The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025601	Mycobacterium tuberculosis strain GG-90-10 chromosome, complete genome	4411602	1125431	1177363	4411602	tRNA,protease,transposase,integrase	Klosneuvirus(18.18%)	54	1133254:1133270	1182312:1182328
AUP90957.1|1125431_1126991_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	2.8e-100
AUP93753.1|1127076_1127871_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
AUP90958.1|1128078_1129167_+	resuscitation-promoting factor RpfB	NA	Q856D9	Mycobacterium_phage	59.4	8.2e-22
AUP90959.1|1129139_1130093_+	ribosomal RNA small subunit methyltransferase A	NA	NA	NA	NA	NA
AUP93754.1|1130178_1131099_+	4-diphosphocytidyl-2C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AUP90960.1|1131115_1131409_+	hypothetical protein	NA	NA	NA	NA	NA
AUP93755.1|1131368_1131668_-	hypothetical protein	NA	NA	NA	NA	NA
AUP90961.1|1131612_1133247_+	polyketide synthase	NA	NA	NA	NA	NA
1133254:1133270	attL	CGAGCAGACGCAAAATC	NA	NA	NA	NA
AUP90962.1|1133320_1133896_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUP90963.1|1133908_1134556_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AUP90964.1|1134772_1135453_-	hypothetical protein	NA	NA	NA	NA	NA
AUP90965.1|1135488_1136469_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	32.7	1.8e-44
AUP90966.1|1136560_1138048_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	NA	NA	NA	NA
AUP93756.1|1138302_1138896_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUP90967.1|1138954_1142659_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
AUP90968.1|1142658_1143636_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AUP90969.1|1143723_1144455_+	murein transglycosylase B	NA	NA	NA	NA	NA
AUP90970.1|1144551_1145841_+	enolase	NA	W6LP63	Streptococcus_phage	56.4	6.1e-133
AUP90971.1|1145845_1146532_+	septation inhibitor protein	NA	NA	NA	NA	NA
AUP93757.1|1146548_1147016_+	DUF501 domain-containing protein	NA	NA	NA	NA	NA
AUP90972.1|1147006_1147966_+	exopolyphosphatase	NA	NA	NA	NA	NA
AUP90973.1|1148205_1148418_+	hypothetical protein	NA	NA	NA	NA	NA
AUP90974.1|1148414_1149095_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.6	4.2e-24
AUP90975.1|1149091_1151674_-	sensor protein KdpD	NA	NA	NA	NA	NA
AUP90976.1|1151764_1151911_+	potassium transporter Trk	NA	NA	NA	NA	NA
AUP93758.1|1151907_1152000_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUP90977.1|1151999_1153715_+	potassium-transporting ATPase A chain	NA	NA	NA	NA	NA
AUP90978.1|1153711_1155841_+	potassium-transporting ATPase subunit B	NA	M1HRW9	Paramecium_bursaria_Chlorella_virus	26.2	3.8e-23
AUP90979.1|1155840_1156410_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AUP90980.1|1156413_1157943_-	sensor histidine kinase	NA	NA	NA	NA	NA
AUP90981.1|1157950_1158724_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.3	2.3e-34
AUP90982.1|1160531_1160816_-	ESAT-6-like protein EsxI	NA	NA	NA	NA	NA
AUP90983.1|1161284_1162460_-	PPE family protein	NA	NA	NA	NA	NA
AUP90984.1|1162536_1163364_-	PE family protein	NA	NA	NA	NA	NA
AUP90985.1|1163924_1164173_+	hypothetical protein	NA	NA	NA	NA	NA
AUP90986.1|1164151_1164391_-	hypothetical protein	NA	NA	NA	NA	NA
AUP90987.1|1164296_1164515_-	hypothetical protein	NA	NA	NA	NA	NA
AUP93759.1|1164559_1165042_-	hypothetical protein	NA	A0A1V0SLQ8	Klosneuvirus	28.7	1.1e-05
AUP90988.1|1165079_1165478_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUP93760.1|1165769_1166795_-|protease	serine protease	protease	NA	NA	NA	NA
AUP90989.1|1167041_1167665_+	hypothetical protein	NA	NA	NA	NA	NA
AUP93761.1|1167661_1168543_+	hypothetical protein	NA	NA	NA	NA	NA
AUP90990.1|1168624_1169413_-	hypothetical protein	NA	NA	NA	NA	NA
AUP90991.1|1169412_1170660_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
AUP90992.1|1171027_1172143_-	hypothetical protein	NA	NA	NA	NA	NA
AUP90993.1|1172099_1172303_-	hypothetical protein	NA	NA	NA	NA	NA
AUP90994.1|1172375_1172822_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUP93762.1|1172870_1173776_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUP90995.1|1173934_1174690_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUP93763.1|1174984_1175611_-	hypothetical protein	NA	NA	NA	NA	NA
AUP90996.1|1175677_1175860_+	hypothetical protein	NA	NA	NA	NA	NA
AUP90997.1|1176555_1176894_+|integrase	integrase	integrase	NA	NA	NA	NA
AUP90998.1|1176917_1177232_+|integrase	integrase	integrase	Q854H9	Mycobacterium_phage	53.6	1.0e-09
AUP90999.1|1177168_1177363_+|integrase	integrase	integrase	A0A2H4JG32	uncultured_Caudovirales_phage	54.5	3.8e-07
1182312:1182328	attR	CGAGCAGACGCAAAATC	NA	NA	NA	NA
>prophage 2
CP025601	Mycobacterium tuberculosis strain GG-90-10 chromosome, complete genome	4411602	2941212	2976586	4411602	capsid,protease,transposase,integrase,tRNA,head,terminase	Tupanvirus(11.11%)	43	2970013:2970040	2981003:2981030
AUP92465.1|2941212_2943291_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
AUP92466.1|2943399_2943627_+	hypothetical protein	NA	NA	NA	NA	NA
AUP93955.1|2943623_2945009_-	PE family protein	NA	NA	NA	NA	NA
AUP92467.1|2945353_2945854_+	DUF1990 domain-containing protein	NA	NA	NA	NA	NA
AUP92468.1|2945870_2946311_-	DoxX family membrane protein	NA	NA	NA	NA	NA
AUP93956.1|2946457_2947135_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP92469.1|2947119_2947473_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AUP92470.1|2947485_2947911_-	hypothetical protein	NA	NA	NA	NA	NA
AUP92471.1|2947907_2948582_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP92472.1|2948659_2949481_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP92473.1|2949616_2950510_+	universal stress protein	NA	NA	NA	NA	NA
AUP93957.1|2950512_2951331_-	universal stress protein	NA	NA	NA	NA	NA
AUP92474.1|2951345_2952527_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AUP92475.1|2952585_2953017_-	hypoxic response protein 1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
AUP92476.1|2953530_2954772_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUP93958.1|2955081_2955444_+	hypothetical protein	NA	NA	NA	NA	NA
AUP92477.1|2955790_2956915_+	hypothetical protein	NA	NA	NA	NA	NA
AUP92478.1|2956916_2957456_+	archease	NA	NA	NA	NA	NA
AUP92479.1|2957595_2958894_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
AUP92480.1|2958932_2959214_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
AUP92481.1|2959358_2959844_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
AUP92482.1|2959870_2960128_-	hypothetical protein	NA	NA	NA	NA	NA
AUP92483.1|2960128_2962465_-	PE family protein	NA	NA	NA	NA	NA
AUP92484.1|2962493_2962736_+	hypothetical protein	NA	NA	NA	NA	NA
AUP92485.1|2962736_2963414_+	hypothetical protein	NA	NA	NA	NA	NA
AUP92486.1|2963609_2964266_+	DedA family protein	NA	NA	NA	NA	NA
AUP92487.1|2964428_2964875_+	STAS domain-containing protein	NA	NA	NA	NA	NA
AUP92488.1|2965049_2965382_-	YnfA family protein	NA	NA	NA	NA	NA
AUP92489.1|2965501_2965861_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP92490.1|2965962_2966421_+	cadmium-induced protein CadI	NA	NA	NA	NA	NA
AUP92491.1|2966556_2966937_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP92492.1|2966933_2968430_+	arsenical-resistance protein	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
AUP93959.1|2968619_2968856_+	DUF3018 domain-containing protein	NA	NA	NA	NA	NA
AUP92493.1|2968928_2969102_+	hypothetical protein	NA	NA	NA	NA	NA
2970013:2970040	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
AUP92494.1|2970146_2970578_+	hypothetical protein	NA	NA	NA	NA	NA
AUP92495.1|2970574_2971573_+|integrase	integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
AUP92496.1|2971586_2972051_+	hypothetical protein	NA	NA	NA	NA	NA
AUP92497.1|2972038_2972227_+	hypothetical protein	NA	NA	NA	NA	NA
AUP92498.1|2972183_2973444_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP92499.1|2973471_2973717_-	hypothetical protein	NA	NA	NA	NA	NA
AUP92500.1|2973818_2975258_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
AUP93960.1|2975265_2975799_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
AUP92501.1|2975959_2976586_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2981003:2981030	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 3
CP025601	Mycobacterium tuberculosis strain GG-90-10 chromosome, complete genome	4411602	3710475	3796413	4411602	tRNA,transposase	Burkholderia_virus(28.57%)	57	NA	NA
AUP93105.1|3710475_3711736_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP93106.1|3711974_3713504_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUP94066.1|3713436_3714375_-	RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
AUP93107.1|3714383_3715751_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.8	9.0e-18
AUP93108.1|3715819_3717037_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
AUP93109.1|3717132_3718641_+	MFS transporter	NA	NA	NA	NA	NA
AUP93110.1|3718637_3719789_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AUP93111.1|3719979_3720825_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
AUP94067.1|3720801_3721281_+	hypothetical protein	NA	NA	NA	NA	NA
AUP93112.1|3721299_3721740_+	Zn(2+)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUP93113.1|3721773_3722643_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
AUP93114.1|3722663_3723674_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUP93115.1|3723958_3724591_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUP93116.1|3724657_3725887_-	isocitrate dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AUP93117.1|3726169_3727519_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
AUP93118.1|3727530_3728670_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
AUP94068.1|3728666_3729398_+	methyltransferase	NA	NA	NA	NA	NA
AUP93119.1|3729406_3736978_-	hypothetical protein	NA	NA	NA	NA	NA
AUP93120.1|3743240_3743498_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
AUP93121.1|3743753_3753227_-	PPE family protein	NA	NA	NA	NA	NA
AUP94070.1|3753264_3753756_-	hypothetical protein	NA	NA	NA	NA	NA
AUP94069.1|3753852_3754299_+|transposase	transposase	transposase	NA	NA	NA	NA
AUP93122.1|3754335_3755154_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP93123.1|3755370_3755607_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP93124.1|3755994_3767145_-	PPE family protein	NA	NA	NA	NA	NA
AUP93125.1|3767388_3768183_-	oxidoreductase	NA	NA	NA	NA	NA
AUP93126.1|3768264_3768636_-	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	56.4	3.3e-15
AUP93127.1|3768533_3768944_-	FAD-binding protein	NA	NA	NA	NA	NA
AUP94071.1|3768778_3769039_-	oxidoreductase	NA	NA	NA	NA	NA
AUP93128.1|3769153_3769543_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
AUP93129.1|3769556_3769850_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
AUP93130.1|3769846_3770692_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
AUP93131.1|3770815_3771091_+	antitoxin	NA	NA	NA	NA	NA
AUP93132.1|3771087_3771345_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AUP93133.1|3771386_3772577_+	oxidoreductase	NA	NA	NA	NA	NA
AUP93134.1|3772693_3773062_+	hypothetical protein	NA	NA	NA	NA	NA
AUP93135.1|3773058_3773610_-	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
AUP93136.1|3773616_3774198_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AUP94072.1|3774178_3774547_-	DUF742 domain-containing protein	NA	NA	NA	NA	NA
AUP93137.1|3774524_3774917_-	dynein regulation protein LC7	NA	NA	NA	NA	NA
AUP93138.1|3774913_3777544_-	two-component system sensor histidine kinase EnvZ	NA	NA	NA	NA	NA
AUP93139.1|3777779_3778244_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AUP93140.1|3778610_3780386_+	PE family protein	NA	NA	NA	NA	NA
AUP93141.1|3780386_3781031_-	oxidoreductase	NA	NA	NA	NA	NA
AUP93142.1|3781029_3781464_+	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
AUP93143.1|3781552_3784792_-	DNA polymerase III subunit alpha	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.6e-118
AUP93144.1|3784983_3786324_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
AUP93145.1|3786365_3787541_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AUP93146.1|3787777_3788419_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUP93147.1|3788419_3788668_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUP93148.1|3788672_3790100_+	amidase	NA	NA	NA	NA	NA
AUP94073.1|3790207_3790861_+	haloacid dehalogenase	NA	NA	NA	NA	NA
AUP93149.1|3790899_3792405_-	type B diterpene cyclase	NA	NA	NA	NA	NA
AUP93150.1|3792409_3793300_-	diterpene synthase	NA	NA	NA	NA	NA
AUP93151.1|3793308_3794919_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUP93152.1|3794863_3795109_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUP93153.1|3795151_3796413_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
