The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025600	Mycobacterium tuberculosis strain 77-11 chromosome, complete genome	4411508	1125390	1177191	4411508	tRNA,protease,transposase,integrase	Klosneuvirus(20.0%)	54	1133213:1133229	1182271:1182287
AUP86812.1|1125390_1126950_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	2.8e-100
AUP89609.1|1127035_1127830_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
AUP86813.1|1128037_1129126_+	resuscitation-promoting factor RpfB	NA	Q856D9	Mycobacterium_phage	59.4	8.2e-22
AUP86814.1|1129098_1130052_+	ribosomal RNA small subunit methyltransferase A	NA	NA	NA	NA	NA
AUP89610.1|1130137_1131058_+	4-diphosphocytidyl-2C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AUP86815.1|1131074_1131368_+	hypothetical protein	NA	NA	NA	NA	NA
AUP89611.1|1131327_1131627_-	hypothetical protein	NA	NA	NA	NA	NA
AUP86816.1|1131571_1133206_+	polyketide synthase	NA	NA	NA	NA	NA
1133213:1133229	attL	CGAGCAGACGCAAAATC	NA	NA	NA	NA
AUP86817.1|1133279_1133855_-|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUP86818.1|1133867_1134515_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AUP86819.1|1134731_1135412_-	hypothetical protein	NA	NA	NA	NA	NA
AUP86820.1|1135447_1136428_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	32.7	1.8e-44
AUP86821.1|1136519_1138007_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	NA	NA	NA	NA
AUP86822.1|1138261_1138855_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUP86823.1|1138913_1142618_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
AUP86824.1|1142617_1143595_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AUP86825.1|1143682_1144414_+	murein transglycosylase B	NA	NA	NA	NA	NA
AUP86826.1|1144510_1145800_+	enolase	NA	W6LP63	Streptococcus_phage	56.6	2.1e-133
AUP86827.1|1145804_1146491_+	septation inhibitor protein	NA	NA	NA	NA	NA
AUP89612.1|1146507_1146975_+	DUF501 domain-containing protein	NA	NA	NA	NA	NA
AUP86828.1|1146965_1147925_+	exopolyphosphatase	NA	NA	NA	NA	NA
AUP86829.1|1148164_1148377_+	hypothetical protein	NA	NA	NA	NA	NA
AUP86830.1|1148373_1149054_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.6	4.2e-24
AUP86831.1|1149050_1151633_-	sensor protein KdpD	NA	NA	NA	NA	NA
AUP86832.1|1151723_1151870_+	potassium transporter Trk	NA	NA	NA	NA	NA
AUP89613.1|1151866_1151959_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUP86833.1|1151958_1153674_+	potassium-transporting ATPase A chain	NA	NA	NA	NA	NA
AUP86834.1|1153670_1155800_+	potassium-transporting ATPase subunit B	NA	M1HRW9	Paramecium_bursaria_Chlorella_virus	26.2	3.8e-23
AUP86835.1|1155799_1156369_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AUP86836.1|1156372_1157902_-	sensor histidine kinase	NA	NA	NA	NA	NA
AUP86837.1|1157909_1158683_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.3	2.3e-34
AUP86838.1|1160490_1160775_-	ESAT-6-like protein EsxI	NA	NA	NA	NA	NA
AUP86839.1|1160801_1161098_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
AUP86840.1|1161243_1162419_-	PPE family protein	NA	NA	NA	NA	NA
AUP86841.1|1162495_1163323_-	PE family protein	NA	NA	NA	NA	NA
AUP86842.1|1163883_1164132_+	hypothetical protein	NA	NA	NA	NA	NA
AUP86843.1|1164110_1164350_-	hypothetical protein	NA	NA	NA	NA	NA
AUP86844.1|1164255_1164474_-	hypothetical protein	NA	NA	NA	NA	NA
AUP89614.1|1164518_1165001_-|transposase	IS5 family transposase	transposase	A0A1V0SLQ8	Klosneuvirus	28.7	8.1e-06
AUP86845.1|1165038_1165437_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUP89615.1|1165728_1166754_-|protease	serine protease	protease	NA	NA	NA	NA
AUP86846.1|1167000_1167624_+	hypothetical protein	NA	NA	NA	NA	NA
AUP86847.1|1167620_1168502_+	hypothetical protein	NA	NA	NA	NA	NA
AUP86848.1|1168583_1169372_-	hypothetical protein	NA	NA	NA	NA	NA
AUP86849.1|1169371_1170619_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
AUP86850.1|1170986_1172102_-	hypothetical protein	NA	NA	NA	NA	NA
AUP86851.1|1172058_1172262_-	hypothetical protein	NA	NA	NA	NA	NA
AUP86852.1|1172334_1172781_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUP89616.1|1172829_1173735_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUP86853.1|1173893_1174649_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUP89617.1|1174943_1175570_-	hypothetical protein	NA	NA	NA	NA	NA
AUP86854.1|1175636_1175819_+	hypothetical protein	NA	NA	NA	NA	NA
AUP86855.1|1176514_1176853_+|integrase	integrase	integrase	NA	NA	NA	NA
AUP89618.1|1176876_1177191_+|integrase	integrase	integrase	Q854H9	Mycobacterium_phage	53.6	1.0e-09
1182271:1182287	attR	CGAGCAGACGCAAAATC	NA	NA	NA	NA
>prophage 2
CP025600	Mycobacterium tuberculosis strain 77-11 chromosome, complete genome	4411508	2941168	2976534	4411508	transposase,capsid,tRNA,protease,head,integrase,terminase	Tupanvirus(11.11%)	42	2969969:2969996	2980951:2980978
AUP88313.1|2941168_2943247_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
AUP88314.1|2943355_2943583_+	hypothetical protein	NA	NA	NA	NA	NA
AUP88315.1|2943579_2944965_-	PE family protein	NA	NA	NA	NA	NA
AUP88316.1|2945309_2945810_+	DUF1990 domain-containing protein	NA	NA	NA	NA	NA
AUP88317.1|2945826_2946267_-	DoxX family membrane protein	NA	NA	NA	NA	NA
AUP89818.1|2946413_2947091_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP88318.1|2947075_2947429_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AUP88319.1|2947441_2947867_-	hypothetical protein	NA	NA	NA	NA	NA
AUP88320.1|2947863_2948538_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP88321.1|2948615_2949437_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP88322.1|2949572_2950466_+	universal stress protein	NA	NA	NA	NA	NA
AUP89819.1|2950468_2951287_-	universal stress protein	NA	NA	NA	NA	NA
AUP88323.1|2951301_2952483_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AUP88324.1|2952541_2952973_-	hypoxic response protein 1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
AUP88325.1|2953486_2954728_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUP89820.1|2955037_2955400_+	hypothetical protein	NA	NA	NA	NA	NA
AUP88326.1|2955746_2956871_+	hypothetical protein	NA	NA	NA	NA	NA
AUP88327.1|2956872_2957412_+	archease	NA	NA	NA	NA	NA
AUP88328.1|2957551_2958850_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
AUP88329.1|2958888_2959170_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
AUP88330.1|2959314_2959800_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
AUP88331.1|2959826_2960084_-	hypothetical protein	NA	NA	NA	NA	NA
AUP88332.1|2960084_2962421_-	PE family protein	NA	NA	NA	NA	NA
AUP88333.1|2962449_2962692_+	hypothetical protein	NA	NA	NA	NA	NA
AUP88334.1|2962692_2963370_+	hypothetical protein	NA	NA	NA	NA	NA
AUP88335.1|2963565_2964222_+	DedA family protein	NA	NA	NA	NA	NA
AUP88336.1|2964384_2964831_+	STAS domain-containing protein	NA	NA	NA	NA	NA
AUP88337.1|2965005_2965338_-	YnfA family protein	NA	NA	NA	NA	NA
AUP88338.1|2965457_2965817_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP88339.1|2965918_2966377_+	cadmium-induced protein CadI	NA	NA	NA	NA	NA
AUP88340.1|2966512_2966893_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP88341.1|2966889_2968386_+	arsenical-resistance protein	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
AUP89821.1|2968575_2968812_+	DUF3018 domain-containing protein	NA	NA	NA	NA	NA
AUP88342.1|2968884_2969058_+	hypothetical protein	NA	NA	NA	NA	NA
2969969:2969996	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
AUP88343.1|2970102_2970534_+	hypothetical protein	NA	NA	NA	NA	NA
AUP88344.1|2970530_2971529_+|integrase	integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
AUP88345.1|2971542_2972007_+	hypothetical protein	NA	NA	NA	NA	NA
AUP88346.1|2971994_2972183_+	hypothetical protein	NA	NA	NA	NA	NA
AUP88347.1|2972139_2973400_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP88348.1|2973774_2975214_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
AUP89822.1|2975221_2975755_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
AUP88349.1|2975907_2976534_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980951:2980978	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 3
CP025600	Mycobacterium tuberculosis strain 77-11 chromosome, complete genome	4411508	3710427	3796356	4411508	tRNA,transposase	Burkholderia_virus(28.57%)	57	NA	NA
AUP88956.1|3710427_3711688_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP88957.1|3711926_3713456_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUP89927.1|3713388_3714327_-	RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
AUP88958.1|3714335_3715703_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.8	9.0e-18
AUP88959.1|3715771_3716989_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
AUP88960.1|3717084_3718593_+	MFS transporter	NA	NA	NA	NA	NA
AUP88961.1|3718589_3719741_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AUP88962.1|3719931_3720777_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
AUP89928.1|3720753_3721233_+	hypothetical protein	NA	NA	NA	NA	NA
AUP88963.1|3721251_3721692_+	Zn(2+)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUP88964.1|3721725_3722595_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
AUP88965.1|3722615_3723626_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUP88966.1|3723910_3724543_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUP88967.1|3724609_3725839_-	isocitrate dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AUP88968.1|3726121_3727471_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
AUP88969.1|3727482_3728622_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
AUP89929.1|3728618_3729350_+	methyltransferase	NA	NA	NA	NA	NA
AUP88970.1|3729358_3736930_-	PPE family protein	NA	NA	NA	NA	NA
AUP88971.1|3743183_3743441_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
AUP88972.1|3743696_3753170_-	PPE family protein	NA	NA	NA	NA	NA
AUP89931.1|3753207_3753699_-	hypothetical protein	NA	NA	NA	NA	NA
AUP89930.1|3753795_3754242_+|transposase	transposase	transposase	NA	NA	NA	NA
AUP88973.1|3754278_3755097_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP88974.1|3755313_3755550_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP89932.1|3755937_3767088_-	hypothetical protein	NA	NA	NA	NA	NA
AUP88975.1|3767331_3768126_-	oxidoreductase	NA	NA	NA	NA	NA
AUP88976.1|3768207_3768579_-	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	56.4	3.3e-15
AUP88977.1|3768476_3768887_-	FAD-binding protein	NA	NA	NA	NA	NA
AUP89933.1|3768721_3768982_-	oxidoreductase	NA	NA	NA	NA	NA
AUP88978.1|3769096_3769486_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
AUP88979.1|3769499_3769793_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
AUP88980.1|3769789_3770635_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
AUP88981.1|3770758_3771034_+	antitoxin	NA	NA	NA	NA	NA
AUP88982.1|3771030_3771288_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AUP88983.1|3771329_3772520_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
AUP88984.1|3772636_3773005_+	hypothetical protein	NA	NA	NA	NA	NA
AUP88985.1|3773001_3773553_-	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
AUP88986.1|3773559_3774141_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AUP88987.1|3774121_3774490_-	DUF742 domain-containing protein	NA	NA	NA	NA	NA
AUP88988.1|3774467_3774860_-	dynein regulation protein LC7	NA	NA	NA	NA	NA
AUP88989.1|3774856_3777487_-	two-component system sensor histidine kinase EnvZ	NA	NA	NA	NA	NA
AUP88990.1|3777722_3778187_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AUP88991.1|3778553_3780329_+	PE family protein	NA	NA	NA	NA	NA
AUP88992.1|3780329_3780974_-	oxidoreductase	NA	NA	NA	NA	NA
AUP88993.1|3780972_3781407_+	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
AUP88994.1|3781495_3784735_-	DNA polymerase III subunit alpha	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.6e-118
AUP88995.1|3784926_3786267_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
AUP88996.1|3786308_3787484_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AUP88997.1|3787720_3788362_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUP88998.1|3788362_3788611_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUP88999.1|3788615_3790043_+	amidase	NA	NA	NA	NA	NA
AUP89934.1|3790150_3790804_+	haloacid dehalogenase	NA	NA	NA	NA	NA
AUP89000.1|3790842_3792348_-	type B diterpene cyclase	NA	NA	NA	NA	NA
AUP89001.1|3792352_3793243_-	diterpene synthase	NA	NA	NA	NA	NA
AUP89002.1|3793251_3794862_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUP89003.1|3794806_3795043_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUP89004.1|3795094_3796356_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
