The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025593	Mycobacterium tuberculosis strain GG-111-10 chromosome, complete genome	4411563	889029	947593	4411563	protease,transposase,bacteriocin,tRNA	Burkholderia_virus(16.67%)	59	NA	NA
AUP50528.1|889029_890290_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP50529.1|890345_891440_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUP50530.1|891429_892227_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AUP50531.1|892223_893231_-	peroxidase	NA	NA	NA	NA	NA
AUP50532.1|893275_894577_+	m18 family aminopeptidase	NA	NA	NA	NA	NA
AUP50533.1|894588_894936_+	VOC family protein	NA	NA	NA	NA	NA
AUP50534.1|894929_895586_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUP53489.1|895777_898042_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.2	1.8e-273
AUP50535.1|898038_898668_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUP50536.1|898788_899745_+	phosphodiesterase	NA	NA	NA	NA	NA
AUP50537.1|899689_901288_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
AUP50538.1|901592_901982_+	hypothetical protein	NA	NA	NA	NA	NA
AUP50539.1|902068_903652_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
AUP50540.1|903682_904777_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
AUP50541.1|904862_905045_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
AUP50542.1|905191_906298_-	folate-binding protein	NA	NA	NA	NA	NA
AUP53490.1|906380_907250_+	4-amino-4-deoxychorismate lyase	NA	NA	NA	NA	NA
AUP50543.1|907295_907976_-	FABP family protein	NA	NA	NA	NA	NA
AUP50544.1|908138_908441_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
AUP53491.1|908442_909276_-	sulfurtransferase	NA	NA	NA	NA	NA
AUP50545.1|909568_909991_-	thioredoxin TrxC	NA	NA	NA	NA	NA
AUP50546.1|909987_910800_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
AUP53492.1|910929_911697_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
AUP50547.1|911693_912641_+	mycothiol synthase	NA	NA	NA	NA	NA
AUP50548.1|912683_913460_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
AUP50549.1|913515_914157_-	phosphate-specific transport system accessory protein PhoU	NA	NA	NA	NA	NA
AUP50550.1|914214_916269_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AUP50551.1|916434_917604_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
AUP50552.1|917691_918708_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
AUP50553.1|918869_919511_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUP53493.1|919591_920647_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
AUP50554.1|920698_921091_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP50555.1|921148_921571_-	nucleoside deaminase	NA	NA	NA	NA	NA
AUP50556.1|921532_921823_+|transposase	transposase	transposase	NA	NA	NA	NA
AUP50557.1|921927_922833_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP50558.1|922851_923667_-	TIGR04255 family protein	NA	NA	NA	NA	NA
AUP50559.1|924908_925322_+	PE family protein	NA	NA	NA	NA	NA
AUP50560.1|925318_927568_+	PE family protein	NA	NA	NA	NA	NA
AUP50561.1|927586_927766_+	hypothetical protein	NA	NA	NA	NA	NA
AUP50562.1|927794_930434_-	PE family protein	NA	NA	NA	NA	NA
AUP50563.1|930901_931546_+	sensor domain-containing protein	NA	NA	NA	NA	NA
AUP50564.1|931526_932078_-	hypothetical protein	NA	NA	NA	NA	NA
AUP53494.1|932227_932881_-	hypothetical protein	NA	NA	NA	NA	NA
AUP50565.1|932951_933980_-	hypothetical protein	NA	NA	NA	NA	NA
AUP50566.1|934241_934430_-	hypothetical protein	NA	NA	NA	NA	NA
AUP50567.1|934668_935439_+	D-Ala-D-Ala dipeptidase VanX	NA	NA	NA	NA	NA
AUP50568.1|935525_936338_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP50569.1|936405_937266_-	proline iminopeptidase	NA	NA	NA	NA	NA
AUP50570.1|937353_937617_+	hypothetical protein	NA	NA	NA	NA	NA
AUP50571.1|937541_937784_+	hypothetical protein	NA	NA	NA	NA	NA
AUP53495.1|938060_939353_+	MFS transporter	NA	NA	NA	NA	NA
AUP50572.1|939336_940341_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
AUP50573.1|940404_941055_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUP50574.1|941138_942416_+	sensor histidine kinase	NA	NA	NA	NA	NA
AUP50575.1|942628_944143_-	oxidase	NA	NA	NA	NA	NA
AUP53496.1|944291_944684_+	hypothetical protein	NA	NA	NA	NA	NA
AUP53497.1|944886_946005_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
AUP50576.1|946004_947264_+	MFS transporter	NA	NA	NA	NA	NA
AUP53498.1|947260_947593_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP025593	Mycobacterium tuberculosis strain GG-111-10 chromosome, complete genome	4411563	1125418	1177219	4411563	tRNA,protease,transposase,integrase	Klosneuvirus(20.0%)	54	1133241:1133257	1182299:1182315
AUP50725.1|1125418_1126978_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	2.8e-100
AUP53520.1|1127063_1127858_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
AUP50726.1|1128065_1129154_+	resuscitation-promoting factor RpfB	NA	Q856D9	Mycobacterium_phage	59.4	8.2e-22
AUP50727.1|1129126_1130080_+	ribosomal RNA small subunit methyltransferase A	NA	NA	NA	NA	NA
AUP53521.1|1130165_1131086_+	4-diphosphocytidyl-2C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AUP50728.1|1131102_1131396_+	hypothetical protein	NA	NA	NA	NA	NA
AUP53522.1|1131355_1131655_-	hypothetical protein	NA	NA	NA	NA	NA
AUP50729.1|1131599_1133234_+	polyketide synthase	NA	NA	NA	NA	NA
1133241:1133257	attL	CGAGCAGACGCAAAATC	NA	NA	NA	NA
AUP50730.1|1133307_1133883_-|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUP50731.1|1133895_1134543_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AUP50732.1|1134759_1135440_-	hypothetical protein	NA	NA	NA	NA	NA
AUP50733.1|1135475_1136456_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	32.7	1.8e-44
AUP50734.1|1136547_1138035_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	NA	NA	NA	NA
AUP53523.1|1138289_1138883_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUP50735.1|1138941_1142646_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
AUP50736.1|1142645_1143623_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AUP50737.1|1143710_1144442_+	murein transglycosylase B	NA	NA	NA	NA	NA
AUP50738.1|1144538_1145828_+	enolase	NA	W6LP63	Streptococcus_phage	56.6	2.1e-133
AUP50739.1|1145832_1146519_+	septation inhibitor protein	NA	NA	NA	NA	NA
AUP53524.1|1146535_1147003_+	DUF501 domain-containing protein	NA	NA	NA	NA	NA
AUP50740.1|1146993_1147953_+	exopolyphosphatase	NA	NA	NA	NA	NA
AUP50741.1|1148192_1148405_+	hypothetical protein	NA	NA	NA	NA	NA
AUP50742.1|1148401_1149082_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.6	4.2e-24
AUP50743.1|1149078_1151661_-	sensor protein KdpD	NA	NA	NA	NA	NA
AUP50744.1|1151751_1151898_+	potassium transporter Trk	NA	NA	NA	NA	NA
AUP53525.1|1151894_1151987_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUP50745.1|1151986_1153702_+	potassium-transporting ATPase subunit A	NA	NA	NA	NA	NA
AUP50746.1|1153698_1155828_+	potassium-transporting ATPase subunit B	NA	M1HRW9	Paramecium_bursaria_Chlorella_virus	26.2	3.8e-23
AUP50747.1|1155827_1156397_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AUP50748.1|1156400_1157930_-	sensor histidine kinase	NA	NA	NA	NA	NA
AUP50749.1|1157937_1158711_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.3	2.3e-34
AUP50750.1|1160518_1160803_-	ESAT-6-like protein EsxI	NA	NA	NA	NA	NA
AUP50751.1|1160829_1161126_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
AUP50752.1|1161271_1162447_-	PPE family protein	NA	NA	NA	NA	NA
AUP50753.1|1162523_1163351_-	PE family protein	NA	NA	NA	NA	NA
AUP50754.1|1163911_1164160_+	hypothetical protein	NA	NA	NA	NA	NA
AUP50755.1|1164138_1164378_-	hypothetical protein	NA	NA	NA	NA	NA
AUP50756.1|1164283_1164502_-	hypothetical protein	NA	NA	NA	NA	NA
AUP53526.1|1164546_1165029_-|transposase	IS5 family transposase	transposase	A0A1V0SLQ8	Klosneuvirus	28.7	8.1e-06
AUP50757.1|1165066_1165465_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUP53527.1|1165756_1166782_-|protease	serine protease	protease	NA	NA	NA	NA
AUP50758.1|1167028_1167652_+	hypothetical protein	NA	NA	NA	NA	NA
AUP50759.1|1167648_1168530_+	hypothetical protein	NA	NA	NA	NA	NA
AUP50760.1|1168611_1169400_-	hypothetical protein	NA	NA	NA	NA	NA
AUP50761.1|1169399_1170647_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
AUP50762.1|1171014_1172130_-	hypothetical protein	NA	NA	NA	NA	NA
AUP50763.1|1172086_1172290_-	hypothetical protein	NA	NA	NA	NA	NA
AUP50764.1|1172362_1172809_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUP53528.1|1172857_1173763_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUP50765.1|1173921_1174677_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUP53529.1|1174971_1175598_-	hypothetical protein	NA	NA	NA	NA	NA
AUP50766.1|1175664_1175847_+	hypothetical protein	NA	NA	NA	NA	NA
AUP50767.1|1176542_1176881_+|integrase	integrase	integrase	NA	NA	NA	NA
AUP50768.1|1176904_1177219_+|integrase	integrase	integrase	Q854H9	Mycobacterium_phage	53.6	1.0e-09
1182299:1182315	attR	CGAGCAGACGCAAAATC	NA	NA	NA	NA
>prophage 3
CP025593	Mycobacterium tuberculosis strain GG-111-10 chromosome, complete genome	4411563	2941191	2976557	4411563	protease,integrase,transposase,head,tRNA,capsid,terminase	Tupanvirus(11.11%)	42	2969992:2970019	2980974:2981001
AUP52232.1|2941191_2943270_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
AUP52233.1|2943378_2943606_+	hypothetical protein	NA	NA	NA	NA	NA
AUP53717.1|2943602_2944988_-	PE family protein	NA	NA	NA	NA	NA
AUP52234.1|2945332_2945833_+	DUF1990 domain-containing protein	NA	NA	NA	NA	NA
AUP52235.1|2945849_2946290_-	DoxX family membrane protein	NA	NA	NA	NA	NA
AUP53718.1|2946436_2947114_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP52236.1|2947098_2947452_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AUP52237.1|2947464_2947890_-	hypothetical protein	NA	NA	NA	NA	NA
AUP52238.1|2947886_2948561_-	transcriptional regulator UhpA	NA	NA	NA	NA	NA
AUP52239.1|2948638_2949460_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUP52240.1|2949595_2950489_+	universal stress protein	NA	NA	NA	NA	NA
AUP53719.1|2950491_2951310_-	universal stress protein	NA	NA	NA	NA	NA
AUP52241.1|2951324_2952506_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AUP52242.1|2952564_2952996_-	hypoxic response protein 1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
AUP52243.1|2953509_2954751_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUP53720.1|2955060_2955423_+	hypothetical protein	NA	NA	NA	NA	NA
AUP53721.1|2955769_2956894_+	hypothetical protein	NA	NA	NA	NA	NA
AUP52244.1|2956895_2957435_+	archease	NA	NA	NA	NA	NA
AUP52245.1|2957574_2958873_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
AUP52246.1|2958911_2959193_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
AUP52247.1|2959337_2959823_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
AUP52248.1|2959849_2960107_-	hypothetical protein	NA	NA	NA	NA	NA
AUP52249.1|2960107_2962444_-	PE family protein	NA	NA	NA	NA	NA
AUP52250.1|2962472_2962715_+	hypothetical protein	NA	NA	NA	NA	NA
AUP52251.1|2962715_2963393_+	hypothetical protein	NA	NA	NA	NA	NA
AUP52252.1|2963588_2964245_+	DedA family protein	NA	NA	NA	NA	NA
AUP52253.1|2964407_2964854_+	STAS domain-containing protein	NA	NA	NA	NA	NA
AUP52254.1|2965028_2965361_-	YnfA family protein	NA	NA	NA	NA	NA
AUP52255.1|2965480_2965840_-	transcriptional regulator	NA	NA	NA	NA	NA
AUP52256.1|2965941_2966400_+	cadmium-induced protein CadI	NA	NA	NA	NA	NA
AUP52257.1|2966535_2966916_+	transcriptional regulator	NA	NA	NA	NA	NA
AUP52258.1|2966912_2968409_+	arsenical-resistance protein	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
AUP53722.1|2968598_2968835_+	DUF3018 domain-containing protein	NA	NA	NA	NA	NA
AUP52259.1|2968907_2969081_+	hypothetical protein	NA	NA	NA	NA	NA
2969992:2970019	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
AUP52260.1|2970125_2970557_+	hypothetical protein	NA	NA	NA	NA	NA
AUP52261.1|2970553_2971552_+|integrase	integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
AUP52262.1|2971565_2972030_+	hypothetical protein	NA	NA	NA	NA	NA
AUP52263.1|2972017_2972206_+	hypothetical protein	NA	NA	NA	NA	NA
AUP52264.1|2972162_2973423_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP52265.1|2973797_2975237_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
AUP53723.1|2975244_2975778_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
AUP52266.1|2975930_2976557_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980974:2981001	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 4
CP025593	Mycobacterium tuberculosis strain GG-111-10 chromosome, complete genome	4411563	3710444	3796400	4411563	tRNA,transposase	Burkholderia_virus(28.57%)	57	NA	NA
AUP52871.1|3710444_3711705_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
AUP52872.1|3711760_3713473_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUP53826.1|3713405_3714344_-	RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
AUP52873.1|3714352_3715720_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.8	9.0e-18
AUP52874.1|3715788_3717006_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
AUP52875.1|3717101_3718610_+	MFS transporter	NA	NA	NA	NA	NA
AUP52876.1|3718606_3719758_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AUP52877.1|3719948_3720794_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
AUP53827.1|3720770_3721250_+	hypothetical protein	NA	NA	NA	NA	NA
AUP52878.1|3721268_3721709_+	Zn(2+)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUP52879.1|3721742_3722612_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
AUP52880.1|3722632_3723643_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUP52881.1|3723927_3724560_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUP52882.1|3724626_3725856_-	isocitrate dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AUP52883.1|3726138_3727488_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
AUP52884.1|3727499_3728639_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
AUP53828.1|3728635_3729367_+	methyltransferase	NA	NA	NA	NA	NA
AUP52885.1|3729375_3736947_-	hypothetical protein	NA	NA	NA	NA	NA
AUP52886.1|3743227_3743485_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
AUP52887.1|3743740_3753214_-	PPE family protein	NA	NA	NA	NA	NA
AUP53830.1|3753251_3753743_-	hypothetical protein	NA	NA	NA	NA	NA
AUP53829.1|3753839_3754286_+|transposase	transposase	transposase	NA	NA	NA	NA
AUP52888.1|3754322_3755141_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP52889.1|3755357_3755594_-|transposase	transposase	transposase	NA	NA	NA	NA
AUP52890.1|3755981_3767132_-	hypothetical protein	NA	NA	NA	NA	NA
AUP52891.1|3767375_3768170_-	oxidoreductase	NA	NA	NA	NA	NA
AUP52892.1|3768251_3768623_-	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	56.4	3.3e-15
AUP52893.1|3768520_3768931_-	FAD-binding protein	NA	NA	NA	NA	NA
AUP53831.1|3768765_3769026_-	oxidoreductase	NA	NA	NA	NA	NA
AUP52894.1|3769140_3769530_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
AUP52895.1|3769543_3769837_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
AUP52896.1|3769833_3770679_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
AUP52897.1|3770802_3771078_+	antitoxin	NA	NA	NA	NA	NA
AUP52898.1|3771074_3771332_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AUP52899.1|3771373_3772564_+	oxidoreductase	NA	NA	NA	NA	NA
AUP52900.1|3772680_3773049_+	hypothetical protein	NA	NA	NA	NA	NA
AUP52901.1|3773045_3773597_-	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
AUP52902.1|3773603_3774185_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AUP53832.1|3774165_3774534_-	DUF742 domain-containing protein	NA	NA	NA	NA	NA
AUP52903.1|3774511_3774904_-	dynein regulation protein LC7	NA	NA	NA	NA	NA
AUP52904.1|3774900_3777531_-	ATP-binding protein	NA	NA	NA	NA	NA
AUP52905.1|3777766_3778231_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AUP52906.1|3778597_3780373_+	PE family protein	NA	NA	NA	NA	NA
AUP52907.1|3780373_3781018_-	oxidoreductase	NA	NA	NA	NA	NA
AUP52908.1|3781016_3781451_+	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
AUP53833.1|3781539_3784779_-	DNA polymerase III subunit alpha	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.6e-118
AUP52909.1|3784970_3786311_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
AUP52910.1|3786352_3787528_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AUP52911.1|3787764_3788406_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUP52912.1|3788406_3788655_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUP52913.1|3788659_3790087_+	amidase	NA	NA	NA	NA	NA
AUP53834.1|3790194_3790848_+	haloacid dehalogenase	NA	NA	NA	NA	NA
AUP52914.1|3790886_3792392_-	type B diterpene cyclase	NA	NA	NA	NA	NA
AUP52915.1|3792396_3793287_-	diterpene synthase	NA	NA	NA	NA	NA
AUP52916.1|3793295_3794906_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUP52917.1|3794850_3795096_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUP52918.1|3795138_3796400_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
