The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025598	Mycobacterium tuberculosis strain GG-37-11 chromosome, complete genome	4411526	889050	947613	4411526	bacteriocin,transposase,protease,tRNA	Burkholderia_virus(16.67%)	58	NA	NA
AUP71211.1|889050_890311_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP71212.1|890366_891461_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUP71213.1|891450_892248_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AUP71214.1|892244_893252_-	peroxidase	NA	NA	NA	NA	NA
AUP71215.1|893296_894598_+	m18 family aminopeptidase	NA	NA	NA	NA	NA
AUP71216.1|894609_894957_+	VOC family protein	NA	NA	NA	NA	NA
AUP71217.1|894950_895607_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUP74180.1|895798_898063_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	8.1e-274
AUP71218.1|898059_898689_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUP71219.1|898809_899766_+	phosphodiesterase	NA	NA	NA	NA	NA
AUP71220.1|899710_901309_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
AUP71221.1|901613_902003_+	hypothetical protein	NA	NA	NA	NA	NA
AUP71222.1|902089_903673_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
AUP71223.1|903703_904798_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
AUP71224.1|904883_905066_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
AUP71225.1|905212_906319_-	folate-binding protein	NA	NA	NA	NA	NA
AUP74181.1|906401_907271_+	4-amino-4-deoxychorismate lyase	NA	NA	NA	NA	NA
AUP71226.1|907316_907997_-	FABP family protein	NA	NA	NA	NA	NA
AUP71227.1|908159_908462_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
AUP74182.1|908463_909297_-	sulfurtransferase	NA	NA	NA	NA	NA
AUP71228.1|909589_910012_-	thioredoxin	NA	NA	NA	NA	NA
AUP71229.1|910008_910821_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
AUP71230.1|910950_911718_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
AUP71231.1|911714_912662_+	mycothiol synthase	NA	NA	NA	NA	NA
AUP71232.1|912704_913481_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
AUP71233.1|913536_914178_-	phosphate-specific transport system accessory protein PhoU	NA	NA	NA	NA	NA
AUP71234.1|914235_916290_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AUP71235.1|916455_917625_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
AUP71236.1|917712_918729_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
AUP71237.1|918890_919532_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUP74183.1|919612_920668_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
AUP71238.1|920719_921112_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP71239.1|921169_921592_-	nucleoside deaminase	NA	NA	NA	NA	NA
AUP71240.1|921553_921844_+|transposase	transposase	transposase	NA	NA	NA	NA
AUP71241.1|921948_922854_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP71242.1|922872_923688_-	TIGR04255 family protein	NA	NA	NA	NA	NA
AUP71243.1|924929_925343_+	PE family protein	NA	NA	NA	NA	NA
AUP71244.1|925339_927589_+	PE family protein	NA	NA	NA	NA	NA
AUP74184.1|927607_927787_+	hypothetical protein	NA	NA	NA	NA	NA
AUP71245.1|930921_931566_+	sensor domain-containing protein	NA	NA	NA	NA	NA
AUP71246.1|931546_932098_-	hypothetical protein	NA	NA	NA	NA	NA
AUP74185.1|932247_932901_-	hypothetical protein	NA	NA	NA	NA	NA
AUP71247.1|932971_934000_-	hypothetical protein	NA	NA	NA	NA	NA
AUP71248.1|934261_934450_-	hypothetical protein	NA	NA	NA	NA	NA
AUP71249.1|934688_935459_+	D-Ala-D-Ala dipeptidase VanX	NA	NA	NA	NA	NA
AUP71250.1|935545_936358_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP71251.1|936425_937286_-	proline iminopeptidase	NA	NA	NA	NA	NA
AUP71252.1|937373_937637_+	hypothetical protein	NA	NA	NA	NA	NA
AUP71253.1|937561_937804_+	hypothetical protein	NA	NA	NA	NA	NA
AUP74186.1|938080_939373_+	MFS transporter	NA	NA	NA	NA	NA
AUP71254.1|939356_940361_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
AUP71255.1|940424_941075_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUP71256.1|941158_942436_+	sensor histidine kinase	NA	NA	NA	NA	NA
AUP71257.1|942648_944163_-	oxidase	NA	NA	NA	NA	NA
AUP74187.1|944311_944704_+	hypothetical protein	NA	NA	NA	NA	NA
AUP74188.1|944906_946025_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
AUP71258.1|946024_947284_+	MFS transporter	NA	NA	NA	NA	NA
AUP74189.1|947280_947613_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP025598	Mycobacterium tuberculosis strain GG-37-11 chromosome, complete genome	4411526	1125423	1177223	4411526	transposase,protease,tRNA,integrase	Klosneuvirus(20.0%)	54	1133246:1133262	1182303:1182319
AUP71409.1|1125423_1126983_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	2.8e-100
AUP74210.1|1127068_1127863_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
AUP71410.1|1128070_1129159_+	resuscitation-promoting factor RpfB	NA	Q856D9	Mycobacterium_phage	59.4	8.2e-22
AUP71411.1|1129131_1130085_+	ribosomal RNA small subunit methyltransferase A	NA	NA	NA	NA	NA
AUP74211.1|1130170_1131091_+	4-diphosphocytidyl-2C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AUP71412.1|1131107_1131401_+	hypothetical protein	NA	NA	NA	NA	NA
AUP74212.1|1131360_1131660_-	hypothetical protein	NA	NA	NA	NA	NA
AUP71413.1|1131604_1133239_+	polyketide synthase	NA	NA	NA	NA	NA
1133246:1133262	attL	CGAGCAGACGCAAAATC	NA	NA	NA	NA
AUP71414.1|1133312_1133888_-|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUP71415.1|1133900_1134548_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AUP71416.1|1134764_1135445_-	hypothetical protein	NA	NA	NA	NA	NA
AUP71417.1|1135480_1136461_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	32.7	1.8e-44
AUP71418.1|1136552_1138040_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	NA	NA	NA	NA
AUP74213.1|1138294_1138888_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUP71419.1|1138946_1142651_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
AUP71420.1|1142650_1143628_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AUP71421.1|1143715_1144447_+	murein transglycosylase B	NA	NA	NA	NA	NA
AUP71422.1|1144543_1145833_+	enolase	NA	W6LP63	Streptococcus_phage	56.6	2.1e-133
AUP71423.1|1145837_1146524_+	septation inhibitor protein	NA	NA	NA	NA	NA
AUP74214.1|1146540_1147008_+	DUF501 domain-containing protein	NA	NA	NA	NA	NA
AUP71424.1|1146998_1147958_+	exopolyphosphatase	NA	NA	NA	NA	NA
AUP71425.1|1148197_1148410_+	hypothetical protein	NA	NA	NA	NA	NA
AUP71426.1|1148406_1149087_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.6	4.2e-24
AUP71427.1|1149083_1151666_-	sensor protein KdpD	NA	NA	NA	NA	NA
AUP71428.1|1151756_1151903_+	potassium transporter Trk	NA	NA	NA	NA	NA
AUP74215.1|1151899_1151992_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUP71429.1|1151991_1153707_+	potassium-transporting ATPase A chain	NA	NA	NA	NA	NA
AUP71430.1|1153703_1155833_+	potassium-transporting ATPase subunit B	NA	M1HRW9	Paramecium_bursaria_Chlorella_virus	26.2	3.8e-23
AUP71431.1|1155832_1156402_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AUP71432.1|1156405_1157935_-	sensor histidine kinase	NA	NA	NA	NA	NA
AUP71433.1|1157942_1158716_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.3	2.3e-34
AUP71434.1|1160523_1160808_-	ESAT-6-like protein EsxI	NA	NA	NA	NA	NA
AUP71435.1|1160834_1161131_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
AUP71436.1|1161276_1162452_-	PPE family protein	NA	NA	NA	NA	NA
AUP71437.1|1162528_1163356_-	PE family protein	NA	NA	NA	NA	NA
AUP71438.1|1163916_1164165_+	hypothetical protein	NA	NA	NA	NA	NA
AUP71439.1|1164143_1164383_-	hypothetical protein	NA	NA	NA	NA	NA
AUP71440.1|1164288_1164507_-	hypothetical protein	NA	NA	NA	NA	NA
AUP74216.1|1164551_1165034_-|transposase	IS5 family transposase	transposase	A0A1V0SLQ8	Klosneuvirus	28.7	8.1e-06
AUP71441.1|1165071_1165470_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUP74217.1|1165760_1166786_-|protease	serine protease	protease	NA	NA	NA	NA
AUP71442.1|1167032_1167656_+	hypothetical protein	NA	NA	NA	NA	NA
AUP71443.1|1167652_1168534_+	hypothetical protein	NA	NA	NA	NA	NA
AUP71444.1|1168615_1169404_-	hypothetical protein	NA	NA	NA	NA	NA
AUP71445.1|1169403_1170651_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
AUP71446.1|1171018_1172134_-	hypothetical protein	NA	NA	NA	NA	NA
AUP71447.1|1172090_1172294_-	hypothetical protein	NA	NA	NA	NA	NA
AUP71448.1|1172366_1172813_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUP74218.1|1172861_1173767_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUP71449.1|1173925_1174681_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUP74219.1|1174975_1175602_-	hypothetical protein	NA	NA	NA	NA	NA
AUP71450.1|1175668_1175851_+	hypothetical protein	NA	NA	NA	NA	NA
AUP71451.1|1176546_1176885_+|integrase	integrase	integrase	NA	NA	NA	NA
AUP71452.1|1176908_1177223_+|integrase	integrase	integrase	Q854H9	Mycobacterium_phage	53.6	1.0e-09
1182303:1182319	attR	CGAGCAGACGCAAAATC	NA	NA	NA	NA
>prophage 3
CP025598	Mycobacterium tuberculosis strain GG-37-11 chromosome, complete genome	4411526	2941185	2976559	4411526	terminase,transposase,integrase,tRNA,capsid,protease,head	Tupanvirus(11.11%)	42	2969986:2970013	2980976:2981003
AUP72918.1|2941185_2943264_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
AUP72919.1|2943372_2943600_+	hypothetical protein	NA	NA	NA	NA	NA
AUP74405.1|2943596_2944982_-	PE family protein	NA	NA	NA	NA	NA
AUP72920.1|2945326_2945827_+	DUF1990 domain-containing protein	NA	NA	NA	NA	NA
AUP72921.1|2945843_2946284_-	DoxX family membrane protein	NA	NA	NA	NA	NA
AUP74406.1|2946430_2947108_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP72922.1|2947092_2947446_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AUP72923.1|2947458_2947884_-	hypothetical protein	NA	NA	NA	NA	NA
AUP72924.1|2947880_2948555_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP72925.1|2948632_2949454_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP72926.1|2949589_2950483_+	universal stress protein	NA	NA	NA	NA	NA
AUP74407.1|2950485_2951304_-	universal stress protein	NA	NA	NA	NA	NA
AUP72927.1|2951318_2952500_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AUP72928.1|2952558_2952990_-	hypoxic response protein 1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
AUP72929.1|2953503_2954745_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUP74408.1|2955054_2955417_+	hypothetical protein	NA	NA	NA	NA	NA
AUP72930.1|2955763_2956888_+	hypothetical protein	NA	NA	NA	NA	NA
AUP72931.1|2956889_2957429_+	archease	NA	NA	NA	NA	NA
AUP72932.1|2957568_2958867_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
AUP72933.1|2958905_2959187_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
AUP72934.1|2959331_2959817_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
AUP72935.1|2959843_2960101_-	hypothetical protein	NA	NA	NA	NA	NA
AUP72936.1|2960101_2962438_-	PE family protein	NA	NA	NA	NA	NA
AUP72937.1|2962466_2962709_+	hypothetical protein	NA	NA	NA	NA	NA
AUP72938.1|2962709_2963387_+	hypothetical protein	NA	NA	NA	NA	NA
AUP72939.1|2963582_2964239_+	DedA family protein	NA	NA	NA	NA	NA
AUP72940.1|2964401_2964848_+	STAS domain-containing protein	NA	NA	NA	NA	NA
AUP72941.1|2965022_2965355_-	YnfA family protein	NA	NA	NA	NA	NA
AUP72942.1|2965474_2965834_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP72943.1|2965935_2966394_+	cadmium-induced protein CadI	NA	NA	NA	NA	NA
AUP72944.1|2966529_2966910_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP72945.1|2966906_2968403_+	arsenical-resistance protein	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
AUP74409.1|2968592_2968829_+	DUF3018 domain-containing protein	NA	NA	NA	NA	NA
AUP72946.1|2968901_2969075_+	hypothetical protein	NA	NA	NA	NA	NA
2969986:2970013	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
AUP72947.1|2970119_2970551_+	hypothetical protein	NA	NA	NA	NA	NA
AUP72948.1|2970547_2971546_+|integrase	integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
AUP72949.1|2971559_2972024_+	hypothetical protein	NA	NA	NA	NA	NA
AUP72950.1|2972011_2972200_+	hypothetical protein	NA	NA	NA	NA	NA
AUP72951.1|2972156_2973417_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP72952.1|2973791_2975231_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
AUP74410.1|2975238_2975772_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
AUP72953.1|2975932_2976559_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980976:2981003	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 4
CP025598	Mycobacterium tuberculosis strain GG-37-11 chromosome, complete genome	4411526	3710452	3796381	4411526	transposase,tRNA	Burkholderia_virus(28.57%)	57	NA	NA
AUP73558.1|3710452_3711713_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP73559.1|3711951_3713481_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUP74517.1|3713413_3714352_-	RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
AUP73560.1|3714360_3715728_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.8	9.0e-18
AUP73561.1|3715796_3717014_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
AUP73562.1|3717109_3718618_+	MFS transporter	NA	NA	NA	NA	NA
AUP73563.1|3718614_3719766_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AUP73564.1|3719956_3720802_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
AUP74518.1|3720778_3721258_+	hypothetical protein	NA	NA	NA	NA	NA
AUP73565.1|3721276_3721717_+	Zn(2+)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUP73566.1|3721750_3722620_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
AUP73567.1|3722640_3723651_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUP73568.1|3723935_3724568_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUP73569.1|3724634_3725864_-	isocitrate dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AUP73570.1|3726146_3727496_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
AUP73571.1|3727507_3728647_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
AUP74519.1|3728643_3729375_+	methyltransferase	NA	NA	NA	NA	NA
AUP73572.1|3729383_3736955_-	PPE family protein	NA	NA	NA	NA	NA
AUP73573.1|3743208_3743466_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
AUP73574.1|3743721_3753195_-	PPE family protein	NA	NA	NA	NA	NA
AUP74521.1|3753232_3753724_-	hypothetical protein	NA	NA	NA	NA	NA
AUP74520.1|3753820_3754267_+|transposase	transposase	transposase	NA	NA	NA	NA
AUP73575.1|3754303_3755122_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP73576.1|3755338_3755575_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP74522.1|3755962_3767113_-	PPE family protein	NA	NA	NA	NA	NA
AUP73577.1|3767356_3768151_-	oxidoreductase	NA	NA	NA	NA	NA
AUP73578.1|3768232_3768604_-	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	56.4	3.3e-15
AUP73579.1|3768501_3768912_-	FAD-binding protein	NA	NA	NA	NA	NA
AUP74523.1|3768746_3769007_-	oxidoreductase	NA	NA	NA	NA	NA
AUP73580.1|3769121_3769511_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
AUP73581.1|3769524_3769818_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
AUP73582.1|3769814_3770660_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
AUP73583.1|3770783_3771059_+	antitoxin	NA	NA	NA	NA	NA
AUP73584.1|3771055_3771313_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AUP73585.1|3771354_3772545_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
AUP73586.1|3772661_3773030_+	hypothetical protein	NA	NA	NA	NA	NA
AUP73587.1|3773026_3773578_-	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
AUP73588.1|3773584_3774166_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AUP74524.1|3774146_3774515_-	DUF742 domain-containing protein	NA	NA	NA	NA	NA
AUP73589.1|3774492_3774885_-	dynein regulation protein LC7	NA	NA	NA	NA	NA
AUP73590.1|3774881_3777512_-	two-component system sensor histidine kinase EnvZ	NA	NA	NA	NA	NA
AUP73591.1|3777747_3778212_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AUP73592.1|3778578_3780354_+	PE family protein	NA	NA	NA	NA	NA
AUP73593.1|3780354_3780999_-	oxidoreductase	NA	NA	NA	NA	NA
AUP73594.1|3780997_3781432_+	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
AUP73595.1|3781520_3784760_-	DNA polymerase III subunit alpha	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.6e-118
AUP73596.1|3784951_3786292_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
AUP73597.1|3786333_3787509_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AUP73598.1|3787745_3788387_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUP73599.1|3788387_3788636_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUP73600.1|3788640_3790068_+	amidase	NA	NA	NA	NA	NA
AUP74525.1|3790175_3790829_+	haloacid dehalogenase	NA	NA	NA	NA	NA
AUP73601.1|3790867_3792373_-	type B diterpene cyclase	NA	NA	NA	NA	NA
AUP73602.1|3792377_3793268_-	diterpene synthase	NA	NA	NA	NA	NA
AUP73603.1|3793276_3794887_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUP73604.1|3794831_3795077_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUP73605.1|3795119_3796381_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
