The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025594	Mycobacterium tuberculosis strain GG-5-10 chromosome, complete genome	4411442	889035	947608	4411442	bacteriocin,tRNA,transposase,protease	Burkholderia_virus(16.67%)	59	NA	NA
AUP54662.1|889035_890296_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP54663.1|890351_891446_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUP54664.1|891435_892233_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AUP54665.1|892229_893237_-	peroxidase	NA	NA	NA	NA	NA
AUP54666.1|893281_894583_+	m18 family aminopeptidase	NA	NA	NA	NA	NA
AUP54667.1|894594_894942_+	VOC family protein	NA	NA	NA	NA	NA
AUP54668.1|894935_895592_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUP57628.1|895783_898048_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	8.1e-274
AUP54669.1|898044_898674_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUP54670.1|898794_899751_+	phosphodiesterase	NA	NA	NA	NA	NA
AUP54671.1|899695_901294_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
AUP54672.1|901598_901988_+	hypothetical protein	NA	NA	NA	NA	NA
AUP54673.1|902074_903658_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
AUP54674.1|903688_904783_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
AUP54675.1|904868_905051_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
AUP54676.1|905197_906304_-	folate-binding protein	NA	NA	NA	NA	NA
AUP57629.1|906386_907256_+	4-amino-4-deoxychorismate lyase	NA	NA	NA	NA	NA
AUP54677.1|907301_907982_-	FABP family protein	NA	NA	NA	NA	NA
AUP54678.1|908144_908447_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
AUP57630.1|908448_909282_-	sulfurtransferase	NA	NA	NA	NA	NA
AUP54679.1|909574_909997_-	thioredoxin	NA	NA	NA	NA	NA
AUP54680.1|909993_910806_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
AUP57631.1|910935_911703_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
AUP54681.1|911699_912647_+	mycothiol synthase	NA	NA	NA	NA	NA
AUP54682.1|912689_913466_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
AUP54683.1|913521_914163_-	phosphate-specific transport system accessory protein PhoU	NA	NA	NA	NA	NA
AUP54684.1|914220_916275_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AUP54685.1|916440_917610_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
AUP54686.1|917697_918714_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
AUP54687.1|918875_919517_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUP57632.1|919597_920653_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
AUP54688.1|920704_921097_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP54689.1|921154_921577_-	nucleoside deaminase	NA	NA	NA	NA	NA
AUP54690.1|921538_921829_+|transposase	transposase	transposase	NA	NA	NA	NA
AUP54691.1|921933_922839_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP54692.1|922857_923673_-	TIGR04255 family protein	NA	NA	NA	NA	NA
AUP54693.1|924914_925328_+	PE family protein	NA	NA	NA	NA	NA
AUP54694.1|925324_927574_+	PE family protein	NA	NA	NA	NA	NA
AUP57633.1|927592_927772_+	hypothetical protein	NA	NA	NA	NA	NA
AUP54695.1|927800_930449_-	PE family protein	NA	NA	NA	NA	NA
AUP54696.1|930916_931561_+	sensor domain-containing protein	NA	NA	NA	NA	NA
AUP54697.1|931541_932093_-	hypothetical protein	NA	NA	NA	NA	NA
AUP57634.1|932242_932896_-	hypothetical protein	NA	NA	NA	NA	NA
AUP54698.1|932966_933995_-	hypothetical protein	NA	NA	NA	NA	NA
AUP54699.1|934256_934445_-	hypothetical protein	NA	NA	NA	NA	NA
AUP54700.1|934683_935454_+	D-Ala-D-Ala dipeptidase VanX	NA	NA	NA	NA	NA
AUP54701.1|935540_936353_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP54702.1|936420_937281_-	proline iminopeptidase	NA	NA	NA	NA	NA
AUP54703.1|937368_937632_+	hypothetical protein	NA	NA	NA	NA	NA
AUP54704.1|937556_937799_+	hypothetical protein	NA	NA	NA	NA	NA
AUP57635.1|938075_939368_+	MFS transporter	NA	NA	NA	NA	NA
AUP54705.1|939351_940356_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
AUP54706.1|940419_941070_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUP54707.1|941153_942431_+	sensor histidine kinase	NA	NA	NA	NA	NA
AUP54708.1|942643_944158_-	oxidase	NA	NA	NA	NA	NA
AUP57636.1|944306_944699_+	hypothetical protein	NA	NA	NA	NA	NA
AUP57637.1|944901_946020_+	cysteine synthase CysK	NA	NA	NA	NA	NA
AUP54709.1|946019_947279_+	MFS transporter	NA	NA	NA	NA	NA
AUP57638.1|947275_947608_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP025594	Mycobacterium tuberculosis strain GG-5-10 chromosome, complete genome	4411442	1125415	1177216	4411442	integrase,tRNA,transposase,protease	Klosneuvirus(20.0%)	54	1133238:1133254	1182296:1182312
AUP54859.1|1125415_1126975_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	2.8e-100
AUP57660.1|1127060_1127855_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
AUP54860.1|1128062_1129151_+	resuscitation-promoting factor RpfB	NA	Q856D9	Mycobacterium_phage	59.4	8.2e-22
AUP54861.1|1129123_1130077_+	ribosomal RNA small subunit methyltransferase A	NA	NA	NA	NA	NA
AUP57661.1|1130162_1131083_+	4-diphosphocytidyl-2C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AUP54862.1|1131099_1131393_+	hypothetical protein	NA	NA	NA	NA	NA
AUP57662.1|1131352_1131652_-	hypothetical protein	NA	NA	NA	NA	NA
AUP54863.1|1131596_1133231_+	polyketide synthase	NA	NA	NA	NA	NA
1133238:1133254	attL	CGAGCAGACGCAAAATC	NA	NA	NA	NA
AUP54864.1|1133304_1133880_-|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUP54865.1|1133892_1134540_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AUP54866.1|1134756_1135437_-	hypothetical protein	NA	NA	NA	NA	NA
AUP54867.1|1135472_1136453_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	32.7	1.8e-44
AUP54868.1|1136544_1138032_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	NA	NA	NA	NA
AUP57663.1|1138286_1138880_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUP54869.1|1138938_1142643_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
AUP54870.1|1142642_1143620_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AUP54871.1|1143707_1144439_+	murein transglycosylase B	NA	NA	NA	NA	NA
AUP54872.1|1144535_1145825_+	enolase	NA	W6LP63	Streptococcus_phage	56.6	2.1e-133
AUP54873.1|1145829_1146516_+	septation inhibitor protein	NA	NA	NA	NA	NA
AUP57664.1|1146532_1147000_+	DUF501 domain-containing protein	NA	NA	NA	NA	NA
AUP54874.1|1146990_1147950_+	exopolyphosphatase	NA	NA	NA	NA	NA
AUP54875.1|1148189_1148402_+	hypothetical protein	NA	NA	NA	NA	NA
AUP54876.1|1148398_1149079_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.6	4.2e-24
AUP54877.1|1149075_1151658_-	sensor protein KdpD	NA	NA	NA	NA	NA
AUP54878.1|1151748_1151895_+	potassium transporter Trk	NA	NA	NA	NA	NA
AUP57665.1|1151891_1151984_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUP54879.1|1151983_1153699_+	potassium-transporting ATPase A chain	NA	NA	NA	NA	NA
AUP54880.1|1153695_1155825_+	potassium-transporting ATPase subunit B	NA	M1HRW9	Paramecium_bursaria_Chlorella_virus	26.2	3.8e-23
AUP54881.1|1155824_1156394_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AUP54882.1|1156397_1157927_-	sensor histidine kinase	NA	NA	NA	NA	NA
AUP54883.1|1157934_1158708_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.3	2.3e-34
AUP54884.1|1160515_1160800_-	ESAT-6-like protein EsxI	NA	NA	NA	NA	NA
AUP54885.1|1160826_1161123_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
AUP54886.1|1161268_1162444_-	PPE family protein	NA	NA	NA	NA	NA
AUP54887.1|1162520_1163348_-	PE family protein	NA	NA	NA	NA	NA
AUP54888.1|1163908_1164157_+	hypothetical protein	NA	NA	NA	NA	NA
AUP54889.1|1164135_1164375_-	hypothetical protein	NA	NA	NA	NA	NA
AUP54890.1|1164280_1164499_-	hypothetical protein	NA	NA	NA	NA	NA
AUP57666.1|1164543_1165026_-|transposase	IS5 family transposase	transposase	A0A1V0SLQ8	Klosneuvirus	28.7	8.1e-06
AUP54891.1|1165063_1165462_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUP57667.1|1165753_1166779_-|protease	serine protease	protease	NA	NA	NA	NA
AUP54892.1|1167025_1167649_+	hypothetical protein	NA	NA	NA	NA	NA
AUP54893.1|1167645_1168527_+	hypothetical protein	NA	NA	NA	NA	NA
AUP54894.1|1168608_1169397_-	hypothetical protein	NA	NA	NA	NA	NA
AUP54895.1|1169396_1170644_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
AUP54896.1|1171011_1172127_-	hypothetical protein	NA	NA	NA	NA	NA
AUP54897.1|1172083_1172287_-	hypothetical protein	NA	NA	NA	NA	NA
AUP54898.1|1172359_1172806_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUP57668.1|1172854_1173760_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUP54899.1|1173918_1174674_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUP57669.1|1174968_1175595_-	hypothetical protein	NA	NA	NA	NA	NA
AUP54900.1|1175661_1175844_+	hypothetical protein	NA	NA	NA	NA	NA
AUP54901.1|1176539_1176878_+|integrase	integrase	integrase	NA	NA	NA	NA
AUP54902.1|1176901_1177216_+|integrase	integrase	integrase	Q854H9	Mycobacterium_phage	53.6	1.0e-09
1182296:1182312	attR	CGAGCAGACGCAAAATC	NA	NA	NA	NA
>prophage 3
CP025594	Mycobacterium tuberculosis strain GG-5-10 chromosome, complete genome	4411442	2941139	2976505	4411442	transposase,terminase,capsid,protease,integrase,head,tRNA	Tupanvirus(11.11%)	42	2969940:2969967	2980922:2980949
AUP56370.1|2941139_2943218_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
AUP56371.1|2943326_2943554_+	hypothetical protein	NA	NA	NA	NA	NA
AUP57858.1|2943550_2944936_-	PE family protein	NA	NA	NA	NA	NA
AUP56372.1|2945280_2945781_+	DUF1990 domain-containing protein	NA	NA	NA	NA	NA
AUP56373.1|2945797_2946238_-	DoxX family membrane protein	NA	NA	NA	NA	NA
AUP57859.1|2946384_2947062_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP56374.1|2947046_2947400_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AUP56375.1|2947412_2947838_-	hypothetical protein	NA	NA	NA	NA	NA
AUP56376.1|2947834_2948509_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP56377.1|2948586_2949408_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP56378.1|2949543_2950437_+	universal stress protein	NA	NA	NA	NA	NA
AUP57860.1|2950439_2951258_-	universal stress protein	NA	NA	NA	NA	NA
AUP56379.1|2951272_2952454_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AUP56380.1|2952512_2952944_-	hypoxic response protein 1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
AUP56381.1|2953457_2954699_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUP57861.1|2955008_2955371_+	hypothetical protein	NA	NA	NA	NA	NA
AUP57862.1|2955717_2956842_+	hypothetical protein	NA	NA	NA	NA	NA
AUP56382.1|2956843_2957383_+	archease	NA	NA	NA	NA	NA
AUP56383.1|2957522_2958821_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
AUP56384.1|2958859_2959141_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
AUP56385.1|2959285_2959771_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
AUP56386.1|2959797_2960055_-	hypothetical protein	NA	NA	NA	NA	NA
AUP56387.1|2960055_2962392_-	PE family protein	NA	NA	NA	NA	NA
AUP56388.1|2962420_2962663_+	hypothetical protein	NA	NA	NA	NA	NA
AUP56389.1|2962663_2963341_+	hypothetical protein	NA	NA	NA	NA	NA
AUP56390.1|2963536_2964193_+	DedA family protein	NA	NA	NA	NA	NA
AUP56391.1|2964355_2964802_+	STAS domain-containing protein	NA	NA	NA	NA	NA
AUP56392.1|2964976_2965309_-	YnfA family protein	NA	NA	NA	NA	NA
AUP56393.1|2965428_2965788_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP56394.1|2965889_2966348_+	cadmium-induced protein CadI	NA	NA	NA	NA	NA
AUP56395.1|2966483_2966864_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP56396.1|2966860_2968357_+	arsenical-resistance protein	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
AUP57863.1|2968546_2968783_+	DUF3018 domain-containing protein	NA	NA	NA	NA	NA
AUP56397.1|2968855_2969029_+	hypothetical protein	NA	NA	NA	NA	NA
2969940:2969967	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
AUP56398.1|2970073_2970505_+	hypothetical protein	NA	NA	NA	NA	NA
AUP56399.1|2970501_2971500_+|integrase	integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
AUP56400.1|2971513_2971978_+	hypothetical protein	NA	NA	NA	NA	NA
AUP56401.1|2971965_2972154_+	hypothetical protein	NA	NA	NA	NA	NA
AUP56402.1|2972110_2973371_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP56403.1|2973745_2975185_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
AUP57864.1|2975192_2975726_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
AUP56404.1|2975878_2976505_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980922:2980949	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 4
CP025594	Mycobacterium tuberculosis strain GG-5-10 chromosome, complete genome	4411442	3710370	3796308	4411442	tRNA,transposase	Burkholderia_virus(28.57%)	57	NA	NA
AUP57010.1|3710370_3711631_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP57011.1|3711686_3713399_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUP57969.1|3713331_3714270_-	RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
AUP57012.1|3714278_3715646_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.0	3.1e-18
AUP57013.1|3715714_3716932_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
AUP57014.1|3717027_3718536_+	MFS transporter	NA	NA	NA	NA	NA
AUP57015.1|3718532_3719684_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AUP57016.1|3719874_3720720_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
AUP57970.1|3720696_3721176_+	hypothetical protein	NA	NA	NA	NA	NA
AUP57017.1|3721194_3721635_+	Zn(2+)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUP57018.1|3721668_3722538_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
AUP57019.1|3722558_3723569_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUP57020.1|3723853_3724486_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUP57021.1|3724552_3725782_-	isocitrate dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AUP57022.1|3726064_3727414_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
AUP57023.1|3727425_3728565_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
AUP57971.1|3728561_3729293_+	methyltransferase	NA	NA	NA	NA	NA
AUP57024.1|3729301_3736873_-	hypothetical protein	NA	NA	NA	NA	NA
AUP57025.1|3743135_3743393_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
AUP57026.1|3743648_3753122_-	PPE family protein	NA	NA	NA	NA	NA
AUP57973.1|3753159_3753651_-	hypothetical protein	NA	NA	NA	NA	NA
AUP57972.1|3753747_3754194_+|transposase	transposase	transposase	NA	NA	NA	NA
AUP57027.1|3754230_3755049_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP57028.1|3755265_3755502_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP57029.1|3755889_3767040_-	PPE family protein	NA	NA	NA	NA	NA
AUP57030.1|3767283_3768078_-	oxidoreductase	NA	NA	NA	NA	NA
AUP57031.1|3768159_3768531_-	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	56.4	3.3e-15
AUP57032.1|3768428_3768839_-	FAD-binding protein	NA	NA	NA	NA	NA
AUP57974.1|3768673_3768934_-	oxidoreductase	NA	NA	NA	NA	NA
AUP57033.1|3769048_3769438_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
AUP57034.1|3769451_3769745_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
AUP57035.1|3769741_3770587_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
AUP57036.1|3770710_3770986_+	antitoxin	NA	NA	NA	NA	NA
AUP57037.1|3770982_3771240_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AUP57038.1|3771281_3772472_+	oxidoreductase	NA	NA	NA	NA	NA
AUP57039.1|3772588_3772957_+	hypothetical protein	NA	NA	NA	NA	NA
AUP57040.1|3772953_3773505_-	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
AUP57041.1|3773511_3774093_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AUP57975.1|3774073_3774442_-	DUF742 domain-containing protein	NA	NA	NA	NA	NA
AUP57042.1|3774419_3774812_-	dynein regulation protein LC7	NA	NA	NA	NA	NA
AUP57043.1|3774808_3777439_-	sensor histidine kinase	NA	NA	NA	NA	NA
AUP57044.1|3777674_3778139_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AUP57045.1|3778505_3780281_+	PE family protein	NA	NA	NA	NA	NA
AUP57046.1|3780281_3780926_-	oxidoreductase	NA	NA	NA	NA	NA
AUP57047.1|3780924_3781359_+	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
AUP57048.1|3781447_3784687_-	DNA polymerase III subunit alpha	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.6e-118
AUP57049.1|3784878_3786219_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
AUP57050.1|3786260_3787436_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AUP57051.1|3787672_3788314_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUP57052.1|3788314_3788563_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUP57053.1|3788567_3789995_+	amidase	NA	NA	NA	NA	NA
AUP57976.1|3790102_3790756_+	haloacid dehalogenase	NA	NA	NA	NA	NA
AUP57054.1|3790794_3792300_-	type B diterpene cyclase	NA	NA	NA	NA	NA
AUP57055.1|3792304_3793195_-	diterpene synthase	NA	NA	NA	NA	NA
AUP57056.1|3793203_3794814_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUP57057.1|3794758_3795004_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUP57058.1|3795046_3796308_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
