The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019121	Vibrio vulnificus strain FORC_054 chromosome 1, complete sequence	3311092	621162	628216	3311092		Faustovirus(16.67%)	9	NA	NA
AUL94710.1|621162_622377_+	Cysteine desulfurase, IscS subfamily	NA	A0A1X7C038	Faustovirus	32.1	2.2e-31
AUL94711.1|622420_622804_+	Iron-sulfur cluster assembly scaffold protein IscU	NA	A0A218MKD1	uncultured_virus	77.4	2.0e-52
AUL94712.1|622876_623200_+	Iron binding protein IscA for iron-sulfur cluster assembly	NA	A0A2H4N7N5	Lake_Baikal_phage	52.3	1.8e-25
AUL94713.1|623260_623776_+	Chaperone protein HscB	NA	NA	NA	NA	NA
AUL94714.1|623797_625651_+	Chaperone protein HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.0	7.4e-108
AUL94715.1|625662_626001_+	Ferredoxin, 2Fe-2S	NA	NA	NA	NA	NA
AUL94716.1|626081_626276_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AUL94717.1|626428_627727_+	Peptidase B	NA	Q6GYZ8	Mycoplasma_phage	33.1	5.0e-34
AUL94718.1|627790_628216_+	Nucleoside diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	40.6	6.6e-20
>prophage 2
CP019121	Vibrio vulnificus strain FORC_054 chromosome 1, complete sequence	3311092	719574	726333	3311092		Staphylococcus_phage(50.0%)	7	NA	NA
AUL94798.1|719574_720765_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	2.2e-65
AUL94799.1|720795_722046_+	Gamma-glutamyl phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	49.0	2.3e-100
AUL94800.1|722246_722696_+	Ribonucleotide reductase transcriptional regulator NrdR	NA	NA	NA	NA	NA
AUL94801.1|722715_723822_+	Diaminohydroxyphosphoribosylaminopyrimidine deaminase	NA	A0A2I2L4R9	Orpheovirus	34.2	8.5e-43
AUL94802.1|723823_724480_+	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	35.5	8.1e-33
AUL94803.1|724577_725687_+	3,4-dihydroxy-2-butanone 4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	40.4	2.3e-64
AUL94804.1|725862_726333_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	2.2e-32
>prophage 3
CP019121	Vibrio vulnificus strain FORC_054 chromosome 1, complete sequence	3311092	2722595	2733744	3311092	tRNA	uncultured_Mediterranean_phage(25.0%)	9	NA	NA
AUL96636.1|2722595_2725178_-|tRNA	Alanyl-tRNA synthetase	tRNA	A0A1V0SK38	Klosneuvirus	38.1	1.7e-78
AUL96637.1|2725358_2725820_-	Regulatory protein RecX	NA	NA	NA	NA	NA
AUL96638.1|2725928_2726978_-	RecA protein	NA	A0A2D1GPX2	Mycobacterium_phage	60.3	1.8e-111
AUL96639.1|2727110_2727614_-	C-terminal domain of CinA type S	NA	B5TK85	Pseudomonas_phage	43.3	3.1e-24
AUL96640.1|2727697_2730259_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	22.4	1.6e-31
AUL96641.1|2730334_2731327_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.8	1.5e-35
AUL96642.1|2731407_2732304_-	Lipoprotein NlpD	NA	I3PV79	Clostridium_phage	34.1	1.5e-13
AUL96643.1|2732347_2732974_-	Protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.6	1.6e-38
AUL96644.1|2732976_2733744_-	5-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.4	1.1e-68
>prophage 1
CP019122	Vibrio vulnificus strain FORC_054 chromosome 2, complete sequence	1777082	327383	402131	1777082	head,transposase,portal,integrase,capsid,tail,tRNA,protease	Vibrio_phage(50.0%)	83	357601:357660	378732:379319
AUL97418.1|327383_327896_+|tRNA	Valyl-tRNA synthetase	tRNA	NA	NA	NA	NA
AUL97419.1|327892_329812_+	diguanylate cyclase/phosphodiesterase (GGDEF & EAL domains) with PAS/PAC sensor(s)	NA	G3MA91	Bacillus_virus	39.1	9.3e-29
AUL97420.1|329996_331196_+	hypothetical protein	NA	NA	NA	NA	NA
AUL97421.1|331444_331765_-	hypothetical protein	NA	NA	NA	NA	NA
AUL97422.1|331867_332758_-	Transcriptional regulator, LysR family	NA	NA	NA	NA	NA
AUL97423.1|332848_333772_+	Permease of the drug/metabolite transporter (DMT) superfamily	NA	NA	NA	NA	NA
AUL97424.1|333774_336654_-	Chemotactic transducer-related protein	NA	NA	NA	NA	NA
AUL97425.1|336846_337287_+	2-oxoglutarate dehydrogenase complex, dehydrogenase component	NA	NA	NA	NA	NA
AUL97426.1|337369_338119_+	putative histidinol phosphatase and related hydrolases of the PHP family	NA	NA	NA	NA	NA
AUL97427.1|338204_338606_+	Soluble cytochrome b562	NA	NA	NA	NA	NA
AUL97428.1|338778_339291_-	Superoxide dismutase (Cu-Zn) precursor	NA	Q9MC02	Salmonella_phage	53.2	5.9e-47
AUL97429.1|339290_339797_-	AnkB protein	NA	NA	NA	NA	NA
AUL97430.1|339889_341434_-	Catalase	NA	A0A2K9L0T1	Tupanvirus	47.8	5.8e-98
AUL97431.1|341490_341691_-	hypothetical protein	NA	NA	NA	NA	NA
AUL97432.1|341791_342121_+	hypothetical protein	NA	NA	NA	NA	NA
AUL97433.1|342228_343644_+	hypothetical protein	NA	NA	NA	NA	NA
AUL97434.1|343826_344210_-	Glyoxylase family protein	NA	NA	NA	NA	NA
AUL97435.1|344209_345214_-	Transcriptional regulator, LysR family	NA	NA	NA	NA	NA
AUL97436.1|345427_346669_+	Permease of the major facilitator superfamily	NA	NA	NA	NA	NA
AUL97437.1|346791_347136_-	ATPase of the AAA+ class	NA	NA	NA	NA	NA
AUL97438.1|347145_349170_-|protease	Alkaline serine protease	protease	A0A1B0T6A2	Bacillus_phage	32.5	3.1e-30
AUL97439.1|349610_350864_+	Thermolabile hemolysin precursor	NA	NA	NA	NA	NA
AUL97440.1|351137_352331_+	2-amino-3-ketobutyrate coenzyme A ligase	NA	D2TEZ5	Emiliania_huxleyi_virus	28.5	6.6e-41
AUL97441.1|352438_353470_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	100.0	1.4e-23
AUL97442.1|353657_354215_-	hypothetical protein	NA	NA	NA	NA	NA
AUL97443.1|354322_354679_-	hypothetical protein	NA	NA	NA	NA	NA
AUL97444.1|354873_355512_-|protease	Putative intracellular protease/amidase	protease	NA	NA	NA	NA
AUL97445.1|355690_356575_-	hypothetical protein	NA	NA	NA	NA	NA
AUL97446.1|356589_357600_-|integrase	integrase	integrase	A0A1P8CWQ3	Bacillus_phage	27.7	1.9e-09
357601:357660	attL	GTATTGCCTTTCATCGGTTGAGGTTAATCTTCCTCTGGCTCTTCCCCGTAAAAGGCTCTC	NA	NA	NA	NA
AUL97447.1|357623_358124_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL97448.1|358408_359278_-	hypothetical protein	NA	NA	NA	NA	NA
AUL97449.1|359445_360204_-	Queuosine Biosynthesis QueC ATPase	NA	A0A0E3GMI2	Enterobacteria_phage	27.3	5.7e-14
AUL97450.1|360389_360680_-	hypothetical protein	NA	NA	NA	NA	NA
AUL97451.1|360957_361551_-	Phage Rha protein	NA	A0A1C9IHV9	Salmonella_phage	59.8	1.7e-26
AUL97452.1|361632_361851_-	hypothetical protein	NA	NA	NA	NA	NA
AUL97453.1|361817_363041_-	Integrase	NA	R9TMP3	Vibrio_phage	82.0	7.1e-200
AUL97454.1|363019_363205_-	transcriptional regulator, putative	NA	NA	NA	NA	NA
AUL97455.1|363279_363543_-	hypothetical protein	NA	R9TNM3	Vibrio_phage	59.8	1.0e-18
AUL97456.1|363552_363765_-	hypothetical protein	NA	A0A1V0E8D5	Vibrio_phage	44.8	4.8e-11
AUL97457.1|363813_364638_-	CPS-53 (KpLE1) prophage	NA	R9TRN9	Vibrio_phage	79.0	1.8e-122
AUL97458.1|364669_365065_-	hypothetical protein	NA	R9TMP0	Vibrio_phage	88.5	2.7e-60
AUL97459.1|365204_366056_-	DNA-methyltransferase	NA	A0A0E3FXM9	Synechococcus_phage	28.9	6.8e-16
AUL97460.1|366127_367609_-	hypothetical protein	NA	Q7Y4B3	Escherichia_virus	34.2	1.7e-09
AUL97461.1|367630_368482_-	transcriptional regulator	NA	R9TNM0	Vibrio_phage	61.4	1.8e-85
AUL97462.1|368447_368684_+	XRE family transcriptional regulator	NA	A0A1V0E8C7	Vibrio_phage	44.8	2.9e-09
AUL97463.1|368703_369156_+	hypothetical protein	NA	R9TRN6	Vibrio_phage	63.7	3.3e-41
AUL97464.1|369152_369404_+	hypothetical protein	NA	R9TMN6	Vibrio_phage	77.1	9.3e-30
AUL97465.1|369564_369762_+	hypothetical protein	NA	A0A0K1LJE4	Vibrio_phage	58.3	8.3e-10
AUL97466.1|369826_370633_+	transcriptional regulator	NA	R9TPU9	Vibrio_phage	71.4	8.5e-93
AUL97467.1|370616_371357_+	Replication protein P	NA	W6MVG8	Pseudomonas_phage	37.5	1.1e-25
AUL97468.1|371346_371550_+	hypothetical protein	NA	R9TRN3	Vibrio_phage	53.7	8.3e-13
AUL97469.1|371552_371642_+	DNA-binding protein Roi	NA	NA	NA	NA	NA
AUL97470.1|371638_371827_+	hypothetical protein	NA	R9TR49	Vibrio_phage	77.0	5.0e-20
AUL97471.1|371961_372132_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	78.2	6.5e-19
AUL97472.1|372211_373225_+	hypothetical protein	NA	R9TRM9	Vibrio_phage	71.4	2.4e-140
AUL97473.1|373509_374718_-	Unknown, probable transporter	NA	NA	NA	NA	NA
AUL97474.1|374727_376008_-	n-type ATP pyrophosphatase superfamily / TilS and TtcA-like	NA	A0A0U2S5Z2	Escherichia_phage	27.3	8.2e-05
AUL97475.1|377038_377221_-	hypothetical protein	NA	NA	NA	NA	NA
AUL97476.1|377720_378731_-|integrase	integrase	integrase	A0A1P8CWQ3	Bacillus_phage	27.7	1.9e-09
AUL97477.1|378754_379255_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL97478.1|379614_380115_-	protein of unknown function DUF159	NA	NA	NA	NA	NA
378732:379319	attR	GTATTGCCTTTCATCGGTTGAGGTTAATCTTCCTCTGGCTCTTCCCCGTAAAAGGCTCTCAGCTTTTTTCGAAGAACCAATAGCGCCGCCGTTTCCGCTAACGCTTTTTCTTTAAAGCGTAACTCTTTTTTCAGCTCTTTAATTTCAAGTTTGTCAGCTTTAGCTTGTTTCTTGGCTTCAGCCTCACGCTCTTTAGCAGACATAAACCCTTGCATACACTCACTTCGCCAACCTTGCACTTGTTCAGGGAACAAGCCTTTCTCGCGACAATACTGACTGAGTTCATTCTCCGTCATCGAGTAAGTTTCAGCGACAATGGCGAGTTTAGTTTGAGCAGACCACTGCTCTGATGAAGTATGACTATTTGGCACAGCGGCTCCTGAACGTCTAAGTTGCTGCCGCCAATGATACAGGGTGGCTGTGCTAATACCTTCCTCTTTTGCTACTTGGCTTACAGACATTGAATAAGGAGGCAGTAGCTTCTTCAATATGGCTTCTTTTCTTTCTGTTGGAATGCGATTCAAAACTCACTCATTACCACCCAAACTGGTTAAATTTTAACAGTGACAACTATCCTGCCAGAGGGGG	NA	NA	NA	NA
AUL97479.1|380699_381386_+	hypothetical protein	NA	R9TRM8	Vibrio_phage	59.0	7.1e-72
AUL97480.1|381515_381704_+	hypothetical protein	NA	A0A1V0E826	Vibrio_phage	54.1	5.0e-12
AUL97481.1|381681_382170_+	lysozyme	NA	A0A1U9GSH3	Vibrio_phage	68.4	1.3e-56
AUL97482.1|382148_382652_+	Phage outer membrane lytic protein Rz	NA	A0A1V0E843	Vibrio_phage	41.4	5.4e-21
AUL97483.1|382873_383326_+	hypothetical protein	NA	NA	NA	NA	NA
AUL97484.1|383492_385193_+	DNA packaging protein	NA	A0A1I9KF19	Aeromonas_phage	40.0	7.0e-113
AUL97485.1|385192_385402_+|head,tail	putative head-tail joining protein of prophage	head,tail	NA	NA	NA	NA
AUL97486.1|385401_386961_+|portal	Phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	57.1	4.6e-159
AUL97487.1|386953_388327_+|tail	Head-tail preconnector protein GP5	tail	A0A2I6TC87	Escherichia_phage	43.8	1.5e-84
AUL97488.1|388337_388676_+	Bacterial surface proteins containing Ig-like domains	NA	NA	NA	NA	NA
AUL97489.1|388713_389754_+|capsid	Phage major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.4	1.7e-69
AUL97490.1|389820_390327_+	hypothetical protein	NA	NA	NA	NA	NA
AUL97491.1|390329_390620_+	hypothetical protein	NA	NA	NA	NA	NA
AUL97492.1|390616_391243_+|tail	minor tail protein	tail	K7PKQ5	Enterobacteria_phage	38.4	1.3e-27
AUL97493.1|391232_391673_+|tail	Phage minor tail protein	tail	S5MW30	Escherichia_phage	37.6	2.8e-13
AUL97494.1|391675_392167_+|tail	putative phage tail component	tail	A5LH35	Enterobacteria_phage	50.0	3.4e-36
AUL97495.1|392176_392635_+	hypothetical protein	NA	NA	NA	NA	NA
AUL97496.1|392700_392979_+	hypothetical protein	NA	NA	NA	NA	NA
AUL97497.1|392959_395263_+	hypothetical protein	NA	A0A1Q1PW43	Pseudoalteromonas_phage	32.4	1.1e-23
AUL97498.1|395262_395865_+	hypothetical protein	NA	NA	NA	NA	NA
AUL97499.1|395861_396413_+	hypothetical protein	NA	NA	NA	NA	NA
AUL97500.1|396416_402131_+|tail	Phage tail assembly	tail	H6WXP7	Vibrio_phage	43.4	9.5e-37
>prophage 2
CP019122	Vibrio vulnificus strain FORC_054 chromosome 2, complete sequence	1777082	807857	820614	1777082	transposase	Staphylococcus_phage(37.5%)	12	NA	NA
AUL97857.1|807857_809618_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	3.1e-63
AUL97858.1|809908_810814_+	exonuclease	NA	NA	NA	NA	NA
AUL97859.1|810760_811657_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	4.6e-39
AUL97860.1|811631_812246_-	hypothetical protein	NA	NA	NA	NA	NA
AUL97861.1|812293_812968_-	ATP-dependent DNA helicase pcrA	NA	A0A1V0SG90	Hokovirus	26.4	1.4e-08
AUL97862.1|812967_813708_-	putative exonuclease	NA	NA	NA	NA	NA
AUL97863.1|813816_814689_-	Mobile element protein	NA	Q716C2	Shigella_phage	66.3	8.0e-113
AUL97864.1|814685_814994_-	Mobile element protein	NA	Q716C1	Shigella_phage	76.3	7.1e-32
AUL97865.1|815562_816510_+	Integrase, catalytic region	NA	W5R8L2	Staphylococcus_phage	35.3	4.7e-42
AUL97866.1|818008_818215_-	hypothetical protein	NA	NA	NA	NA	NA
AUL97867.1|818268_819216_-	Integrase, catalytic region	NA	W5R8L2	Staphylococcus_phage	35.3	8.1e-42
AUL97868.1|819306_820614_-	hypothetical protein	NA	G3MAX6	Bacillus_virus	42.2	5.5e-33
