The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025603	Mycobacterium tuberculosis strain GG-121-10 chromosome, complete genome	4411510	1125407	1177208	4411510	tRNA,transposase,integrase,protease	Klosneuvirus(20.0%)	54	1133230:1133246	1182288:1182304
AUP99224.1|1125407_1126967_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	2.8e-100
AUQ02015.1|1127052_1127847_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
AUP99225.1|1128054_1129143_+	resuscitation-promoting factor RpfB	NA	Q856D9	Mycobacterium_phage	59.4	8.2e-22
AUP99226.1|1129115_1130069_+	ribosomal RNA small subunit methyltransferase A	NA	NA	NA	NA	NA
AUQ02016.1|1130154_1131075_+	4-diphosphocytidyl-2C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AUP99227.1|1131091_1131385_+	hypothetical protein	NA	NA	NA	NA	NA
AUQ02017.1|1131344_1131644_-	hypothetical protein	NA	NA	NA	NA	NA
AUP99228.1|1131588_1133223_+	polyketide synthase	NA	NA	NA	NA	NA
1133230:1133246	attL	CGAGCAGACGCAAAATC	NA	NA	NA	NA
AUP99229.1|1133296_1133872_-|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUP99230.1|1133884_1134532_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AUP99231.1|1134748_1135429_-	hypothetical protein	NA	NA	NA	NA	NA
AUP99232.1|1135464_1136445_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	32.7	1.8e-44
AUP99233.1|1136536_1138024_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	NA	NA	NA	NA
AUP99234.1|1138278_1138872_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUP99235.1|1138930_1142635_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
AUP99236.1|1142634_1143612_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AUP99237.1|1143699_1144431_+	murein transglycosylase B	NA	NA	NA	NA	NA
AUP99238.1|1144527_1145817_+	enolase	NA	W6LP63	Streptococcus_phage	56.6	2.1e-133
AUP99239.1|1145821_1146508_+	septation inhibitor protein	NA	NA	NA	NA	NA
AUQ02018.1|1146524_1146992_+	DUF501 domain-containing protein	NA	NA	NA	NA	NA
AUP99240.1|1146982_1147942_+	exopolyphosphatase	NA	NA	NA	NA	NA
AUP99241.1|1148181_1148394_+	hypothetical protein	NA	NA	NA	NA	NA
AUP99242.1|1148390_1149071_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.6	4.2e-24
AUP99243.1|1149067_1151650_-	sensor protein KdpD	NA	NA	NA	NA	NA
AUP99244.1|1151740_1151887_+	potassium transporter Trk	NA	NA	NA	NA	NA
AUQ02019.1|1151883_1151976_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUP99245.1|1151975_1153691_+	potassium-transporting ATPase A chain	NA	NA	NA	NA	NA
AUP99246.1|1153687_1155817_+	potassium-transporting ATPase subunit B	NA	M1HRW9	Paramecium_bursaria_Chlorella_virus	26.2	3.8e-23
AUP99247.1|1155816_1156386_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AUP99248.1|1156389_1157919_-	sensor histidine kinase	NA	NA	NA	NA	NA
AUP99249.1|1157926_1158700_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.3	2.3e-34
AUP99250.1|1160507_1160792_-	ESAT-6-like protein EsxI	NA	NA	NA	NA	NA
AUP99251.1|1160818_1161115_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
AUP99252.1|1161260_1162436_-	PPE family protein	NA	NA	NA	NA	NA
AUP99253.1|1162512_1163340_-	PE family protein	NA	NA	NA	NA	NA
AUP99254.1|1163900_1164149_+	hypothetical protein	NA	NA	NA	NA	NA
AUP99255.1|1164127_1164367_-	hypothetical protein	NA	NA	NA	NA	NA
AUP99256.1|1164272_1164491_-	hypothetical protein	NA	NA	NA	NA	NA
AUQ02020.1|1164535_1165018_-|transposase	IS5 family transposase	transposase	A0A1V0SLQ8	Klosneuvirus	28.7	8.1e-06
AUP99257.1|1165055_1165454_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUQ02021.1|1165745_1166771_-|protease	serine protease	protease	NA	NA	NA	NA
AUP99258.1|1167017_1167641_+	hypothetical protein	NA	NA	NA	NA	NA
AUP99259.1|1167637_1168519_+	hypothetical protein	NA	NA	NA	NA	NA
AUP99260.1|1168600_1169389_-	hypothetical protein	NA	NA	NA	NA	NA
AUP99261.1|1169388_1170636_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
AUP99262.1|1171003_1172119_-	hypothetical protein	NA	NA	NA	NA	NA
AUP99263.1|1172075_1172279_-	hypothetical protein	NA	NA	NA	NA	NA
AUP99264.1|1172351_1172798_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUQ02022.1|1172846_1173752_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUP99265.1|1173910_1174666_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUQ02023.1|1174960_1175587_-	hypothetical protein	NA	NA	NA	NA	NA
AUP99266.1|1175653_1175836_+	hypothetical protein	NA	NA	NA	NA	NA
AUP99267.1|1176531_1176870_+|integrase	integrase	integrase	NA	NA	NA	NA
AUQ02024.1|1176893_1177208_+|integrase	integrase	integrase	Q854H9	Mycobacterium_phage	53.6	1.0e-09
1182288:1182304	attR	CGAGCAGACGCAAAATC	NA	NA	NA	NA
>prophage 2
CP025603	Mycobacterium tuberculosis strain GG-121-10 chromosome, complete genome	4411510	2941163	2976529	4411510	transposase,tRNA,head,protease,integrase,terminase,capsid	Tupanvirus(11.11%)	42	2969964:2969991	2980946:2980973
AUQ00723.1|2941163_2943242_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
AUQ00724.1|2943350_2943578_+	hypothetical protein	NA	NA	NA	NA	NA
AUQ00725.1|2943574_2944960_-	PE family protein	NA	NA	NA	NA	NA
AUQ00726.1|2945304_2945805_+	DUF1990 domain-containing protein	NA	NA	NA	NA	NA
AUQ00727.1|2945821_2946262_-	DoxX family membrane protein	NA	NA	NA	NA	NA
AUQ02226.1|2946408_2947086_+	transcriptional regulator	NA	NA	NA	NA	NA
AUQ00728.1|2947070_2947424_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AUQ00729.1|2947436_2947862_-	hypothetical protein	NA	NA	NA	NA	NA
AUQ00730.1|2947858_2948533_-	transcriptional regulator	NA	NA	NA	NA	NA
AUQ00731.1|2948610_2949432_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUQ00732.1|2949567_2950461_+	universal stress protein	NA	NA	NA	NA	NA
AUQ02227.1|2950463_2951282_-	universal stress protein	NA	NA	NA	NA	NA
AUQ00733.1|2951296_2952478_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AUQ00734.1|2952536_2952968_-	hypoxic response protein 1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
AUQ00735.1|2953481_2954723_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUQ02228.1|2955032_2955395_+	hypothetical protein	NA	NA	NA	NA	NA
AUQ00736.1|2955741_2956866_+	hypothetical protein	NA	NA	NA	NA	NA
AUQ00737.1|2956867_2957407_+	archease	NA	NA	NA	NA	NA
AUQ00738.1|2957546_2958845_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
AUQ00739.1|2958883_2959165_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
AUQ00740.1|2959309_2959795_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
AUQ00741.1|2959821_2960079_-	hypothetical protein	NA	NA	NA	NA	NA
AUQ00742.1|2960079_2962416_-	PE family protein	NA	NA	NA	NA	NA
AUQ00743.1|2962444_2962687_+	hypothetical protein	NA	NA	NA	NA	NA
AUQ00744.1|2962687_2963365_+	hypothetical protein	NA	NA	NA	NA	NA
AUQ00745.1|2963560_2964217_+	DedA family protein	NA	NA	NA	NA	NA
AUQ00746.1|2964379_2964826_+	STAS domain-containing protein	NA	NA	NA	NA	NA
AUQ00747.1|2965000_2965333_-	YnfA family protein	NA	NA	NA	NA	NA
AUQ00748.1|2965452_2965812_-	transcriptional regulator	NA	NA	NA	NA	NA
AUQ00749.1|2965913_2966372_+	cadmium-induced protein CadI	NA	NA	NA	NA	NA
AUQ00750.1|2966507_2966888_+	transcriptional regulator	NA	NA	NA	NA	NA
AUQ00751.1|2966884_2968381_+	arsenical-resistance protein	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
AUQ02229.1|2968570_2968807_+	DUF3018 domain-containing protein	NA	NA	NA	NA	NA
AUQ00752.1|2968879_2969053_+	hypothetical protein	NA	NA	NA	NA	NA
2969964:2969991	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
AUQ00753.1|2970097_2970529_+	hypothetical protein	NA	NA	NA	NA	NA
AUQ00754.1|2970525_2971524_+|integrase	integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
AUQ00755.1|2971537_2972002_+	hypothetical protein	NA	NA	NA	NA	NA
AUQ00756.1|2971989_2972178_+	hypothetical protein	NA	NA	NA	NA	NA
AUQ00757.1|2972134_2973395_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUQ00758.1|2973769_2975209_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
AUQ02230.1|2975216_2975750_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
AUQ00759.1|2975902_2976529_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980946:2980973	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 3
CP025603	Mycobacterium tuberculosis strain GG-121-10 chromosome, complete genome	4411510	3710430	3796359	4411510	tRNA,transposase	Burkholderia_virus(28.57%)	57	NA	NA
AUQ01363.1|3710430_3711691_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUQ01364.1|3711929_3713459_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUQ02334.1|3713391_3714330_-	RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
AUQ01365.1|3714338_3715706_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.8	9.0e-18
AUQ01366.1|3715774_3716992_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
AUQ01367.1|3717087_3718596_+	MFS transporter	NA	NA	NA	NA	NA
AUQ01368.1|3718592_3719744_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AUQ01369.1|3719934_3720780_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
AUQ02335.1|3720756_3721236_+	hypothetical protein	NA	NA	NA	NA	NA
AUQ01370.1|3721254_3721695_+	Zn(2+)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUQ01371.1|3721728_3722598_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
AUQ01372.1|3722618_3723629_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUQ01373.1|3723913_3724546_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUQ01374.1|3724612_3725842_-	isocitrate dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AUQ01375.1|3726124_3727474_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
AUQ01376.1|3727485_3728625_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
AUQ02336.1|3728621_3729353_+	methyltransferase	NA	NA	NA	NA	NA
AUQ01377.1|3729361_3736933_-	PPE family protein	NA	NA	NA	NA	NA
AUQ01378.1|3743186_3743444_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
AUQ01379.1|3743699_3753173_-	PPE family protein	NA	NA	NA	NA	NA
AUQ02338.1|3753210_3753702_-	hypothetical protein	NA	NA	NA	NA	NA
AUQ02337.1|3753798_3754245_+|transposase	transposase	transposase	NA	NA	NA	NA
AUQ01380.1|3754281_3755100_-|transposase	transposase	transposase	NA	NA	NA	NA
AUQ01381.1|3755316_3755553_-|transposase	transposase	transposase	NA	NA	NA	NA
AUQ02339.1|3755940_3767091_-	PPE family protein	NA	NA	NA	NA	NA
AUQ01382.1|3767334_3768129_-	oxidoreductase	NA	NA	NA	NA	NA
AUQ01383.1|3768210_3768582_-	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	56.4	3.3e-15
AUQ01384.1|3768479_3768890_-	FAD-binding protein	NA	NA	NA	NA	NA
AUQ02340.1|3768724_3768985_-	oxidoreductase	NA	NA	NA	NA	NA
AUQ01385.1|3769099_3769489_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
AUQ01386.1|3769502_3769796_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
AUQ01387.1|3769792_3770638_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
AUQ01388.1|3770761_3771037_+	antitoxin	NA	NA	NA	NA	NA
AUQ01389.1|3771033_3771291_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AUQ01390.1|3771332_3772523_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
AUQ01391.1|3772639_3773008_+	hypothetical protein	NA	NA	NA	NA	NA
AUQ01392.1|3773004_3773556_-	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
AUQ01393.1|3773562_3774144_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AUQ01394.1|3774124_3774493_-	DUF742 domain-containing protein	NA	NA	NA	NA	NA
AUQ01395.1|3774470_3774863_-	dynein regulation protein LC7	NA	NA	NA	NA	NA
AUQ01396.1|3774859_3777490_-	two-component system sensor histidine kinase EnvZ	NA	NA	NA	NA	NA
AUQ01397.1|3777725_3778190_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AUQ01398.1|3778556_3780332_+	PE family protein	NA	NA	NA	NA	NA
AUQ01399.1|3780332_3780977_-	oxidoreductase	NA	NA	NA	NA	NA
AUQ01400.1|3780975_3781410_+	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
AUQ01401.1|3781498_3784738_-	DNA polymerase III subunit alpha	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.6e-118
AUQ01402.1|3784929_3786270_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
AUQ01403.1|3786311_3787487_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AUQ01404.1|3787723_3788365_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUQ01405.1|3788365_3788614_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUQ01406.1|3788618_3790046_+	amidase	NA	NA	NA	NA	NA
AUQ02341.1|3790153_3790807_+	haloacid dehalogenase	NA	NA	NA	NA	NA
AUQ01407.1|3790845_3792351_-	type B diterpene cyclase	NA	NA	NA	NA	NA
AUQ01408.1|3792355_3793246_-	diterpene synthase	NA	NA	NA	NA	NA
AUQ01409.1|3793254_3794865_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUQ01410.1|3794809_3795055_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUQ01411.1|3795097_3796359_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
