The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025595	Mycobacterium tuberculosis strain GG-20-11 chromosome, complete genome	4411504	889052	947616	4411504	bacteriocin,tRNA,protease,transposase	Burkholderia_virus(16.67%)	59	NA	NA
AUP58801.1|889052_890313_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP58802.1|890368_891463_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUP58803.1|891452_892250_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AUP58804.1|892246_893254_-	peroxidase	NA	NA	NA	NA	NA
AUP58805.1|893298_894600_+	m18 family aminopeptidase	NA	NA	NA	NA	NA
AUP58806.1|894611_894959_+	VOC family protein	NA	NA	NA	NA	NA
AUP58807.1|894952_895609_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUP61762.1|895800_898065_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	8.1e-274
AUP58808.1|898061_898691_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUP58809.1|898811_899768_+	phosphodiesterase	NA	NA	NA	NA	NA
AUP58810.1|899712_901311_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
AUP58811.1|901615_902005_+	hypothetical protein	NA	NA	NA	NA	NA
AUP58812.1|902091_903675_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
AUP58813.1|903705_904800_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
AUP58814.1|904885_905068_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
AUP58815.1|905214_906321_-	folate-binding protein	NA	NA	NA	NA	NA
AUP61763.1|906403_907273_+	4-amino-4-deoxychorismate lyase	NA	NA	NA	NA	NA
AUP58816.1|907318_907999_-	FABP family protein	NA	NA	NA	NA	NA
AUP58817.1|908161_908464_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
AUP61764.1|908465_909299_-	sulfurtransferase	NA	NA	NA	NA	NA
AUP58818.1|909591_910014_-	thioredoxin	NA	NA	NA	NA	NA
AUP58819.1|910010_910823_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
AUP61765.1|910952_911720_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
AUP58820.1|911716_912664_+	mycothiol synthase	NA	NA	NA	NA	NA
AUP58821.1|912706_913483_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
AUP58822.1|913538_914180_-	phosphate-specific transport system accessory protein PhoU	NA	NA	NA	NA	NA
AUP58823.1|914237_916292_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AUP58824.1|916457_917627_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
AUP58825.1|917714_918731_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
AUP58826.1|918892_919534_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUP61766.1|919614_920670_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
AUP58827.1|920721_921114_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP58828.1|921171_921594_-	nucleoside deaminase	NA	NA	NA	NA	NA
AUP58829.1|921555_921846_+|transposase	transposase	transposase	NA	NA	NA	NA
AUP58830.1|921950_922856_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP58831.1|922874_923690_-	TIGR04255 family protein	NA	NA	NA	NA	NA
AUP58832.1|924931_925345_+	PE family protein	NA	NA	NA	NA	NA
AUP58833.1|925341_927591_+	PE family protein	NA	NA	NA	NA	NA
AUP58834.1|927609_927789_+	hypothetical protein	NA	NA	NA	NA	NA
AUP58835.1|927817_930457_-	PE family protein	NA	NA	NA	NA	NA
AUP58836.1|930924_931569_+	sensor domain-containing protein	NA	NA	NA	NA	NA
AUP58837.1|931549_932101_-	hypothetical protein	NA	NA	NA	NA	NA
AUP61767.1|932250_932904_-	hypothetical protein	NA	NA	NA	NA	NA
AUP58838.1|932974_934003_-	hypothetical protein	NA	NA	NA	NA	NA
AUP58839.1|934264_934453_-	hypothetical protein	NA	NA	NA	NA	NA
AUP58840.1|934691_935462_+	D-Ala-D-Ala dipeptidase VanX	NA	NA	NA	NA	NA
AUP58841.1|935548_936361_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP58842.1|936428_937289_-	proline iminopeptidase	NA	NA	NA	NA	NA
AUP58843.1|937376_937640_+	hypothetical protein	NA	NA	NA	NA	NA
AUP58844.1|937564_937807_+	hypothetical protein	NA	NA	NA	NA	NA
AUP61768.1|938083_939376_+	MFS transporter	NA	NA	NA	NA	NA
AUP58845.1|939359_940364_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
AUP58846.1|940427_941078_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUP58847.1|941161_942439_+	sensor histidine kinase	NA	NA	NA	NA	NA
AUP58848.1|942651_944166_-	oxidase	NA	NA	NA	NA	NA
AUP61769.1|944314_944707_+	hypothetical protein	NA	NA	NA	NA	NA
AUP61770.1|944909_946028_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
AUP58849.1|946027_947287_+	MFS transporter	NA	NA	NA	NA	NA
AUP61771.1|947283_947616_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP025595	Mycobacterium tuberculosis strain GG-20-11 chromosome, complete genome	4411504	1125418	1177218	4411504	tRNA,integrase,protease,transposase	Klosneuvirus(20.0%)	53	1133241:1133257	1182298:1182314
AUP59001.1|1125418_1126978_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	2.8e-100
AUP61791.1|1127063_1127858_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
AUP59002.1|1128065_1129154_+	resuscitation-promoting factor RpfB	NA	Q856D9	Mycobacterium_phage	59.4	8.2e-22
AUP59003.1|1129126_1130080_+	ribosomal RNA small subunit methyltransferase A	NA	NA	NA	NA	NA
AUP61792.1|1130165_1131086_+	4-diphosphocytidyl-2C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AUP59004.1|1131102_1131396_+	hypothetical protein	NA	NA	NA	NA	NA
AUP61793.1|1131355_1131655_-	hypothetical protein	NA	NA	NA	NA	NA
AUP59005.1|1131599_1133234_+	polyketide synthase	NA	NA	NA	NA	NA
1133241:1133257	attL	CGAGCAGACGCAAAATC	NA	NA	NA	NA
AUP59006.1|1133307_1133883_-|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUP59007.1|1133895_1134543_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AUP59008.1|1134759_1135440_-	hypothetical protein	NA	NA	NA	NA	NA
AUP59009.1|1135475_1136456_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	32.7	1.8e-44
AUP59010.1|1136547_1138035_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	NA	NA	NA	NA
AUP61794.1|1138289_1138883_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUP59011.1|1138941_1142646_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
AUP59012.1|1142645_1143623_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AUP59013.1|1143710_1144442_+	murein transglycosylase B	NA	NA	NA	NA	NA
AUP59014.1|1144538_1145828_+	enolase	NA	W6LP63	Streptococcus_phage	56.6	2.1e-133
AUP59015.1|1145832_1146519_+	septation inhibitor protein	NA	NA	NA	NA	NA
AUP61795.1|1146535_1147003_+	DUF501 domain-containing protein	NA	NA	NA	NA	NA
AUP59016.1|1146993_1147953_+	exopolyphosphatase	NA	NA	NA	NA	NA
AUP59017.1|1148192_1148405_+	hypothetical protein	NA	NA	NA	NA	NA
AUP59018.1|1148401_1149082_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.6	4.2e-24
AUP59019.1|1149078_1151661_-	sensor protein KdpD	NA	NA	NA	NA	NA
AUP59020.1|1151751_1151898_+	potassium transporter Trk	NA	NA	NA	NA	NA
AUP61796.1|1151894_1151987_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUP59021.1|1151986_1153702_+	potassium-transporting ATPase A chain	NA	NA	NA	NA	NA
AUP59022.1|1153698_1155828_+	potassium-transporting ATPase subunit B	NA	M1HRW9	Paramecium_bursaria_Chlorella_virus	26.2	3.8e-23
AUP59023.1|1155827_1156397_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AUP59024.1|1156400_1157930_-	sensor histidine kinase	NA	NA	NA	NA	NA
AUP59025.1|1157937_1158711_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.3	2.3e-34
AUP59026.1|1160518_1160803_-	ESAT-6-like protein EsxI	NA	NA	NA	NA	NA
AUP59027.1|1160829_1161126_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
AUP59028.1|1161271_1162447_-	PPE family protein	NA	NA	NA	NA	NA
AUP59029.1|1162523_1163351_-	PE family protein	NA	NA	NA	NA	NA
AUP59030.1|1163911_1164160_+	hypothetical protein	NA	NA	NA	NA	NA
AUP59031.1|1164138_1164378_-	hypothetical protein	NA	NA	NA	NA	NA
AUP59032.1|1164283_1164502_-	hypothetical protein	NA	NA	NA	NA	NA
AUP61797.1|1164546_1165029_-|transposase	IS5 family transposase	transposase	A0A1V0SLQ8	Klosneuvirus	28.7	8.1e-06
AUP59033.1|1165066_1165465_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUP61798.1|1165756_1166782_-|protease	serine protease	protease	NA	NA	NA	NA
AUP59034.1|1167028_1167652_+	hypothetical protein	NA	NA	NA	NA	NA
AUP59035.1|1167648_1168530_+	hypothetical protein	NA	NA	NA	NA	NA
AUP59036.1|1169398_1170646_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
AUP59037.1|1171013_1172129_-	hypothetical protein	NA	NA	NA	NA	NA
AUP59038.1|1172085_1172289_-	hypothetical protein	NA	NA	NA	NA	NA
AUP59039.1|1172361_1172808_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUP61799.1|1172856_1173762_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUP59040.1|1173920_1174676_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUP61800.1|1174970_1175597_-	hypothetical protein	NA	NA	NA	NA	NA
AUP59041.1|1175663_1175846_+	hypothetical protein	NA	NA	NA	NA	NA
AUP59042.1|1176541_1176880_+|integrase	integrase	integrase	NA	NA	NA	NA
AUP59043.1|1176903_1177218_+|integrase	integrase	integrase	Q854H9	Mycobacterium_phage	53.6	1.0e-09
1182298:1182314	attR	CGAGCAGACGCAAAATC	NA	NA	NA	NA
>prophage 3
CP025595	Mycobacterium tuberculosis strain GG-20-11 chromosome, complete genome	4411504	2941175	2976541	4411504	tRNA,capsid,integrase,terminase,head,protease,transposase	Tupanvirus(11.11%)	42	2969976:2970003	2980958:2980985
AUP60509.1|2941175_2943254_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
AUP60510.1|2943362_2943590_+	hypothetical protein	NA	NA	NA	NA	NA
AUP61991.1|2943586_2944972_-	PE family protein	NA	NA	NA	NA	NA
AUP60511.1|2945316_2945817_+	DUF1990 domain-containing protein	NA	NA	NA	NA	NA
AUP60512.1|2945833_2946274_-	DoxX family membrane protein	NA	NA	NA	NA	NA
AUP61992.1|2946420_2947098_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP60513.1|2947082_2947436_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AUP60514.1|2947448_2947874_-	hypothetical protein	NA	NA	NA	NA	NA
AUP60515.1|2947870_2948545_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP60516.1|2948622_2949444_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP60517.1|2949579_2950473_+	universal stress protein	NA	NA	NA	NA	NA
AUP61993.1|2950475_2951294_-	universal stress protein	NA	NA	NA	NA	NA
AUP60518.1|2951308_2952490_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AUP60519.1|2952548_2952980_-	hypoxic response protein 1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
AUP60520.1|2953493_2954735_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUP61994.1|2955149_2955407_+	hypothetical protein	NA	NA	NA	NA	NA
AUP60521.1|2955753_2956878_+	hypothetical protein	NA	NA	NA	NA	NA
AUP60522.1|2956879_2957419_+	archease	NA	NA	NA	NA	NA
AUP60523.1|2957558_2958857_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
AUP60524.1|2958895_2959177_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
AUP60525.1|2959321_2959807_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
AUP60526.1|2959833_2960091_-	hypothetical protein	NA	NA	NA	NA	NA
AUP60527.1|2960091_2962428_-	PE family protein	NA	NA	NA	NA	NA
AUP60528.1|2962456_2962699_+	hypothetical protein	NA	NA	NA	NA	NA
AUP60529.1|2962699_2963377_+	hypothetical protein	NA	NA	NA	NA	NA
AUP60530.1|2963572_2964229_+	DedA family protein	NA	NA	NA	NA	NA
AUP60531.1|2964391_2964838_+	STAS domain-containing protein	NA	NA	NA	NA	NA
AUP60532.1|2965012_2965345_-	YnfA family protein	NA	NA	NA	NA	NA
AUP60533.1|2965464_2965824_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP60534.1|2965925_2966384_+	cadmium-induced protein CadI	NA	NA	NA	NA	NA
AUP60535.1|2966519_2966900_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP60536.1|2966896_2968393_+	arsenical-resistance protein	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
AUP61995.1|2968582_2968819_+	DUF3018 domain-containing protein	NA	NA	NA	NA	NA
AUP60537.1|2968891_2969065_+	hypothetical protein	NA	NA	NA	NA	NA
2969976:2970003	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
AUP60538.1|2970109_2970541_+	hypothetical protein	NA	NA	NA	NA	NA
AUP60539.1|2970537_2971536_+|integrase	integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
AUP60540.1|2971549_2972014_+	hypothetical protein	NA	NA	NA	NA	NA
AUP60541.1|2972001_2972190_+	hypothetical protein	NA	NA	NA	NA	NA
AUP60542.1|2972146_2973407_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP60543.1|2973781_2975221_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
AUP61996.1|2975228_2975762_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
AUP60544.1|2975914_2976541_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980958:2980985	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 4
CP025595	Mycobacterium tuberculosis strain GG-20-11 chromosome, complete genome	4411504	3710434	3796354	4411504	tRNA,transposase	Burkholderia_virus(28.57%)	57	NA	NA
AUP61148.1|3710434_3711695_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP61149.1|3711933_3713463_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUP62102.1|3713395_3714334_-	RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
AUP61150.1|3714342_3715710_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.8	9.0e-18
AUP61151.1|3715778_3716996_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
AUP61152.1|3717091_3718600_+	MFS transporter	NA	NA	NA	NA	NA
AUP61153.1|3718596_3719748_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AUP61154.1|3719938_3720784_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
AUP62103.1|3720760_3721240_+	hypothetical protein	NA	NA	NA	NA	NA
AUP61155.1|3721258_3721699_+	Zn(2+)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUP61156.1|3721732_3722602_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
AUP61157.1|3722622_3723633_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUP61158.1|3723917_3724550_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUP61159.1|3724616_3725846_-	isocitrate dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AUP61160.1|3726128_3727478_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
AUP61161.1|3727489_3728629_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
AUP62104.1|3728625_3729357_+	methyltransferase	NA	NA	NA	NA	NA
AUP61162.1|3729365_3736937_-	hypothetical protein	NA	NA	NA	NA	NA
AUP61163.1|3743190_3743448_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
AUP61164.1|3743703_3753177_-	PPE family protein	NA	NA	NA	NA	NA
AUP62106.1|3753214_3753706_-	hypothetical protein	NA	NA	NA	NA	NA
AUP62105.1|3753802_3754249_+|transposase	transposase	transposase	NA	NA	NA	NA
AUP61165.1|3754285_3755104_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP61166.1|3755320_3755557_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP61167.1|3755944_3767095_-	PPE family protein	NA	NA	NA	NA	NA
AUP61168.1|3767338_3768133_-	oxidoreductase	NA	NA	NA	NA	NA
AUP61169.1|3768214_3768586_-	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	56.4	3.3e-15
AUP61170.1|3768483_3768894_-	FAD-binding protein	NA	NA	NA	NA	NA
AUP62107.1|3768728_3768989_-	oxidoreductase	NA	NA	NA	NA	NA
AUP61171.1|3769103_3769493_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
AUP61172.1|3769506_3769800_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
AUP61173.1|3769796_3770642_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
AUP61174.1|3770765_3771041_+	antitoxin	NA	NA	NA	NA	NA
AUP61175.1|3771037_3771295_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AUP61176.1|3771336_3772527_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
AUP61177.1|3772643_3773012_+	hypothetical protein	NA	NA	NA	NA	NA
AUP61178.1|3773008_3773560_-	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
AUP61179.1|3773566_3774148_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AUP61180.1|3774128_3774497_-	DUF742 domain-containing protein	NA	NA	NA	NA	NA
AUP61181.1|3774474_3774867_-	dynein regulation protein LC7	NA	NA	NA	NA	NA
AUP61182.1|3774863_3777494_-	two-component system sensor histidine kinase EnvZ	NA	NA	NA	NA	NA
AUP61183.1|3777729_3778194_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AUP61184.1|3778560_3780327_+	PE family protein	NA	NA	NA	NA	NA
AUP61185.1|3780327_3780972_-	oxidoreductase	NA	NA	NA	NA	NA
AUP61186.1|3780970_3781405_+	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
AUP61187.1|3781493_3784733_-	DNA polymerase III subunit alpha	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.6e-118
AUP61188.1|3784924_3786265_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
AUP61189.1|3786306_3787482_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AUP61190.1|3787718_3788360_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUP61191.1|3788360_3788609_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUP61192.1|3788613_3790041_+	amidase	NA	NA	NA	NA	NA
AUP62108.1|3790148_3790802_+	haloacid dehalogenase	NA	NA	NA	NA	NA
AUP61193.1|3790840_3792346_-	type B diterpene cyclase	NA	NA	NA	NA	NA
AUP61194.1|3792350_3793241_-	diterpene synthase	NA	NA	NA	NA	NA
AUP61195.1|3793249_3794860_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUP61196.1|3794804_3795050_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUP61197.1|3795092_3796354_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
