.1|939268_940273_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
AUP62975.1|940336_940987_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUP62976.1|941070_942348_+	sensor histidine kinase	NA	NA	NA	NA	NA
AUP62977.1|942560_944075_-	oxidase	NA	NA	NA	NA	NA
AUP65897.1|944223_944616_+	hypothetical protein	NA	NA	NA	NA	NA
AUP65898.1|944818_945937_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
AUP62978.1|945936_947196_+	MFS transporter	NA	NA	NA	NA	NA
AUP65899.1|947192_947525_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP025596	Mycobacterium tuberculosis strain GG-27-11 chromosome, complete genome	4411443	1125348	1177149	4411443	tRNA,integrase,protease,transposase	Klosneuvirus(20.0%)	54	1133171:1133187	1182229:1182245
AUP63129.1|1125348_1126908_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	2.8e-100
AUP65921.1|1126993_1127788_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
AUP63130.1|1127995_1129084_+	resuscitation-promoting factor	NA	Q856D9	Mycobacterium_phage	59.4	8.2e-22
AUP65922.1|1129056_1130010_+	ribosomal RNA small subunit methyltransferase A	NA	NA	NA	NA	NA
AUP65923.1|1130095_1131016_+	4-diphosphocytidyl-2C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AUP63131.1|1131032_1131326_+	hypothetical protein	NA	NA	NA	NA	NA
AUP65924.1|1131285_1131585_-	hypothetical protein	NA	NA	NA	NA	NA
AUP63132.1|1131529_1133164_+	polyketide synthase	NA	NA	NA	NA	NA
1133171:1133187	attL	CGAGCAGACGCAAAATC	NA	NA	NA	NA
AUP63133.1|1133237_1133813_-|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUP63134.1|1133825_1134473_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AUP63135.1|1134689_1135370_-	hypothetical protein	NA	NA	NA	NA	NA
AUP63136.1|1135405_1136386_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	32.7	1.8e-44
AUP63137.1|1136477_1137965_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	NA	NA	NA	NA
AUP65925.1|1138219_1138813_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUP63138.1|1138871_1142576_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
AUP63139.1|1142575_1143553_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AUP63140.1|1143640_1144372_+	murein transglycosylase B	NA	NA	NA	NA	NA
AUP63141.1|1144468_1145758_+	enolase	NA	W6LP63	Streptococcus_phage	56.6	2.1e-133
AUP63142.1|1145762_1146449_+	septation inhibitor protein	NA	NA	NA	NA	NA
AUP65926.1|1146465_1146933_+	DUF501 domain-containing protein	NA	NA	NA	NA	NA
AUP63143.1|1146923_1147883_+	exopolyphosphatase	NA	NA	NA	NA	NA
AUP63144.1|1148122_1148335_+	hypothetical protein	NA	NA	NA	NA	NA
AUP63145.1|1148331_1149012_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.6	4.2e-24
AUP63146.1|1149008_1151591_-	histidine kinase	NA	NA	NA	NA	NA
AUP63147.1|1151681_1151828_+	potassium transporter Trk	NA	NA	NA	NA	NA
AUP65927.1|1151824_1151917_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUP63148.1|1151916_1153632_+	potassium-transporting ATPase A chain	NA	NA	NA	NA	NA
AUP63149.1|1153628_1155758_+	potassium-transporting ATPase subunit B	NA	M1HRW9	Paramecium_bursaria_Chlorella_virus	26.2	3.8e-23
AUP63150.1|1155757_1156327_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AUP63151.1|1156330_1157860_-	sensor histidine kinase	NA	NA	NA	NA	NA
AUP63152.1|1157867_1158641_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.3	2.3e-34
AUP63153.1|1160448_1160733_-	ESAT-6-like protein EsxI	NA	NA	NA	NA	NA
AUP63154.1|1160759_1161056_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
AUP63155.1|1161201_1162377_-	PPE family protein	NA	NA	NA	NA	NA
AUP63156.1|1162453_1163281_-	PE family protein	NA	NA	NA	NA	NA
AUP63157.1|1163841_1164090_+	hypothetical protein	NA	NA	NA	NA	NA
AUP63158.1|1164068_1164308_-	hypothetical protein	NA	NA	NA	NA	NA
AUP63159.1|1164213_1164432_-	hypothetical protein	NA	NA	NA	NA	NA
AUP65928.1|1164476_1164959_-|transposase	IS5 family transposase	transposase	A0A1V0SLQ8	Klosneuvirus	28.7	8.1e-06
AUP63160.1|1164996_1165395_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUP65929.1|1165686_1166712_-|protease	serine protease	protease	NA	NA	NA	NA
AUP63161.1|1166958_1167582_+	hypothetical protein	NA	NA	NA	NA	NA
AUP63162.1|1167578_1168460_+	hypothetical protein	NA	NA	NA	NA	NA
AUP63163.1|1168541_1169330_-	hypothetical protein	NA	NA	NA	NA	NA
AUP63164.1|1169329_1170577_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
AUP63165.1|1170944_1172060_-	hypothetical protein	NA	NA	NA	NA	NA
AUP63166.1|1172016_1172220_-	hypothetical protein	NA	NA	NA	NA	NA
AUP63167.1|1172292_1172739_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUP65930.1|1172787_1173693_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUP63168.1|1173851_1174607_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUP65931.1|1174901_1175528_-	hypothetical protein	NA	NA	NA	NA	NA
AUP63169.1|1175594_1175777_+	hypothetical protein	NA	NA	NA	NA	NA
AUP63170.1|1176472_1176811_+|integrase	integrase	integrase	NA	NA	NA	NA
AUP63171.1|1176834_1177149_+|integrase	integrase	integrase	Q854H9	Mycobacterium_phage	53.6	1.0e-09
1182229:1182245	attR	CGAGCAGACGCAAAATC	NA	NA	NA	NA
>prophage 3
CP025596	Mycobacterium tuberculosis strain GG-27-11 chromosome, complete genome	4411443	2941093	2976459	4411443	terminase,tRNA,head,capsid,transposase,integrase,protease	Tupanvirus(11.11%)	42	2969894:2969921	2980876:2980903
AUP64636.1|2941093_2943172_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
AUP64637.1|2943280_2943508_+	hypothetical protein	NA	NA	NA	NA	NA
AUP66121.1|2943504_2944890_-	PE family protein	NA	NA	NA	NA	NA
AUP64638.1|2945234_2945735_+	DUF1990 domain-containing protein	NA	NA	NA	NA	NA
AUP64639.1|2945751_2946192_-	DoxX family membrane protein	NA	NA	NA	NA	NA
AUP66122.1|2946338_2947016_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP64640.1|2947000_2947354_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AUP64641.1|2947366_2947792_-	hypothetical protein	NA	NA	NA	NA	NA
AUP64642.1|2947788_2948463_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP64643.1|2948540_2949362_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP64644.1|2949497_2950391_+	universal stress protein	NA	NA	NA	NA	NA
AUP66123.1|2950393_2951212_-	universal stress protein	NA	NA	NA	NA	NA
AUP64645.1|2951226_2952408_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AUP64646.1|2952466_2952898_-	hypoxic response protein 1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
AUP64647.1|2953411_2954653_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUP66124.1|2954962_2955325_+	hypothetical protein	NA	NA	NA	NA	NA
AUP64648.1|2955671_2956796_+	hypothetical protein	NA	NA	NA	NA	NA
AUP64649.1|2956797_2957337_+	archease	NA	NA	NA	NA	NA
AUP64650.1|2957476_2958775_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
AUP64651.1|2958813_2959095_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
AUP64652.1|2959239_2959725_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
AUP64653.1|2959751_2960009_-	hypothetical protein	NA	NA	NA	NA	NA
AUP64654.1|2960009_2962346_-	PE family protein	NA	NA	NA	NA	NA
AUP64655.1|2962374_2962617_+	hypothetical protein	NA	NA	NA	NA	NA
AUP64656.1|2962617_2963295_+	hypothetical protein	NA	NA	NA	NA	NA
AUP64657.1|2963490_2964147_+	DedA family protein	NA	NA	NA	NA	NA
AUP64658.1|2964309_2964756_+	STAS domain-containing protein	NA	NA	NA	NA	NA
AUP64659.1|2964930_2965263_-	YnfA family protein	NA	NA	NA	NA	NA
AUP64660.1|2965382_2965742_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP64661.1|2965843_2966302_+	cadmium-induced protein CadI	NA	NA	NA	NA	NA
AUP64662.1|2966437_2966818_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP64663.1|2966814_2968311_+	arsenical-resistance protein	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
AUP66125.1|2968500_2968737_+	DUF3018 domain-containing protein	NA	NA	NA	NA	NA
AUP64664.1|2968809_2968983_+	hypothetical protein	NA	NA	NA	NA	NA
2969894:2969921	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
AUP64665.1|2970027_2970459_+	hypothetical protein	NA	NA	NA	NA	NA
AUP64666.1|2970455_2971454_+|integrase	integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
AUP64667.1|2971467_2971932_+	hypothetical protein	NA	NA	NA	NA	NA
AUP64668.1|2971919_2972108_+	hypothetical protein	NA	NA	NA	NA	NA
AUP64669.1|2972064_2973325_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP64670.1|2973699_2975139_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
AUP66126.1|2975146_2975680_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
AUP64671.1|2975832_2976459_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980876:2980903	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 4
CP025596	Mycobacterium tuberculosis strain GG-27-11 chromosome, complete genome	4411443	3710330	3796284	4411443	tRNA,transposase	Burkholderia_virus(28.57%)	57	NA	NA
AUP65274.1|3710330_3711591_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP65275.1|3711646_3713359_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUP66233.1|3713291_3714230_-	RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
AUP65276.1|3714238_3715606_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.8	9.0e-18
AUP65277.1|3715674_3716892_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
AUP65278.1|3716987_3718496_+	MFS transporter	NA	NA	NA	NA	NA
AUP65279.1|3718492_3719644_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AUP65280.1|3719834_3720680_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
AUP66234.1|3720656_3721136_+	hypothetical protein	NA	NA	NA	NA	NA
AUP65281.1|3721154_3721595_+	Zn(2+)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUP65282.1|3721628_3722498_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
AUP65283.1|3722518_3723529_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUP65284.1|3723813_3724446_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUP65285.1|3724512_3725742_-	isocitrate dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AUP65286.1|3726024_3727374_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
AUP65287.1|3727385_3728525_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
AUP66235.1|3728521_3729253_+	methyltransferase	NA	NA	NA	NA	NA
AUP65288.1|3729261_3736830_-	PPE family protein	NA	NA	NA	NA	NA
AUP65289.1|3743110_3743368_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
AUP65290.1|3743623_3753097_-	PPE family protein	NA	NA	NA	NA	NA
AUP66237.1|3753134_3753626_-	hypothetical protein	NA	NA	NA	NA	NA
AUP66236.1|3753722_3754169_+|transposase	transposase	transposase	NA	NA	NA	NA
AUP65291.1|3754205_3755024_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP65292.1|3755240_3755477_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP66238.1|3755864_3759524_-	PPE family protein	NA	NA	NA	NA	NA
AUP65293.1|3767259_3768054_-	oxidoreductase	NA	NA	NA	NA	NA
AUP65294.1|3768135_3768507_-	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	56.4	3.3e-15
AUP65295.1|3768404_3768815_-	FAD-binding protein	NA	NA	NA	NA	NA
AUP66239.1|3768649_3768910_-	oxidoreductase	NA	NA	NA	NA	NA
AUP65296.1|3769024_3769414_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
AUP65297.1|3769427_3769721_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
AUP65298.1|3769717_3770563_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
AUP65299.1|3770686_3770962_+	antitoxin	NA	NA	NA	NA	NA
AUP65300.1|3770958_3771216_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AUP65301.1|3771257_3772448_+	oxidoreductase	NA	NA	NA	NA	NA
AUP65302.1|3772564_3772933_+	hypothetical protein	NA	NA	NA	NA	NA
AUP65303.1|3772929_3773481_-	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
AUP65304.1|3773487_3774069_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AUP66240.1|3774049_3774418_-	DUF742 domain-containing protein	NA	NA	NA	NA	NA
AUP65305.1|3774395_3774788_-	dynein regulation protein LC7	NA	NA	NA	NA	NA
AUP65306.1|3774784_3777415_-	two-component system sensor histidine kinase EnvZ	NA	NA	NA	NA	NA
AUP65307.1|3777650_3778115_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AUP65308.1|3778481_3780257_+	PE family protein	NA	NA	NA	NA	NA
AUP65309.1|3780257_3780902_-	oxidoreductase	NA	NA	NA	NA	NA
AUP65310.1|3780900_3781335_+	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
AUP66241.1|3781423_3784663_-	DNA polymerase III subunit alpha	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.6e-118
AUP65311.1|3784854_3786195_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
AUP65312.1|3786236_3787412_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AUP65313.1|3787648_3788290_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUP65314.1|3788290_3788539_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUP65315.1|3788543_3789971_+	amidase	NA	NA	NA	NA	NA
AUP66242.1|3790078_3790732_+	haloacid dehalogenase	NA	NA	NA	NA	NA
AUP65316.1|3790770_3792276_-	cyclase	NA	NA	NA	NA	NA
AUP65317.1|3792280_3793171_-	diterpene synthase	NA	NA	NA	NA	NA
AUP65318.1|3793179_3794790_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUP65319.1|3794734_3794980_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUP65320.1|3795022_3796284_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
