The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032839	Aeromonas veronii strain FC951 chromosome, complete genome	4666657	461955	614599	4666657	protease,transposase,tRNA	Vibrio_phage(17.39%)	116	NA	NA
AYK16879.1|461955_464217_+|protease	serine protease	protease	A0A1V0SFX9	Hokovirus	27.1	1.7e-05
AYK20157.1|464446_467044_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
AYK16880.1|467324_468911_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AYK16881.1|469074_470469_+	FAD-binding protein	NA	NA	NA	NA	NA
AYK20158.1|470487_471606_+	GTP-binding protein	NA	NA	NA	NA	NA
AYK16882.1|474693_475794_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYK16883.1|475884_476493_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYK16884.1|477892_478381_-	DNA-binding protein	NA	NA	NA	NA	NA
AYK16885.1|478507_479017_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AYK16886.1|479016_479388_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AYK20159.1|479479_480208_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
AYK16887.1|480727_481900_+	hypothetical protein	NA	NA	NA	NA	NA
AYK16888.1|481986_482319_-	hypothetical protein	NA	NA	NA	NA	NA
AYK16889.1|482452_482968_+	DfsB family protein	NA	NA	NA	NA	NA
AYK16890.1|483213_483669_+	hypothetical protein	NA	NA	NA	NA	NA
AYK16891.1|483744_485130_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AYK16892.1|485545_486781_-	argininosuccinate synthase	NA	NA	NA	NA	NA
AYK16893.1|486849_487761_-	ornithine carbamoyltransferase	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	29.3	8.1e-15
AYK16894.1|487786_488590_-	acetylglutamate kinase	NA	NA	NA	NA	NA
AYK16895.1|488612_489620_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AYK16896.1|489891_491037_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
AYK16897.1|491268_493902_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AYK16898.1|494006_494642_-	Vat family streptogramin A O-acetyltransferase	NA	A0A1V0SJ47	Klosneuvirus	37.6	3.8e-19
AYK16899.1|494665_494983_-	hypothetical protein	NA	NA	NA	NA	NA
AYK16900.1|495331_496222_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.1	2.2e-17
AYK16901.1|496693_497968_+	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
AYK16902.1|498034_498742_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYK20160.1|498923_499547_+	porin family protein	NA	NA	NA	NA	NA
AYK16903.1|499637_500561_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.0	4.5e-13
AYK16904.1|501066_502494_+	ammonium transporter	NA	NA	NA	NA	NA
AYK16905.1|502576_503044_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AYK16906.1|503141_503639_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYK20161.1|503751_504156_-	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
AYK16907.1|504243_506046_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	34.4	5.9e-94
AYK16908.1|506079_506745_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYK16909.1|506938_508564_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.1	1.4e-142
AYK16910.1|508713_509601_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
AYK16911.1|509675_510188_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
AYK20162.1|510329_510710_-	hypothetical protein	NA	NA	NA	NA	NA
AYK16912.1|510895_512284_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AYK20163.1|512286_513366_+	AI-2E family transporter YdiK	NA	NA	NA	NA	NA
AYK16913.1|513510_514050_-	hypothetical protein	NA	NA	NA	NA	NA
AYK16914.1|514068_514338_-	hypothetical protein	NA	NA	NA	NA	NA
AYK16915.1|514300_515317_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
AYK16916.1|515827_516964_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
AYK16917.1|516980_517676_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYK20164.1|518335_520237_+	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
AYK16918.1|520331_521414_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
AYK16919.1|522264_522894_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
AYK16920.1|522903_523974_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
AYK20165.1|524212_525556_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	68.7	9.7e-150
AYK16921.1|525876_526089_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	1.1e-23
AYK20166.1|526684_526954_-	DUF3811 domain-containing protein	NA	NA	NA	NA	NA
AYK16922.1|527115_528018_-	cation transporter	NA	NA	NA	NA	NA
AYK16923.1|528482_528605_+	hypothetical protein	NA	NA	NA	NA	NA
AYK16924.1|529083_530505_-|transposase	IS66-like element ISKpn15 family transposase	transposase	NA	NA	NA	NA
AYK16925.1|531295_532213_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	57.0	2.8e-92
AYK16926.1|533294_533486_-	hypothetical protein	NA	NA	NA	NA	NA
AYK16927.1|533506_534568_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYK16928.1|536863_538000_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
AYK16929.1|538092_539133_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	41.5	4.1e-71
AYK16930.1|539705_541266_+|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
AYK16931.1|542101_543268_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AYK16932.1|543280_544894_-|transposase	IS1634-like element ISAs25 family transposase	transposase	NA	NA	NA	NA
AYK16933.1|544924_545998_-	hypothetical protein	NA	NA	NA	NA	NA
AYK16934.1|546778_547141_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYK16935.1|547232_548794_-|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
AYK16936.1|550081_551503_+|transposase	IS66-like element ISKpn15 family transposase	transposase	NA	NA	NA	NA
AYK16937.1|552707_553619_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	54.8	4.2e-88
AYK16938.1|553946_556730_-	hypothetical protein	NA	NA	NA	NA	NA
AYK16939.1|556630_558192_-|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
AYK16940.1|558234_559395_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AYK16941.1|559885_560758_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	55.3	3.2e-85
AYK16942.1|560738_560993_-	hypothetical protein	NA	NA	NA	NA	NA
AYK16943.1|561153_561741_-	single-stranded DNA-binding protein	NA	R9TR60	Vibrio_phage	58.8	5.7e-54
AYK16944.1|562167_562815_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AYK16945.1|562814_563258_+	CsgE	NA	NA	NA	NA	NA
AYK16946.1|563269_563671_+	curli production assembly protein CsgF	NA	NA	NA	NA	NA
AYK16947.1|563678_564518_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	39.9	2.1e-41
AYK16948.1|564704_565226_+	curlin	NA	NA	NA	NA	NA
AYK16949.1|565260_566538_+	curlin	NA	NA	NA	NA	NA
AYK16950.1|566540_566939_+	hypothetical protein	NA	NA	NA	NA	NA
AYK16951.1|567028_569857_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.3	0.0e+00
AYK16952.1|569976_571650_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.1	1.4e-20
AYK16953.1|572108_572723_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
AYK16954.1|572945_574925_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.9	3.5e-23
AYK16955.1|574933_576421_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
AYK16956.1|576494_577295_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYK16957.1|577624_578515_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AYK16958.1|578584_579649_-	DUF3103 family protein	NA	NA	NA	NA	NA
AYK16959.1|579771_580947_-	benzoate transporter BenE	NA	NA	NA	NA	NA
AYK16960.1|581066_581636_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYK20167.1|581652_582849_-	NnrS family protein	NA	NA	NA	NA	NA
AYK16961.1|589390_590140_+	DsbA family protein	NA	NA	NA	NA	NA
AYK16962.1|590436_591339_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AYK16963.1|591253_592069_-	hypothetical protein	NA	NA	NA	NA	NA
AYK16964.1|592286_593573_-	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
AYK16965.1|593817_595206_+	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
AYK16966.1|595297_595993_+	hypothetical protein	NA	NA	NA	NA	NA
AYK16967.1|596080_596431_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	49.5	1.8e-26
AYK16968.1|596569_597979_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
AYK16969.1|598280_598490_+	hypothetical protein	NA	NA	NA	NA	NA
AYK16970.1|598484_598838_-	hypothetical protein	NA	NA	NA	NA	NA
AYK16971.1|599635_601096_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
AYK16972.1|601085_602303_-	glucose-1-phosphate adenylyltransferase	NA	I7I009	Enterobacteria_phage	25.6	7.0e-06
AYK16973.1|602454_603483_-	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
AYK16974.1|603763_604636_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AYK16975.1|604727_605696_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AYK16976.1|605865_606546_+	TIGR00153 family protein	NA	NA	NA	NA	NA
AYK16977.1|606571_607837_+	inorganic phosphate transporter	NA	M4QMY4	Ostreococcus_lucimarinus_virus	37.2	1.1e-62
AYK16978.1|607947_609166_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	29.2	1.5e-16
AYK16979.1|609254_611711_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
AYK16980.1|611710_612883_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AYK16981.1|613088_613412_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
AYK20168.1|613453_614176_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYK16982.1|614260_614599_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
>prophage 2
CP032839	Aeromonas veronii strain FC951 chromosome, complete genome	4666657	1625500	1696847	4666657	transposase	Stx2-converting_phage(42.86%)	50	NA	NA
AYK17771.1|1625500_1626838_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
AYK20221.1|1627061_1627937_+	hypothetical protein	NA	NA	NA	NA	NA
AYK17772.1|1628082_1629273_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AYK17773.1|1629389_1629893_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
AYK20223.1|1629886_1630405_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
AYK20222.1|1630348_1632634_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
AYK17774.1|1632738_1634502_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	2.2e-56
AYK17775.1|1634501_1635497_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AYK17776.1|1635620_1635809_+	Trm112 family protein	NA	NA	NA	NA	NA
AYK17777.1|1635805_1636555_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AYK17778.1|1636767_1637412_+	two-component system response regulator UvrY	NA	NA	NA	NA	NA
AYK17779.1|1637539_1639393_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
AYK17780.1|1639592_1640147_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AYK17781.1|1641061_1641637_-	hypothetical protein	NA	NA	NA	NA	NA
AYK17782.1|1642124_1643141_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
AYK17783.1|1643527_1644001_-	DUF2846 domain-containing protein	NA	NA	NA	NA	NA
AYK17784.1|1645292_1645469_-	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
AYK17785.1|1645723_1646455_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AYK17786.1|1646451_1647249_-	DUF4269 domain-containing protein	NA	NA	NA	NA	NA
AYK17787.1|1647238_1647736_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AYK17788.1|1650474_1651896_-|transposase	IS66-like element ISKpn15 family transposase	transposase	NA	NA	NA	NA
AYK17789.1|1652729_1655189_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
AYK17790.1|1655868_1657290_+|transposase	IS66-like element ISKpn15 family transposase	transposase	NA	NA	NA	NA
AYK17791.1|1658552_1659308_-	hypothetical protein	NA	NA	NA	NA	NA
AYK17792.1|1659447_1660194_-	hypothetical protein	NA	NA	NA	NA	NA
AYK17793.1|1660324_1661071_-	hypothetical protein	NA	NA	NA	NA	NA
AYK17794.1|1661142_1661661_-	hypothetical protein	NA	NA	NA	NA	NA
AYK17795.1|1661657_1662662_-	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
AYK17796.1|1662654_1663593_-	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
AYK17797.1|1663757_1664315_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
AYK17798.1|1664574_1664904_-	translation initiation factor	NA	NA	NA	NA	NA
AYK17799.1|1665023_1665251_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
AYK17800.1|1665380_1667651_+	Fe(2+) transporter permease subunit FeoB	NA	NA	NA	NA	NA
AYK17801.1|1667647_1667887_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AYK17802.1|1667986_1668637_-	DUF2913 family protein	NA	NA	NA	NA	NA
AYK20224.1|1668735_1669962_-	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	30.9	2.1e-50
AYK17803.1|1670317_1670896_+	O-methyltransferase	NA	NA	NA	NA	NA
AYK17804.1|1670971_1672387_-	glutamate synthase small subunit	NA	NA	NA	NA	NA
AYK17805.1|1672399_1676857_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
AYK17806.1|1677039_1677255_-	hypothetical protein	NA	NA	NA	NA	NA
AYK17807.1|1678774_1680919_+	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	34.6	1.8e-25
AYK17808.1|1680911_1682342_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYK17809.1|1682379_1683696_+	channel protein TolC	NA	NA	NA	NA	NA
AYK20225.1|1683990_1684584_+	sulfate adenylyltransferase	NA	NA	NA	NA	NA
AYK17810.1|1684587_1686513_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AYK17811.1|1686812_1687214_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	39.4	4.8e-12
AYK17812.1|1687210_1687558_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	89.6	1.6e-56
AYK20226.1|1687588_1689139_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	80.4	3.5e-244
AYK17813.1|1689228_1695399_+	retention module-containing protein	NA	NA	NA	NA	NA
AYK17814.1|1695425_1696847_+|transposase	IS66-like element ISKpn15 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP032839	Aeromonas veronii strain FC951 chromosome, complete genome	4666657	1758365	1836112	4666657	transposase,tRNA	Ostreococcus_tauri_virus(16.67%)	59	NA	NA
AYK17868.1|1758365_1759979_-|transposase	IS1634-like element ISAs25 family transposase	transposase	NA	NA	NA	NA
AYK17869.1|1760109_1760634_-	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
AYK17870.1|1760883_1762548_-	asparagine synthase B	NA	H8ZJK1	Ostreococcus_tauri_virus	41.0	7.9e-93
AYK17871.1|1762753_1763122_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AYK17872.1|1763252_1764827_-	potassium transporter Kef	NA	NA	NA	NA	NA
AYK17873.1|1764881_1765631_-	HAD-IIA family hydrolase	NA	NA	NA	NA	NA
AYK17874.1|1765828_1766893_+	adenosine deaminase	NA	NA	NA	NA	NA
AYK17875.1|1767004_1767991_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AYK17876.1|1768137_1769259_-	alkene reductase	NA	NA	NA	NA	NA
AYK17877.1|1769455_1770991_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.9	5.1e-38
AYK17878.1|1771291_1772218_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
AYK17879.1|1772310_1775457_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AYK17880.1|1775456_1775945_+	hypothetical protein	NA	NA	NA	NA	NA
AYK17881.1|1776113_1776575_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
AYK17882.1|1776722_1778657_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.7	3.5e-60
AYK17883.1|1779147_1780470_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
AYK17884.1|1780743_1781469_-	ribonuclease T	NA	NA	NA	NA	NA
AYK17885.1|1781520_1782264_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AYK17886.1|1782511_1783633_+	4-phosphoerythronate dehydrogenase	NA	NA	NA	NA	NA
AYK17887.1|1783826_1784843_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYK17888.1|1785114_1787313_+	pilus assembly protein FimV	NA	NA	NA	NA	NA
AYK17889.1|1787513_1788323_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AYK17890.1|1788442_1789306_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
AYK17891.1|1789320_1790568_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AYK17892.1|1790642_1791443_+	cell division protein DedD	NA	NA	NA	NA	NA
AYK17893.1|1791614_1791932_+	hypothetical protein	NA	NA	NA	NA	NA
AYK17894.1|1792184_1792742_+	hypothetical protein	NA	NA	NA	NA	NA
AYK17895.1|1792791_1794405_+|transposase	IS1634-like element ISAs25 family transposase	transposase	NA	NA	NA	NA
AYK17896.1|1795221_1796643_+|transposase	IS66-like element ISKpn15 family transposase	transposase	NA	NA	NA	NA
AYK17897.1|1797746_1798757_-	sulfite reductase subunit C	NA	NA	NA	NA	NA
AYK17898.1|1798768_1799608_-	anaerobic sulfite reductase subunit AsrB	NA	NA	NA	NA	NA
AYK17899.1|1799609_1800668_-	anaerobic sulfite reductase subunit AsrA	NA	NA	NA	NA	NA
AYK17900.1|1800868_1801711_-	patatin family protein	NA	NA	NA	NA	NA
AYK17901.1|1801976_1802993_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
AYK17902.1|1803057_1805313_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
AYK17903.1|1805568_1806654_+	hypothetical protein	NA	NA	NA	NA	NA
AYK17904.1|1806735_1808088_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AYK17905.1|1808509_1809838_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
AYK17906.1|1810106_1810739_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
AYK17907.1|1811000_1811336_-	DUF3802 family protein	NA	NA	NA	NA	NA
AYK17908.1|1811393_1811882_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK17909.1|1811878_1812262_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AYK17910.1|1812380_1813172_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AYK17911.1|1813363_1814707_-	hypothetical protein	NA	NA	NA	NA	NA
AYK17912.1|1815312_1816386_-	carotenoid 1,2-hydratase	NA	NA	NA	NA	NA
AYK17913.1|1816382_1818812_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
AYK17914.1|1818842_1819523_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	1.1e-29
AYK17915.1|1819720_1820188_+	DUF4357 domain-containing protein	NA	NA	NA	NA	NA
AYK17916.1|1820295_1821720_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AYK17917.1|1821805_1823017_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	23.9	5.9e-21
AYK17918.1|1823130_1824825_-	hypothetical protein	NA	NA	NA	NA	NA
AYK17919.1|1824883_1826317_-	hypothetical protein	NA	NA	NA	NA	NA
AYK17920.1|1826330_1826891_-	hypothetical protein	NA	NA	NA	NA	NA
AYK17921.1|1826925_1828350_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AYK17922.1|1828452_1829292_-	hypothetical protein	NA	NA	NA	NA	NA
AYK17923.1|1832285_1832735_-	hypothetical protein	NA	NA	NA	NA	NA
AYK17924.1|1832967_1833951_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	78.9	1.3e-146
AYK17925.1|1834109_1835072_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AYK17926.1|1835149_1836112_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 4
CP032839	Aeromonas veronii strain FC951 chromosome, complete genome	4666657	1924201	1972987	4666657	protease,transposase,tRNA,integrase	Aeromonas_phage(21.43%)	40	1930654:1930671	1960079:1960096
AYK17987.1|1924201_1925146_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
AYK17988.1|1925269_1925647_+	DUF454 domain-containing protein	NA	NA	NA	NA	NA
AYK17989.1|1925676_1926327_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.7	2.8e-30
AYK17990.1|1926499_1929076_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	36.3	1.1e-43
AYK17991.1|1929190_1929520_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AYK17992.1|1929640_1929829_+	hypothetical protein	NA	NA	NA	NA	NA
AYK17993.1|1929838_1930681_+	deoxyribonuclease IV	NA	A0A1V0SCI4	Indivirus	26.0	2.3e-16
1930654:1930671	attL	CAGCTGGTTGCGCAGTCT	NA	NA	NA	NA
AYK17994.1|1930776_1931682_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYK17995.1|1931784_1932777_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AYK20233.1|1933035_1934025_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AYK17996.1|1934172_1935171_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AYK17997.1|1935366_1936227_+	serine protein kinase RIO	NA	NA	NA	NA	NA
AYK17998.1|1936609_1938226_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYK17999.1|1939887_1943358_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AYK18000.1|1943370_1943949_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
AYK18001.1|1944025_1945261_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
AYK20234.1|1945265_1946057_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	39.7	2.1e-35
AYK18002.1|1946056_1947298_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AYK18003.1|1947428_1948019_-	5'-deoxynucleotidase	NA	NA	NA	NA	NA
AYK18004.1|1948103_1948538_-	YccF domain-containing protein	NA	NA	NA	NA	NA
AYK18005.1|1948968_1950279_+	trigger factor	NA	NA	NA	NA	NA
AYK20235.1|1950386_1950989_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	61.2	1.9e-60
AYK18006.1|1951059_1952334_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.5	2.5e-131
AYK18007.1|1952475_1954830_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.6	1.2e-224
AYK18008.1|1955070_1955343_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	61.8	5.0e-21
AYK20236.1|1955496_1957407_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AYK18009.1|1957621_1959214_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.3	6.5e-60
AYK18010.1|1959239_1959701_-|integrase	integrase	integrase	A0A1I9KF78	Aeromonas_phage	42.3	9.7e-25
AYK18011.1|1959685_1960156_-	hypothetical protein	NA	A0A1I9KF78	Aeromonas_phage	40.1	9.9e-25
1960079:1960096	attR	CAGCTGGTTGCGCAGTCT	NA	NA	NA	NA
AYK18012.1|1960197_1960449_-	DUF3596 domain-containing protein	NA	A0A1I9KF78	Aeromonas_phage	68.3	6.9e-17
AYK18013.1|1960843_1961029_-	hypothetical protein	NA	NA	NA	NA	NA
AYK18014.1|1962774_1962966_+	hypothetical protein	NA	NA	NA	NA	NA
AYK18015.1|1964034_1964214_-	hypothetical protein	NA	NA	NA	NA	NA
AYK18016.1|1964272_1965223_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AYK18017.1|1966065_1966254_+	hypothetical protein	NA	NA	NA	NA	NA
AYK18018.1|1966357_1967296_-	hypothetical protein	NA	NA	NA	NA	NA
AYK18019.1|1967468_1968386_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	57.3	7.4e-93
AYK18020.1|1969467_1969659_-	hypothetical protein	NA	NA	NA	NA	NA
AYK18021.1|1969679_1970741_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYK18022.1|1971946_1972987_-|transposase	IS481-like element ISAs19 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	42.1	1.7e-72
>prophage 5
CP032839	Aeromonas veronii strain FC951 chromosome, complete genome	4666657	2373914	2451357	4666657	transposase	Hokovirus(25.0%)	56	NA	NA
AYK18318.1|2373914_2374865_+|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
AYK18319.1|2376149_2377196_+	diguanylate cyclase	NA	NA	NA	NA	NA
AYK18320.1|2377239_2378376_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AYK18321.1|2378388_2379660_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AYK18322.1|2379656_2381063_-	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
AYK18323.1|2381050_2382370_-	sugar translocase	NA	NA	NA	NA	NA
AYK18324.1|2382669_2383425_+	acyltransferase	NA	NA	NA	NA	NA
AYK18325.1|2383421_2384621_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AYK18326.1|2384617_2387158_+	hypothetical protein	NA	NA	NA	NA	NA
AYK18327.1|2387169_2387646_+	hypothetical protein	NA	NA	NA	NA	NA
AYK18328.1|2387623_2388070_-	hypothetical protein	NA	NA	NA	NA	NA
AYK18329.1|2388056_2388824_-	hypothetical protein	NA	NA	NA	NA	NA
AYK18330.1|2389946_2390387_-	hypothetical protein	NA	NA	NA	NA	NA
AYK18331.1|2391050_2391536_-	hypothetical protein	NA	NA	NA	NA	NA
AYK18332.1|2391918_2393334_-	chain-length determining protein	NA	NA	NA	NA	NA
AYK18333.1|2393491_2394607_+	glycosyltransferase	NA	NA	NA	NA	NA
AYK18334.1|2394638_2395832_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AYK18335.1|2395828_2396464_+	sugar transferase	NA	NA	NA	NA	NA
AYK18336.1|2396651_2397653_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AYK18337.1|2397733_2399224_-	response regulator	NA	NA	NA	NA	NA
AYK18338.1|2399247_2399916_-	tyrosine-protein kinase family protein	NA	NA	NA	NA	NA
AYK18339.1|2399917_2402023_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYK18340.1|2402041_2402458_-	hypothetical protein	NA	NA	NA	NA	NA
AYK18341.1|2402454_2402805_-	anti-sigma factor antagonist	NA	NA	NA	NA	NA
AYK18342.1|2403143_2403635_+	molybdopterin-binding protein	NA	NA	NA	NA	NA
AYK18343.1|2403643_2405470_+	response regulator	NA	A0A1V0SGX0	Hokovirus	36.3	3.8e-56
AYK18344.1|2405985_2406774_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AYK18345.1|2406878_2408315_-	arginine-ornithine antiporter	NA	NA	NA	NA	NA
AYK18346.1|2408673_2409453_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYK18347.1|2409505_2410408_-	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
AYK18348.1|2410459_2411572_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
AYK20271.1|2411590_2412373_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AYK18349.1|2413969_2415112_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AYK18350.1|2416720_2417575_+	crotonase	NA	NA	NA	NA	NA
AYK18351.1|2417571_2419542_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
AYK18352.1|2419538_2420507_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	36.0	3.3e-43
AYK18353.1|2420509_2420920_+	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AYK18354.1|2420956_2421718_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYK18355.1|2421770_2424758_+	DUF748 domain-containing protein	NA	NA	NA	NA	NA
AYK18356.1|2424981_2425578_+	hypothetical protein	NA	NA	NA	NA	NA
AYK18357.1|2425659_2426469_-	zinc-dependent peptidase	NA	NA	NA	NA	NA
AYK18358.1|2426500_2426938_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK18359.1|2427286_2428786_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
AYK18360.1|2428856_2429663_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
AYK18361.1|2429831_2431619_+	cyclic nucleotide-binding/CBS domain-containing protein	NA	NA	NA	NA	NA
AYK18362.1|2431621_2432248_+	3'-5' exonuclease	NA	NA	NA	NA	NA
AYK18363.1|2432353_2432665_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
AYK20272.1|2432676_2434329_+	cation acetate symporter	NA	NA	NA	NA	NA
AYK18364.1|2434433_2435652_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.5	3.4e-16
AYK18365.1|2436323_2437745_-|transposase	IS66-like element ISKpn15 family transposase	transposase	NA	NA	NA	NA
AYK18366.1|2440058_2440997_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AYK18367.1|2441526_2441907_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AYK18368.1|2442024_2443650_-	MCR-3 family phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
AYK18369.1|2446987_2447188_+	hypothetical protein	NA	NA	NA	NA	NA
AYK18370.1|2448655_2450217_-|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
AYK18371.1|2450316_2451357_-|transposase	IS481-like element ISAs19 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	41.8	1.7e-72
>prophage 6
CP032839	Aeromonas veronii strain FC951 chromosome, complete genome	4666657	2599456	2610037	4666657	protease,tRNA	Bacillus_phage(42.86%)	11	NA	NA
AYK18477.1|2599456_2600704_+	response regulator	NA	A0A127AWB9	Bacillus_phage	32.2	2.5e-14
AYK18478.1|2600812_2601283_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AYK18479.1|2601302_2602010_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AYK18480.1|2602006_2602723_+	arginyltransferase	NA	NA	NA	NA	NA
AYK18481.1|2602791_2603010_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AYK18482.1|2603078_2605334_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.0	2.7e-168
AYK18483.1|2605393_2605711_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	49.4	1.4e-14
AYK18484.1|2605940_2606159_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.2	1.2e-17
AYK18485.1|2606276_2607131_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	32.9	4.6e-28
AYK18486.1|2607979_2608690_+	two-component system response regulator RstA	NA	W8CYM9	Bacillus_phage	31.4	3.8e-28
AYK18487.1|2608711_2610037_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	7.4e-17
>prophage 7
CP032839	Aeromonas veronii strain FC951 chromosome, complete genome	4666657	3477389	3505449	4666657	transposase	uncultured_virus(33.33%)	17	NA	NA
AYK19171.1|3477389_3479033_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	31.7	2.4e-41
AYK19172.1|3479088_3480147_+	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	52.2	9.2e-103
AYK19173.1|3480266_3482456_+	hypothetical protein	NA	NA	NA	NA	NA
AYK19174.1|3482471_3483197_+	hypothetical protein	NA	NA	NA	NA	NA
AYK19175.1|3483181_3484882_+	hypothetical protein	NA	NA	NA	NA	NA
AYK19176.1|3484885_3488110_+	DEAD/DEAH box helicase	NA	A0A160DHD3	Gordonia_phage	28.8	4.1e-37
AYK19177.1|3488183_3489134_-|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
AYK19178.1|3489605_3491036_-	hypothetical protein	NA	NA	NA	NA	NA
AYK19179.1|3491420_3492254_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AYK19180.1|3492256_3492994_+	hypothetical protein	NA	NA	NA	NA	NA
AYK19181.1|3492997_3494671_+	protein kinase family protein	NA	NA	NA	NA	NA
AYK19182.1|3495088_3496510_-|transposase	IS66-like element ISKpn15 family transposase	transposase	NA	NA	NA	NA
AYK19183.1|3498190_3498700_+	hypothetical protein	NA	NA	NA	NA	NA
AYK19184.1|3500572_3500908_+	hypothetical protein	NA	NA	NA	NA	NA
AYK19185.1|3501249_3502810_+|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
AYK19186.1|3502807_3503899_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AYK19187.1|3504417_3505449_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
CP032839	Aeromonas veronii strain FC951 chromosome, complete genome	4666657	4026551	4084363	4666657	transposase,tRNA,integrase	Bacillus_thuringiensis_phage(50.0%)	50	4075813:4075872	4097236:4097312
AYK19621.1|4026551_4027499_+	hypothetical protein	NA	Q56AS0	Bacillus_thuringiensis_phage	100.0	9.3e-22
AYK19622.1|4027583_4028198_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	97.1	1.9e-113
AYK19623.1|4028215_4028695_-	hypothetical protein	NA	Q56AR5	Bacillus_thuringiensis_phage	98.7	3.0e-37
AYK19624.1|4028639_4028828_+	hypothetical protein	NA	Q56AR2	Bacillus_thuringiensis_phage	97.6	1.4e-17
AYK19625.1|4028871_4029888_-	chemotaxis signal transduction protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	99.7	1.3e-191
AYK19626.1|4030089_4030809_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q56AQ6	Bacillus_thuringiensis_phage	97.1	1.2e-130
AYK19627.1|4030795_4032862_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	Q56AQ2	Bacillus_thuringiensis_phage	93.3	1.0e-97
AYK19628.1|4032858_4033170_-	transcriptional regulator	NA	NA	NA	NA	NA
AYK19629.1|4033306_4033513_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
AYK19630.1|4033657_4034134_+	bacterioferritin	NA	NA	NA	NA	NA
AYK19631.1|4034318_4034777_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AYK20364.1|4034866_4036042_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
AYK19632.1|4036057_4037026_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.2	1.0e-180
AYK19633.1|4037362_4037884_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYK19634.1|4037880_4038834_+	fec operon regulator FecR	NA	NA	NA	NA	NA
AYK19635.1|4038920_4041245_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AYK19636.1|4041303_4042206_+	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AYK19637.1|4042202_4043201_+	iron-dicitrate ABC transporter permease FecC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	23.0	2.3e-10
AYK19638.1|4043197_4044154_+	iron-dicitrate ABC transporter permease FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.2	2.0e-16
AYK19639.1|4044154_4044922_+	iron-dicitrate ABC transporter ATP-binding subunit	NA	G3M9Y6	Bacillus_virus	25.2	4.9e-13
AYK19640.1|4045347_4045644_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYK19641.1|4046502_4047774_+	hypothetical protein	NA	NA	NA	NA	NA
AYK19642.1|4048523_4049441_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	58.2	2.6e-98
AYK19643.1|4049729_4050314_+	hypothetical protein	NA	NA	NA	NA	NA
AYK20365.1|4050414_4050840_-	hypothetical protein	NA	NA	NA	NA	NA
AYK19644.1|4051063_4051810_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYK19645.1|4051852_4052089_-	DUF3624 domain-containing protein	NA	NA	NA	NA	NA
AYK19646.1|4052085_4052559_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYK19647.1|4052746_4054189_+	RimK family alpha-L-glutamate ligase	NA	NA	NA	NA	NA
AYK20366.1|4054216_4054744_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	33.7	3.6e-07
AYK19648.1|4054789_4056118_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AYK19649.1|4056236_4057853_-	glycosidase	NA	NA	NA	NA	NA
AYK19650.1|4060174_4060432_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
AYK19651.1|4060691_4062656_+	LTA synthase family protein	NA	NA	NA	NA	NA
AYK19652.1|4062747_4063218_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AYK19653.1|4063361_4063880_+	protein tyrosine phosphatase	NA	NA	NA	NA	NA
AYK19654.1|4063880_4064828_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
AYK19655.1|4064912_4066211_+	DUF3391 domain-containing protein	NA	NA	NA	NA	NA
AYK19656.1|4066264_4067413_+	CinA family nicotinamide mononucleotide deamidase-related protein	NA	NA	NA	NA	NA
AYK19657.1|4067614_4069336_+	DUF342 domain-containing protein	NA	NA	NA	NA	NA
AYK19658.1|4069450_4070260_+	sugar-phosphatase	NA	NA	NA	NA	NA
AYK19659.1|4070369_4073453_-	penicillin-binding protein	NA	NA	NA	NA	NA
AYK19660.1|4073661_4073979_-	DUF496 family protein	NA	NA	NA	NA	NA
AYK19661.1|4074658_4074871_+	hypothetical protein	NA	NA	NA	NA	NA
AYK19662.1|4074861_4075812_-|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
4075813:4075872	attL	GATCTCGCACCTCGATAACTGTACGTAAGATCAGTATAGTTCGTGGTAACTGACTGCTAA	NA	NA	NA	NA
AYK19663.1|4075898_4076315_+	hypothetical protein	NA	NA	NA	NA	NA
AYK19664.1|4076307_4078542_+	hypothetical protein	NA	NA	NA	NA	NA
AYK19665.1|4078526_4081889_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AYK19666.1|4082321_4083188_-	HDIG domain-containing protein	NA	NA	NA	NA	NA
AYK19667.1|4083184_4084363_-|integrase	site-specific integrase	integrase	R9TMP3	Vibrio_phage	23.7	5.2e-22
4097236:4097312	attR	TTAGCAGTCAGTTACCACGAACTATACTGATCTTACGTACAGTTATCGAGGTGCGAGATCATGGCCAAAAGCAAAAT	NA	NA	NA	NA
>prophage 9
CP032839	Aeromonas veronii strain FC951 chromosome, complete genome	4666657	4090810	4149371	4666657	transposase,tRNA	Salmonella_phage(20.0%)	42	NA	NA
AYK19673.1|4090810_4092352_-|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	4.4e-130
AYK19674.1|4093039_4094461_+|transposase	IS66-like element ISKpn15 family transposase	transposase	NA	NA	NA	NA
AYK19675.1|4095263_4095449_+	hypothetical protein	NA	NA	NA	NA	NA
AYK20367.1|4095583_4097161_-	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	97.2	1.0e-94
AYK19676.1|4097295_4098246_+|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
AYK19677.1|4098341_4098554_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AYK20368.1|4098516_4098636_+	mercury resistance protein	NA	NA	NA	NA	NA
AYK19678.1|4098619_4098856_-	mercury resistance protein	NA	NA	NA	NA	NA
AYK19679.1|4098852_4099218_-	transcriptional regulator	NA	NA	NA	NA	NA
AYK19680.1|4099235_4100921_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.3e-39
AYK19681.1|4100959_4101385_-	mercury transporter MerC	NA	NA	NA	NA	NA
AYK19682.1|4101412_4101688_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
AYK19683.1|4101703_4102084_-	mercuric transporter	NA	NA	NA	NA	NA
AYK19684.1|4102155_4102611_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AYK19685.1|4102659_4103235_+	phospholipid:lipid A palmitoyltransferase	NA	NA	NA	NA	NA
AYK19686.1|4103242_4104208_-	acyltransferase	NA	NA	NA	NA	NA
AYK19687.1|4104358_4107415_-	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	21.9	7.1e-23
AYK19688.1|4107414_4108500_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYK19689.1|4108844_4109861_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
AYK19690.1|4110035_4110284_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
AYK19691.1|4110410_4110986_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	52.7	5.6e-46
AYK19692.1|4111164_4111785_+	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	100.0	1.4e-42
AYK19693.1|4112395_4113427_-|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
AYK19694.1|4113537_4118640_-	DNA phosphorothioation-dependent restriction protein DptH	NA	NA	NA	NA	NA
AYK19695.1|4119806_4121135_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AYK19696.1|4121389_4123009_-	DNA phosphorothioation-dependent restriction protein DptF	NA	NA	NA	NA	NA
AYK19697.1|4129110_4131978_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	38.8	2.2e-21
AYK19698.1|4132093_4132750_+|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
AYK19699.1|4132810_4132999_-	hypothetical protein	NA	NA	NA	NA	NA
AYK19700.1|4133118_4133718_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
AYK19701.1|4133721_4135383_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
AYK19702.1|4135449_4136880_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AYK19703.1|4137072_4138020_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
AYK19704.1|4138157_4139108_+	AEC family transporter	NA	NA	NA	NA	NA
AYK19705.1|4139170_4139365_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
AYK19706.1|4139495_4140554_+	L-asparaginase 2	NA	NA	NA	NA	NA
AYK19707.1|4140797_4142090_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
AYK19708.1|4142108_4142774_+	DedA family protein	NA	NA	NA	NA	NA
AYK19709.1|4142933_4143761_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
AYK19710.1|4145199_4145388_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	2.9e-12
AYK19711.1|4145491_4146730_-	aspartate kinase	NA	NA	NA	NA	NA
AYK19712.1|4146746_4149371_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.3	9.6e-77
>prophage 10
CP032839	Aeromonas veronii strain FC951 chromosome, complete genome	4666657	4181173	4253234	4666657	protease,transposase,tRNA,integrase	Salmonella_phage(11.11%)	54	4173461:4173476	4199982:4199997
4173461:4173476	attL	GCCGCCAGCGGCAGGC	NA	NA	NA	NA
AYK19744.1|4181173_4182595_+|transposase	IS66-like element ISKpn15 family transposase	transposase	NA	NA	NA	NA
AYK20373.1|4182904_4185634_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
AYK19745.1|4186886_4187321_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AYK19746.1|4187381_4188943_-|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
AYK19747.1|4188990_4189269_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AYK19748.1|4189883_4190072_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AYK19749.1|4190625_4191579_+	hypothetical protein	NA	NA	NA	NA	NA
AYK19750.1|4191671_4192955_-|integrase	site-specific integrase	integrase	Q9AZ40	Salmonella_phage	23.3	5.7e-14
AYK19751.1|4193158_4195714_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	24.6	1.8e-35
AYK19752.1|4195790_4196654_-	patatin family protein	NA	NA	NA	NA	NA
AYK19753.1|4197904_4198594_-	LrgB family protein	NA	NA	NA	NA	NA
AYK20374.1|4198586_4198988_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
AYK19754.1|4199122_4200007_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
4199982:4199997	attR	GCCGCCAGCGGCAGGC	NA	NA	NA	NA
AYK19755.1|4200000_4200885_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYK19756.1|4201068_4201533_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AYK19757.1|4201752_4202190_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYK19758.1|4202182_4203124_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
AYK19759.1|4203291_4203831_-|transposase	transposase	transposase	NA	NA	NA	NA
AYK19760.1|4204350_4205556_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
AYK19761.1|4205591_4206359_-	thiazole synthase	NA	NA	NA	NA	NA
AYK19762.1|4206360_4206567_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AYK19763.1|4206563_4207340_-	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
AYK19764.1|4207329_4208946_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
AYK19765.1|4208942_4210934_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
AYK19766.1|4214590_4215076_-	hypothetical protein	NA	NA	NA	NA	NA
AYK19767.1|4215162_4215585_-	hypothetical protein	NA	NA	NA	NA	NA
AYK19768.1|4215673_4216342_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.3	6.7e-27
AYK19769.1|4216338_4217583_+	sensor histidine kinase	NA	NA	NA	NA	NA
AYK19770.1|4217678_4218575_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.3	7.9e-39
AYK19771.1|4218806_4222502_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	80.3	1.2e-21
AYK19772.1|4222718_4223990_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	39.8	2.3e-39
AYK19773.1|4224496_4224673_+	hypothetical protein	NA	NA	NA	NA	NA
AYK19774.1|4224826_4225324_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYK19775.1|4225452_4226274_-	HDOD domain-containing protein	NA	A0A1C3NFB0	Phage_NCTB	24.0	3.5e-09
AYK19776.1|4226443_4226710_+	hypothetical protein	NA	NA	NA	NA	NA
AYK19777.1|4226783_4227503_-	class B acid phosphatase	NA	NA	NA	NA	NA
AYK19778.1|4227609_4228284_-	adenine nucleotide alpha hydrolase	NA	NA	NA	NA	NA
AYK19779.1|4228450_4229770_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.4	3.7e-37
AYK19780.1|4229908_4230631_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
AYK20375.1|4230790_4230994_+	hypothetical protein	NA	NA	NA	NA	NA
AYK19781.1|4231126_4232566_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AYK19782.1|4232707_4233541_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AYK19783.1|4233566_4233887_-	Dabb family protein	NA	NA	NA	NA	NA
AYK20376.1|4233921_4237785_-	TIGR02099 family protein	NA	NA	NA	NA	NA
AYK19784.1|4237815_4239285_-	ribonuclease G	NA	NA	NA	NA	NA
AYK19785.1|4239364_4239952_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AYK19786.1|4239954_4240440_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AYK19787.1|4240439_4241330_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AYK19788.1|4241372_4242413_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.9	2.1e-06
AYK19789.1|4245428_4246352_+	1-aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase	NA	NA	NA	NA	NA
AYK19790.1|4246428_4248387_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AYK19791.1|4248862_4250389_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYK19792.1|4250670_4251768_+	calcium:proton antiporter	NA	NA	NA	NA	NA
AYK19793.1|4251896_4253234_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
>prophage 11
CP032839	Aeromonas veronii strain FC951 chromosome, complete genome	4666657	4647015	4657658	4666657		Liberibacter_phage(16.67%)	9	NA	NA
AYK20111.1|4647015_4650300_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.6	3.2e-69
AYK20112.1|4650296_4651316_-	hydroxyacid dehydrogenase	NA	Q9JMN3	Wolbachia_phage	40.4	5.1e-58
AYK20113.1|4651329_4652028_-	YecA family protein	NA	H9NBT7	Sphingomonas_phage	69.0	3.4e-05
AYK20114.1|4652024_4653272_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AYK20115.1|4653261_4654788_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.5	1.2e-87
AYK20116.1|4654791_4655628_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	78.4	2.6e-92
AYK20117.1|4655624_4656230_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AYK20397.1|4656463_4656799_+	DNA-binding protein	NA	NA	NA	NA	NA
AYK20398.1|4656806_4657658_+	hypothetical protein	NA	A0A0E3GMB2	Rhodoferax_phage	29.0	1.1e-18
