The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP018909	Acinetobacter pittii strain XJ88, complete genome	4090120	219200	231704	4090120		Acinetobacter_phage(100.0%)	10	NA	NA
AUM25580.1|219200_219755_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	99.5	7.9e-98
AUM25581.1|220010_221510_+	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	97.2	1.2e-278
AUM25582.1|221511_223887_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	97.5	0.0e+00
AUM25583.1|223893_224877_+	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	94.8	4.6e-181
AUM25584.1|224887_225583_-	DNA mismatch repair protein MutS	NA	A0A0P0IDT4	Acinetobacter_phage	97.0	1.3e-118
AUM25585.1|225592_226399_-	indole-3-glycerol phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	97.0	6.2e-144
AUM25586.1|226408_227458_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	98.9	5.4e-188
AUM25587.1|227467_228052_-	anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	98.5	8.6e-111
AUM25588.1|228345_230148_-	Xaa-Pro aminopeptidase	NA	A0A0P0I8D7	Acinetobacter_phage	91.5	0.0e+00
AUM25589.1|230144_231704_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	78.9	2.4e-232
>prophage 2
CP018909	Acinetobacter pittii strain XJ88, complete genome	4090120	560145	623165	4090120	capsid,head,tail,coat,integrase,terminase,holin	Acinetobacter_phage(88.89%)	79	579728:579744	627975:627991
AUM25876.1|560145_562374_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AUM25877.1|562421_562856_-	thioesterase	NA	NA	NA	NA	NA
AUM25878.1|562855_564013_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUM25879.1|564372_564684_+	hypothetical protein	NA	NA	NA	NA	NA
AUM28942.1|565076_565205_+	hypothetical protein	NA	NA	NA	NA	NA
AUM25880.1|565386_565854_-	transcriptional regulator	NA	NA	NA	NA	NA
AUM25881.1|565916_566144_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AUM28943.1|566419_566905_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AUM25882.1|566924_567959_+	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AUM25883.1|567963_569088_+	hypothetical protein	NA	NA	NA	NA	NA
AUM25884.1|569087_570116_+	lysophospholipase	NA	NA	NA	NA	NA
AUM25885.1|570172_570667_-	hypothetical protein	NA	NA	NA	NA	NA
AUM25886.1|570729_571785_-	choloylglycine hydrolase	NA	NA	NA	NA	NA
AUM28944.1|571996_573397_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
AUM28945.1|574390_574885_+|coat	spore coat protein SpoU	coat	NA	NA	NA	NA
AUM25887.1|574968_575676_+	pilus assembly protein	NA	NA	NA	NA	NA
AUM25888.1|575686_578125_+	fimbrial protein	NA	NA	NA	NA	NA
AUM25889.1|578115_579144_+|coat	spore coat protein SpoU	coat	NA	NA	NA	NA
579728:579744	attL	GGATTCTACTTTTTCTA	NA	NA	NA	NA
AUM25890.1|579905_581168_+|integrase	integrase	integrase	A0A0P0IKP2	Acinetobacter_phage	93.3	9.8e-237
AUM25891.1|581173_581443_-	DNA-binding protein	NA	A0A0N7IRE8	Acinetobacter_phage	95.5	2.5e-41
AUM25892.1|581443_581740_-	hypothetical protein	NA	NA	NA	NA	NA
AUM25893.1|581739_582714_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	76.2	6.0e-133
AUM25894.1|582710_583781_-	AAA family ATPase	NA	A0A1B1P9H8	Acinetobacter_phage	52.0	2.9e-48
AUM25895.1|583792_584116_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	86.9	3.9e-49
AUM25896.1|584118_584556_-	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	62.6	1.2e-40
AUM25897.1|584767_585796_-	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	36.4	5.7e-57
AUM25898.1|585855_586071_-	hypothetical protein	NA	A0A0D4DBY2	Acinetobacter_phage	95.8	4.2e-31
AUM25899.1|586139_586811_-	geranylgeranyl reductase	NA	A0A2H4JAJ5	uncultured_Caudovirales_phage	66.9	6.3e-57
AUM25900.1|586887_587073_+	hypothetical protein	NA	J7HXD2	Acinetobacter_phage	74.5	9.5e-16
AUM25901.1|587083_587347_+	hypothetical protein	NA	NA	NA	NA	NA
AUM25902.1|587394_587664_+	hypothetical protein	NA	A0A0P0J0B9	Acinetobacter_phage	45.7	9.7e-09
AUM25903.1|587660_587954_+	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	56.2	1.7e-22
AUM25904.1|587953_588913_+	helix-turn-helix domain-containing protein	NA	A0A0P0HSN8	Acinetobacter_phage	51.9	9.7e-19
AUM28946.1|589035_589245_+	hypothetical protein	NA	NA	NA	NA	NA
AUM25905.1|589241_589649_+	hypothetical protein	NA	A0A0R6PIZ9	Moraxella_phage	49.1	1.2e-21
AUM25906.1|589654_590272_+	hypothetical protein	NA	NA	NA	NA	NA
AUM25907.1|590569_591340_+	restriction endonuclease subunit M	NA	C7BGE1	Burkholderia_phage	59.6	1.3e-85
AUM25908.1|591544_591805_+	hypothetical protein	NA	NA	NA	NA	NA
AUM25909.1|591885_592116_+	hypothetical protein	NA	NA	NA	NA	NA
AUM25910.1|592180_592369_+	hypothetical protein	NA	J7I0V8	Acinetobacter_phage	75.8	8.5e-20
AUM25911.1|592384_592813_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	66.9	3.2e-46
AUM25912.1|592781_593423_+	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	92.0	5.5e-119
AUM25913.1|593481_593952_+	hypothetical protein	NA	A0A0D4DC15	Acinetobacter_phage	85.9	1.4e-71
AUM25914.1|593941_595369_+|terminase	terminase	terminase	A0A0D4DCE6	Acinetobacter_phage	88.4	6.3e-248
AUM25915.1|595365_596808_+	hypothetical protein	NA	A0A0D4DCP1	Acinetobacter_phage	88.3	5.9e-254
AUM25916.1|596818_597922_+|head	phage head morphogenesis protein	head	A0A0D4DBL9	Acinetobacter_phage	88.3	1.6e-187
AUM25917.1|597931_598360_+	hypothetical protein	NA	A0A0D4DBV9	Acinetobacter_phage	97.9	6.4e-71
AUM25918.1|598458_598695_+	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	93.6	1.1e-35
AUM25919.1|598716_598932_+	hypothetical protein	NA	NA	NA	NA	NA
AUM25920.1|599054_599606_+	hypothetical protein	NA	A0A2I7RHW2	Vibrio_phage	65.5	1.1e-17
AUM25921.1|599720_600488_+	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	80.4	6.4e-106
AUM25922.1|600515_601460_+|capsid	phage capsid protein	capsid	A0A0D4DBM4	Acinetobacter_phage	92.0	6.4e-164
AUM25923.1|601528_602188_+	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	61.1	3.7e-62
AUM25924.1|602192_602582_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	93.0	1.4e-61
AUM25925.1|602585_602954_+	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	91.0	5.7e-60
AUM25926.1|602993_603722_+	hypothetical protein	NA	NA	NA	NA	NA
AUM25927.1|603937_604345_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	76.9	5.1e-54
AUM28947.1|604316_604685_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	93.4	2.5e-60
AUM25928.1|604686_605085_+	hypothetical protein	NA	A0A0P0IRA6	Acinetobacter_phage	72.7	6.1e-52
AUM25929.1|605092_605422_+	hypothetical protein	NA	NA	NA	NA	NA
AUM25930.1|605520_605874_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	91.5	1.4e-55
AUM25931.1|605873_607016_+|tail	phage tail protein	tail	J7I0X3	Acinetobacter_phage	84.4	4.4e-151
AUM25932.1|607112_608030_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	93.1	1.4e-160
AUM28948.1|608099_608609_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	81.4	6.4e-62
AUM25933.1|608596_608863_+	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	56.5	5.2e-23
AUM25934.1|608955_609303_+	hypothetical protein	NA	NA	NA	NA	NA
AUM25935.1|609365_610004_+	energy transducer TonB	NA	NA	NA	NA	NA
AUM25936.1|610101_610644_+	hypothetical protein	NA	NA	NA	NA	NA
AUM25937.1|610640_610988_+	hypothetical protein	NA	NA	NA	NA	NA
AUM25938.1|611039_611498_+	hypothetical protein	NA	NA	NA	NA	NA
AUM25939.1|611665_616009_+|tail	phage tail tape measure protein	tail	A0A0D4DC37	Acinetobacter_phage	78.5	0.0e+00
AUM25940.1|616099_616687_+	hypothetical protein	NA	NA	NA	NA	NA
AUM25941.1|616779_617178_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	96.2	1.2e-71
AUM25942.1|617177_617684_+	hypothetical protein	NA	A0A0P0IKN4	Acinetobacter_phage	89.9	1.7e-86
AUM25943.1|617680_618043_+	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	80.8	2.8e-51
AUM25944.1|618035_621479_+	hypothetical protein	NA	A0A0D4DBG7	Acinetobacter_phage	90.1	0.0e+00
AUM25945.1|621601_621991_+	hypothetical protein	NA	J7I481	Acinetobacter_phage	95.3	1.4e-64
AUM28949.1|622108_622555_+	hypothetical protein	NA	NA	NA	NA	NA
AUM25946.1|622619_623165_+	hypothetical protein	NA	J7I0Y1	Acinetobacter_phage	92.2	4.0e-94
627975:627991	attR	GGATTCTACTTTTTCTA	NA	NA	NA	NA
>prophage 3
CP018909	Acinetobacter pittii strain XJ88, complete genome	4090120	1700480	1707871	4090120	transposase	Acinetobacter_phage(50.0%)	9	NA	NA
AUM26889.1|1700480_1700708_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	61.7	8.1e-17
AUM26890.1|1701051_1701984_-	lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	34.6	2.7e-42
AUM26891.1|1702223_1702841_+	lysine transporter LysE	NA	NA	NA	NA	NA
AUM26892.1|1702938_1703484_-	hypothetical protein	NA	A0A0B5L5G7	Acinetobacter_phage	69.1	3.9e-73
AUM26893.1|1703514_1703904_-	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	76.7	3.0e-51
AUM26894.1|1704113_1704368_-	hypothetical protein	NA	NA	NA	NA	NA
AUM26895.1|1705041_1705713_+	peptidase S24	NA	A0A1B1P9J5	Acinetobacter_phage	55.8	1.2e-63
AUM26896.1|1705864_1706098_-|transposase	transposase	transposase	NA	NA	NA	NA
AUM26897.1|1706605_1707871_+	exodeoxyribonuclease VII large subunit	NA	M1NLU2	Moumouvirus	29.5	2.3e-12
>prophage 4
CP018909	Acinetobacter pittii strain XJ88, complete genome	4090120	1988397	2019762	4090120	head,tail,integrase,terminase,plate	Acinetobacter_phage(84.38%)	38	1980431:1980444	1990081:1990094
1980431:1980444	attL	TAGCTAAATATTTA	NA	NA	NA	NA
AUM27118.1|1988397_1989753_+|integrase	integrase	integrase	A0A0R6PHM8	Moraxella_phage	42.4	8.7e-82
AUM27119.1|1989988_1991161_+	hypothetical protein	NA	NA	NA	NA	NA
1990081:1990094	attR	TAAATATTTAGCTA	NA	NA	NA	NA
AUM27120.1|1991176_1991821_+	DUF159 family protein	NA	A0A218MNF5	uncultured_virus	48.8	3.5e-57
AUM27121.1|1991936_1992437_+	DNA polymerase V	NA	A0A2H4J538	uncultured_Caudovirales_phage	59.6	9.2e-45
AUM27122.1|1992433_1993732_+	DNA polymerase V subunit UmuC	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	61.2	9.4e-158
AUM27123.1|1993831_1994197_+	hypothetical protein	NA	NA	NA	NA	NA
AUM27124.1|1994364_1994907_-	hypothetical protein	NA	A0A0P0IW03	Acinetobacter_phage	93.9	3.6e-95
AUM27125.1|1995556_1995946_-	hypothetical protein	NA	J7I481	Acinetobacter_phage	92.2	7.6e-63
AUM27126.1|1996028_1998020_-	hypothetical protein	NA	NA	NA	NA	NA
AUM27127.1|1998082_1998826_-	hypothetical protein	NA	A0A0P0IE19	Acinetobacter_phage	61.2	5.3e-73
AUM27128.1|1998815_1999409_-	hypothetical protein	NA	A0A0P0IKZ0	Acinetobacter_phage	54.1	2.3e-58
AUM27129.1|1999408_2000593_-|plate	phage baseplate protein	plate	A0A0P0I499	Acinetobacter_phage	55.2	1.6e-119
AUM27130.1|2000589_2000949_-	hypothetical protein	NA	A0A0P0IVU6	Acinetobacter_phage	57.3	9.5e-36
AUM27131.1|2000985_2001663_-	hypothetical protein	NA	A0A0N7IRF4	Acinetobacter_phage	50.7	1.2e-60
AUM27132.1|2001662_2002655_-	hypothetical protein	NA	A0A0P0HSL6	Acinetobacter_phage	50.0	3.3e-86
AUM27133.1|2002651_2002948_-	hypothetical protein	NA	A0A0P0J0D9	Acinetobacter_phage	55.7	5.3e-24
AUM27134.1|2002941_2003607_-	hypothetical protein	NA	A0A0P0IKS1	Acinetobacter_phage	61.0	4.6e-52
AUM27135.1|2003660_2004122_+	hypothetical protein	NA	NA	NA	NA	NA
AUM27136.1|2004118_2004484_+	hypothetical protein	NA	NA	NA	NA	NA
AUM29033.1|2004480_2006646_-|tail	phage tail tape measure protein	tail	A0A0P0IE11	Acinetobacter_phage	38.4	9.0e-113
AUM27137.1|2006844_2007294_-	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	55.6	1.6e-40
AUM27138.1|2007305_2007749_-	hypothetical protein	NA	A0A0P0IKY2	Acinetobacter_phage	72.8	4.3e-54
AUM27139.1|2007759_2008881_-	hypothetical protein	NA	A0A0P0I492	Acinetobacter_phage	51.3	1.8e-125
AUM27140.1|2008877_2009423_-	hypothetical protein	NA	A0A0P0IVT9	Acinetobacter_phage	94.4	1.4e-94
AUM27141.1|2009426_2009795_-	hypothetical protein	NA	A0A0P0HSK8	Acinetobacter_phage	93.4	1.8e-61
AUM27142.1|2009806_2010343_-	hypothetical protein	NA	A0A0P0J0D1	Acinetobacter_phage	94.4	6.1e-87
AUM27143.1|2010339_2010726_-	hypothetical protein	NA	A0A0P0IKR4	Acinetobacter_phage	89.8	2.2e-62
AUM27144.1|2010729_2011215_-	hypothetical protein	NA	A0A0P0IYA6	Acinetobacter_phage	81.0	3.1e-37
AUM27145.1|2011224_2012250_-	hypothetical protein	NA	A0A0N7IRF2	Acinetobacter_phage	93.3	1.2e-184
AUM27146.1|2012315_2012792_-	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	91.8	1.2e-78
AUM27147.1|2012795_2014115_-	hypothetical protein	NA	A0A0P0IRE1	Acinetobacter_phage	86.1	9.8e-179
AUM27148.1|2014175_2014379_-	hypothetical protein	NA	NA	NA	NA	NA
AUM29034.1|2014420_2015008_-|head	phage head morphogenesis protein	head	A0A0P0IKX5	Acinetobacter_phage	91.2	5.8e-99
AUM27149.1|2015078_2016491_-	hypothetical protein	NA	A0A0P0I486	Acinetobacter_phage	95.5	7.9e-251
AUM27150.1|2016502_2018161_-|terminase	terminase	terminase	A0A0P0IVT4	Acinetobacter_phage	92.8	0.0e+00
AUM27151.1|2018157_2018664_-	hypothetical protein	NA	A0A2H4JI35	uncultured_Caudovirales_phage	64.9	6.0e-52
AUM27152.1|2018723_2019365_-	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	87.3	1.7e-112
AUM27153.1|2019333_2019762_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	65.5	3.5e-45
>prophage 5
CP018909	Acinetobacter pittii strain XJ88, complete genome	4090120	2022779	2029285	4090120		Acinetobacter_phage(77.78%)	12	NA	NA
AUM27159.1|2022779_2023277_-	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	97.6	2.4e-90
AUM27160.1|2023273_2023666_-	hypothetical protein	NA	A0A0P0I8E8	Acinetobacter_phage	87.0	4.6e-60
AUM27161.1|2023662_2024613_-	helix-turn-helix domain-containing protein	NA	A0A1V0E8B1	Vibrio_phage	41.2	6.2e-18
AUM27162.1|2024609_2024939_-	hypothetical protein	NA	NA	NA	NA	NA
AUM27163.1|2024986_2025259_-	hypothetical protein	NA	NA	NA	NA	NA
AUM27164.1|2025269_2025464_-	hypothetical protein	NA	A0A2H4JCB6	uncultured_Caudovirales_phage	53.4	1.4e-09
AUM27165.1|2025593_2026289_+	peptidase	NA	A0A0P0J076	Acinetobacter_phage	66.2	7.7e-50
AUM29036.1|2026483_2026924_+	hypothetical protein	NA	A0A0D4DBH9	Acinetobacter_phage	85.6	1.1e-65
AUM27166.1|2026926_2027250_+	hypothetical protein	NA	A0A0P0IRC4	Acinetobacter_phage	74.8	1.2e-40
AUM27167.1|2027260_2028028_+	hypothetical protein	NA	NA	NA	NA	NA
AUM27168.1|2028042_2029032_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	65.0	3.1e-105
AUM27169.1|2029033_2029285_+	hypothetical protein	NA	A0A0P0I475	Acinetobacter_phage	97.4	1.4e-38
>prophage 6
CP018909	Acinetobacter pittii strain XJ88, complete genome	4090120	3661133	3719009	4090120	capsid,integrase,tRNA,tail,portal,plate,terminase	uncultured_Caudovirales_phage(25.81%)	61	3666577:3666604	3701741:3701768
AUM28561.1|3661133_3662267_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.5	2.9e-94
AUM28562.1|3662419_3662989_-	hypothetical protein	NA	NA	NA	NA	NA
AUM28563.1|3663074_3664103_-	hypothetical protein	NA	NA	NA	NA	NA
AUM28564.1|3664193_3665201_-	hypothetical protein	NA	NA	NA	NA	NA
AUM28565.1|3665286_3666324_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
3666577:3666604	attL	TCCGACCCTCGGGACCATATTCAGAATC	NA	NA	NA	NA
AUM28566.1|3666770_3667838_+|integrase	integrase	integrase	A0A0A0YR56	Pseudomonas_phage	37.5	3.3e-44
AUM28567.1|3667826_3668603_-	hypothetical protein	NA	NA	NA	NA	NA
AUM28568.1|3668692_3668980_-	hypothetical protein	NA	NA	NA	NA	NA
AUM29144.1|3668984_3669191_-	hypothetical protein	NA	NA	NA	NA	NA
AUM28569.1|3669259_3671998_-	toprim	NA	A0A2H4JDT6	uncultured_Caudovirales_phage	62.0	0.0e+00
AUM28570.1|3672091_3672283_-	hypothetical protein	NA	NA	NA	NA	NA
AUM28571.1|3672374_3672716_+	transcriptional regulator	NA	A0A1S5NPU3	Burkholderia_phage	35.4	8.2e-05
AUM28572.1|3672696_3673650_+	hypothetical protein	NA	NA	NA	NA	NA
AUM28573.1|3673665_3673881_-	hypothetical protein	NA	NA	NA	NA	NA
AUM28574.1|3673997_3674819_-	Rha family transcriptional regulator	NA	A0A0P0ZGC2	Escherichia_phage	55.1	6.6e-24
AUM29145.1|3674926_3675121_-	hypothetical protein	NA	NA	NA	NA	NA
AUM28575.1|3675434_3675623_+	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	45.8	2.0e-05
AUM28576.1|3675641_3676103_+	hypothetical protein	NA	NA	NA	NA	NA
AUM28577.1|3676266_3677313_+	hypothetical protein	NA	NA	NA	NA	NA
AUM28578.1|3677315_3678515_+	hypothetical protein	NA	NA	NA	NA	NA
AUM28579.1|3678813_3679014_-	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AUM28580.1|3679010_3679250_-	transcriptional regulator	NA	NA	NA	NA	NA
AUM28581.1|3679377_3680691_-	DNA primase	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	43.3	1.2e-96
AUM28582.1|3680691_3681132_-	oxidoreductase	NA	A0A2H4JG54	uncultured_Caudovirales_phage	55.5	5.1e-39
AUM28583.1|3681137_3683678_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	53.0	2.4e-210
AUM29146.1|3683690_3683804_-|tail	phage tail protein	tail	NA	NA	NA	NA
AUM28584.1|3683830_3684172_-	hypothetical protein	NA	E5E3U8	Burkholderia_phage	48.8	1.4e-15
AUM28585.1|3684239_3684755_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	62.6	1.1e-56
AUM28586.1|3684767_3685943_-|tail	phage tail protein	tail	Q9ZXK4	Pseudomonas_virus	69.3	1.3e-153
AUM28587.1|3686034_3686328_-|tail	phage tail protein	tail	A0A088FV63	Escherichia_phage	54.8	5.6e-18
AUM28588.1|3686335_3687700_-|tail	phage tail protein	tail	A0A088FQW7	Escherichia_phage	52.6	1.2e-126
AUM28589.1|3687713_3689630_-	hypothetical protein	NA	NA	NA	NA	NA
AUM28590.1|3689631_3690234_-|tail	phage tail protein I	tail	A0A088FVH1	Escherichia_phage	48.8	2.6e-38
AUM28591.1|3690233_3691136_-|plate	baseplate J family protein	plate	D5LGZ3	Escherichia_phage	47.0	3.5e-71
AUM28592.1|3691143_3691491_-|plate	baseplate assembly protein	plate	A0A2H4JE52	uncultured_Caudovirales_phage	48.7	2.3e-23
AUM28593.1|3691487_3692177_-|plate	baseplate assembly protein	plate	A0A1B2LRU5	Wolbachia_phage	32.5	1.0e-14
AUM28594.1|3692249_3692699_-	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	47.4	9.1e-28
AUM28595.1|3692695_3693223_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	49.4	2.8e-36
AUM28596.1|3693219_3694050_-	hydrolase	NA	A4JWU0	Burkholderia_virus	41.4	2.0e-44
AUM28597.1|3694046_3694316_-	hypothetical protein	NA	Q9ZXL7	Pseudomonas_virus	38.5	7.7e-06
AUM28598.1|3694312_3694663_-	hypothetical protein	NA	NA	NA	NA	NA
AUM28599.1|3694671_3694881_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	61.2	4.0e-18
AUM28600.1|3694881_3695334_-|capsid	capsid protein	capsid	Q9ZXM1	Pseudomonas_virus	46.5	1.6e-24
AUM28601.1|3695435_3696200_-|terminase	terminase	terminase	K4NX86	Burkholderia_phage	41.7	1.5e-33
AUM28602.1|3696208_3697222_-|capsid	phage major capsid protein, P2 family	capsid	E5E3W8	Burkholderia_phage	52.6	8.2e-93
AUM28603.1|3697227_3698031_-|capsid	capsid protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	42.0	2.3e-50
AUM28604.1|3698189_3699974_+|terminase	terminase	terminase	Q9ZXM5	Pseudomonas_virus	57.9	1.4e-199
AUM28605.1|3699974_3700982_+|portal	phage portal protein	portal	E5E3X1	Burkholderia_phage	55.3	1.9e-102
AUM28606.1|3701879_3702959_+	hypothetical protein	NA	NA	NA	NA	NA
3701741:3701768	attR	TCCGACCCTCGGGACCATATTCAGAATC	NA	NA	NA	NA
AUM28607.1|3703405_3704677_+	two-component sensor histidine kinase	NA	B5LWN0	Feldmannia_species_virus	27.6	1.2e-11
AUM28608.1|3704744_3707495_+	bifunctional glutamine synthetase adenylyltransferase/deadenyltransferase	NA	NA	NA	NA	NA
AUM28609.1|3707519_3708446_+	branched chain amino acid aminotransferase	NA	NA	NA	NA	NA
AUM28610.1|3708514_3709405_+	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
AUM28611.1|3709427_3710456_+	glycosyltransferase	NA	NA	NA	NA	NA
AUM28612.1|3710452_3711208_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AUM28613.1|3711204_3711969_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AUM28614.1|3711980_3713015_+	glycosyl transferase	NA	NA	NA	NA	NA
AUM28615.1|3713011_3713905_-	hypothetical protein	NA	NA	NA	NA	NA
AUM28616.1|3713923_3714739_-	glycosyltransferase	NA	NA	NA	NA	NA
AUM28617.1|3716860_3717076_-	hypothetical protein	NA	NA	NA	NA	NA
AUM28618.1|3717224_3719009_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	21.5	3.1e-18
