The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	1121256	1175758	5267207	head,tRNA,integrase,plate,portal,tail,capsid	Salmonella_phage(68.52%)	70	1129453:1129497	1164487:1164531
AUL83817.1|1121256_1123029_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	98.8	0.0e+00
AUL83818.1|1124319_1124919_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	96.5	3.1e-108
AUL83819.1|1125070_1126384_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.0	5.9e-75
AUL83820.1|1126385_1126655_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	4.9e-45
AUL83821.1|1126765_1127347_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	55.3	2.1e-48
AUL83822.1|1127419_1128049_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	2.1e-78
AUL83823.1|1128130_1128772_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	98.6	4.8e-107
AUL83824.1|1128932_1129181_-	damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	5.4e-38
1129453:1129497	attL	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AUL83825.1|1129613_1130645_-	hypothetical protein	NA	NA	NA	NA	NA
AUL83826.1|1130647_1131667_-|integrase	integrase	integrase	E5G6L0	Salmonella_phage	94.0	6.4e-186
AUL83827.1|1131670_1132300_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	55.5	2.1e-62
AUL83828.1|1132423_1132666_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
AUL83829.1|1132698_1133208_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	94.1	7.3e-82
AUL83830.1|1133215_1133512_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
AUL83831.1|1133629_1133971_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	97.3	6.6e-55
AUL83832.1|1134038_1134272_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
AUL83833.1|1134271_1134499_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AUL83834.1|1134495_1134798_+	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	42.1	9.8e-10
AUL83835.1|1134794_1135652_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	7.8e-161
AUL83836.1|1135648_1138063_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.8	0.0e+00
AUL83837.1|1138216_1138405_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AUL83838.1|1138343_1138649_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AUL83839.1|1138970_1140863_+	NTPase KAP	NA	NA	NA	NA	NA
AUL83840.1|1141346_1141640_+	hypothetical protein	NA	NA	NA	NA	NA
AUL83841.1|1141685_1142711_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.1	2.1e-173
AUL83842.1|1142710_1144477_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AUL83843.1|1144619_1145453_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	8.2e-123
AUL83844.1|1145469_1146528_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AUL83845.1|1146531_1147182_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	94.0	4.7e-110
AUL83846.1|1147277_1147742_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	88.3	7.9e-75
AUL83847.1|1147741_1147945_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AUL83848.1|1147948_1148164_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AUL87699.1|1148183_1148657_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AUL83849.1|1148658_1149036_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	1.1e-15
AUL83850.1|1149032_1149461_+	hypothetical protein	NA	E5G6N2	Salmonella_phage	75.2	4.2e-46
AUL83851.1|1149390_1149594_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	3.0e-23
AUL83852.1|1149556_1149988_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	1.3e-71
AUL83853.1|1149980_1150427_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.1e-62
AUL83854.1|1150495_1151074_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	8.8e-92
AUL83855.1|1151070_1151430_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
AUL83856.1|1151416_1152325_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	1.3e-142
AUL83857.1|1152317_1152923_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	1.8e-111
AUL83858.1|1152919_1154320_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.4	7.5e-153
AUL83859.1|1154346_1154787_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	4.7e-53
AUL83860.1|1154758_1155361_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.4	6.6e-98
AUL87700.1|1155360_1155864_-|tail	phage tail protein	tail	Q9MCR6	Enterobacteria_phage	54.3	1.8e-40
AUL83861.1|1155936_1156503_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	3.2e-86
AUL83862.1|1156645_1157818_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
AUL83863.1|1157827_1158343_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
AUL83864.1|1158397_1158700_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AUL83865.1|1158714_1158834_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AUL83866.1|1158826_1161988_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	59.6	1.8e-308
AUL83867.1|1161984_1162470_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	8.3e-67
AUL83868.1|1162466_1163567_+	late control protein D	NA	A0A1S6KZZ5	Salmonella_phage	88.5	3.4e-177
AUL83869.1|1163635_1163854_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
AUL83870.1|1163880_1164363_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	2.7e-17
AUL83871.1|1165063_1165546_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1164487:1164531	attR	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AUL83872.1|1165677_1166154_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
AUL83873.1|1166143_1166434_+	RnfH family protein	NA	NA	NA	NA	NA
AUL83874.1|1166495_1166837_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AUL83875.1|1166985_1168647_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AUL83876.1|1168732_1169611_-	NAD(+) kinase	NA	NA	NA	NA	NA
AUL87701.1|1169542_1169737_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
AUL83877.1|1169733_1170327_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUL87702.1|1170381_1171623_-	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
AUL87703.1|1171688_1172480_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AUL83878.1|1172646_1174008_+	signal recognition particle protein	NA	NA	NA	NA	NA
AUL83879.1|1174144_1174393_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUL83880.1|1174411_1174960_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUL83881.1|1174990_1175758_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	1387453	1578719	5267207	bacteriocin,lysis,tRNA,integrase,plate,holin,portal,terminase,transposase,tail,capsid	Escherichia_phage(38.93%)	205	1452744:1452768	1516771:1516795
AUL84070.1|1387453_1388869_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AUL84071.1|1388919_1389312_-	hypothetical protein	NA	NA	NA	NA	NA
AUL84072.1|1389313_1389658_-	hypothetical protein	NA	NA	NA	NA	NA
AUL84073.1|1390292_1392482_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AUL84074.1|1392531_1393734_-	nucleoside permease NupC	NA	NA	NA	NA	NA
AUL84075.1|1394069_1395308_+	divalent metal cation transporter	NA	NA	NA	NA	NA
AUL84076.1|1395448_1395775_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
AUL84077.1|1395889_1397146_-	ion channel protein	NA	NA	NA	NA	NA
AUL84078.1|1397349_1398315_+	glucokinase	NA	NA	NA	NA	NA
AUL84079.1|1398534_1398861_+	fructose-like phosphotransferase enzyme IIB component 1	NA	NA	NA	NA	NA
AUL84080.1|1398882_1400130_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
AUL84081.1|1400144_1401230_+	aminopeptidase	NA	NA	NA	NA	NA
AUL84082.1|1401229_1402267_+	aminopeptidase	NA	NA	NA	NA	NA
AUL84083.1|1402291_1404787_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AUL84084.1|1405659_1406394_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
AUL84085.1|1406408_1408106_-	sensor histidine kinase	NA	NA	NA	NA	NA
AUL84086.1|1408482_1409721_+	glutamate--pyruvate aminotransferase AlaC	NA	NA	NA	NA	NA
AUL84087.1|1410212_1411133_-	lipid A biosynthesis palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
AUL84088.1|1411485_1411728_+	DUF2545 domain-containing protein	NA	NA	NA	NA	NA
AUL84089.1|1411804_1412080_-	lipoprotein	NA	NA	NA	NA	NA
AUL84090.1|1412375_1413008_+	hypothetical protein	NA	NA	NA	NA	NA
AUL84091.1|1413520_1414771_+	formyl-CoA--oxalate CoA-transferase	NA	NA	NA	NA	NA
AUL84092.1|1414824_1416519_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	4.7e-24
AUL84093.1|1416588_1417533_+	transporter YfdV	NA	NA	NA	NA	NA
AUL84094.1|1417665_1418360_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL84095.1|1418431_1419526_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
AUL84096.1|1419581_1423175_-	two-component system sensor histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.3e-36
AUL84097.1|1423179_1423794_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL84098.1|1424209_1425373_+	multidrug resistance protein EmrK	NA	NA	NA	NA	NA
AUL84099.1|1425372_1426911_+	multidrug resistance protein EmrY	NA	NA	NA	NA	NA
AUL84100.1|1427018_1428347_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
AUL87708.1|1428813_1429809_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL84101.1|1429816_1431250_-	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	25.4	9.1e-29
AUL84102.1|1432137_1433351_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
AUL87709.1|1434558_1435110_+	replication protein O	NA	M1FN81	Enterobacteria_phage	99.5	9.6e-104
AUL84103.1|1435106_1435808_+	Replication protein P	NA	A0A1U9AJJ8	Stx1_converting_phage	100.0	3.4e-130
AUL84104.1|1435804_1436095_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
AUL84105.1|1436165_1436444_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
AUL84106.1|1436576_1436792_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
AUL84107.1|1436802_1437039_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
AUL84108.1|1436995_1437442_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
AUL84109.1|1437438_1437966_+	phage N-6-adenine-methyltransferase	NA	H6WZI7	Escherichia_phage	99.4	1.2e-100
AUL84110.1|1437962_1438103_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	1.0e-14
AUL84111.1|1438138_1438834_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	97.8	3.1e-131
AUL84112.1|1439194_1439929_+	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	99.6	5.5e-123
AUL84113.1|1440003_1440726_+	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.6	3.9e-129
AUL84114.1|1440725_1441331_+	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
AUL84115.1|1441327_1441522_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
AUL84116.1|1441514_1441949_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	99.3	1.8e-81
AUL84117.1|1441937_1442183_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
AUL84118.1|1442197_1442350_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
AUL84119.1|1443060_1444998_+	sialate O-acetylesterase	NA	A0A0P0ZBP4	Stx2-converting_phage	96.4	0.0e+00
AUL84120.1|1445134_1445314_+	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
AUL84121.1|1445354_1445627_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
AUL84122.1|1445703_1445919_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AUL84123.1|1446305_1447037_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	99.6	4.2e-123
AUL84124.1|1447103_1447703_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	8.2e-109
AUL84125.1|1447767_1449081_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.9	4.8e-77
AUL84126.1|1449082_1449352_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	4.9e-45
AUL84127.1|1449457_1450339_+	T3SS effector protein NleH	NA	A5LH48	Enterobacteria_phage	89.4	1.1e-144
AUL84128.1|1450569_1451268_+	T3SS effector protein NleD	NA	NA	NA	NA	NA
AUL84129.1|1451364_1452531_-|integrase	integrase	integrase	Q716F9	Shigella_phage	98.7	1.6e-220
1452744:1452768	attL	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
AUL84130.1|1452962_1454132_+|integrase	integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	99.7	3.7e-230
AUL84131.1|1454115_1454298_-	DNA-binding protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
AUL84132.1|1454376_1454754_-	hypothetical protein	NA	A0A2R2Z2X7	Escherichia_phage	98.4	1.7e-51
AUL84133.1|1454789_1455002_-	hypothetical protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
AUL84134.1|1454961_1455588_-	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
AUL84135.1|1455584_1456016_-	regulator	NA	A0A2R2Z303	Escherichia_phage	99.3	2.1e-74
AUL84136.1|1456071_1456710_-	phage antirepressor Ant	NA	A0A0P0ZG08	Escherichia_phage	99.5	5.5e-119
AUL84137.1|1457033_1457762_-	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	100.0	7.9e-130
AUL84138.1|1457857_1458454_-	DUF551 domain-containing protein	NA	Q6H9Z7	Enterobacteria_phage	99.5	6.3e-117
AUL84139.1|1458456_1458648_-	hypothetical protein	NA	Q6H9Z6	Enterobacteria_phage	100.0	1.2e-26
AUL84140.1|1458649_1459420_-	hypothetical protein	NA	Q08J58	Stx2-converting_phage	100.0	1.5e-142
AUL84141.1|1459416_1460076_-	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	61.5	3.4e-39
AUL84142.1|1460084_1460495_-	hypothetical protein	NA	A0A076G6X8	Escherichia_phage	72.1	2.0e-29
AUL84143.1|1460491_1461106_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	71.7	9.2e-55
AUL84144.1|1461102_1461267_-	DUF2737 domain-containing protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
AUL84145.1|1461277_1461574_-	RecBCD nuclease inhibitor	NA	A5VWB0	Enterobacteria_phage	98.0	9.5e-50
AUL84146.1|1461597_1462185_-	DUF669 domain-containing protein	NA	G9L666	Escherichia_phage	99.0	5.4e-105
AUL84147.1|1462181_1462862_-	ATP-binding protein	NA	G9L667	Escherichia_phage	100.0	3.4e-127
AUL84148.1|1462870_1463059_-	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
AUL84149.1|1463055_1463295_-	host cell division inhibitory peptide Kil	NA	K7PL44	Enterobacteria_phage	97.5	2.6e-37
AUL84150.1|1463493_1463964_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.8e-87
AUL84151.1|1464023_1464296_-	antitermination protein N	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
AUL84152.1|1464273_1464456_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
AUL84153.1|1464752_1464914_+	hypothetical protein	NA	A0A0P0ZCZ3	Stx2-converting_phage	100.0	2.7e-22
AUL84154.1|1465024_1465546_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
AUL84155.1|1466047_1466743_-	phage repressor	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
AUL84156.1|1466818_1467034_+	XRE family transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
AUL84157.1|1467175_1467475_+	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	99.0	3.7e-49
AUL84158.1|1467497_1467770_+	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
AUL84159.1|1467832_1468720_+	replication protein	NA	A5VW95	Enterobacteria_phage	98.0	4.9e-142
AUL84160.1|1468716_1470093_+	replicative DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	99.1	2.4e-252
AUL84161.1|1470574_1470790_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
AUL84162.1|1470800_1471037_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
AUL84163.1|1470993_1471440_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
AUL84164.1|1471436_1471964_+	phage N-6-adenine-methyltransferase	NA	H6WZI7	Escherichia_phage	99.4	1.2e-100
AUL84165.1|1471960_1472143_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
AUL84166.1|1472418_1473096_+	phage antirepressor Ant	NA	A0A0P0ZC44	Stx2-converting_phage	98.7	4.0e-128
AUL84167.1|1473170_1473893_+	DNA-binding protein	NA	A0A0P0ZBS6	Stx2-converting_phage	99.6	3.0e-129
AUL84168.1|1473892_1474183_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
AUL84169.1|1474179_1474557_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	64.9	1.1e-37
AUL84170.1|1474553_1475375_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
AUL84171.1|1475601_1475799_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	9.8e-27
AUL84172.1|1475868_1477065_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUL84173.1|1477320_1478517_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUL84174.1|1478772_1479969_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUL87710.1|1480077_1480257_-	hypothetical protein	NA	NA	NA	NA	NA
AUL84175.1|1480295_1481009_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL84176.1|1481464_1481692_+	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	98.3	7.8e-28
AUL84177.1|1481818_1483756_+	sialate O-acetylesterase	NA	A0A1I9LJQ8	Stx_converting_phage	99.8	0.0e+00
AUL84178.1|1483890_1484070_+	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AUL84179.1|1484110_1484383_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
AUL84180.1|1484459_1484675_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AUL84181.1|1484679_1485213_+	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
AUL84182.1|1485487_1486054_+	hypothetical protein	NA	A0A0H4IQ87	Shigella_phage	100.0	1.4e-105
AUL84183.1|1486210_1486678_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	100.0	1.2e-78
AUL87711.1|1486858_1487356_+	DNA-binding protein	NA	A0A0H4IPL1	Shigella_phage	100.0	2.4e-93
AUL84184.1|1487352_1487610_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
AUL84185.1|1488009_1488816_+|terminase	terminase	terminase	A0A1U9AJA9	Stx1_converting_phage	100.0	1.7e-133
AUL84186.1|1488796_1490503_+|terminase	terminase	terminase	A0A1U9AJA6	Stx1_converting_phage	100.0	0.0e+00
AUL84187.1|1490502_1492647_+|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	99.9	0.0e+00
AUL84188.1|1492804_1493812_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	99.7	1.5e-179
AUL84189.1|1493835_1495050_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
AUL84190.1|1495105_1495495_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
AUL84191.1|1495544_1496006_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
AUL84192.1|1495989_1496553_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
AUL84193.1|1496552_1497203_+	hypothetical protein	NA	A0A0H4J3F2	Shigella_phage	99.5	3.9e-120
AUL84194.1|1497199_1499137_+|tail	phage tail protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
AUL84195.1|1499138_1499408_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	6.4e-45
AUL84196.1|1499492_1499726_+	hypothetical protein	NA	A0A0N7CHY0	Escherichia_phage	100.0	1.6e-39
AUL84197.1|1499621_1499864_-	outer membrane protein	NA	NA	NA	NA	NA
AUL87712.1|1500029_1501655_+	hypothetical protein	NA	A0A088CBK0	Shigella_phage	99.8	0.0e+00
AUL84198.1|1501651_1502920_+	host specificity protein J	NA	A0A2L1IV54	Escherichia_phage	89.5	2.6e-213
AUL84199.1|1502934_1503213_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
AUL84200.1|1503218_1503836_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
AUL84201.1|1503926_1504661_+	outer membrane protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
AUL84202.1|1504591_1504837_-	hypothetical protein	NA	Q7Y2U2	Escherichia_phage	100.0	5.7e-40
AUL84203.1|1504893_1505034_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
AUL84204.1|1505090_1505492_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
AUL84205.1|1505585_1506242_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
AUL84206.1|1506244_1506691_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
AUL84207.1|1506700_1506952_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
AUL84208.1|1506962_1508228_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	98.8	9.9e-205
AUL84209.1|1508296_1516648_+	hypothetical protein	NA	Q08J70	Stx2-converting_phage	94.3	0.0e+00
AUL84210.1|1516869_1517802_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.7	2.1e-167
1516771:1516795	attR	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
AUL84211.1|1517899_1518070_+	hypothetical protein	NA	NA	NA	NA	NA
AUL84212.1|1518095_1518851_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AUL84213.1|1519032_1520091_-	hypothetical protein	NA	NA	NA	NA	NA
AUL84214.1|1520456_1521797_-	long-chain fatty acid transporter	NA	NA	NA	NA	NA
AUL84215.1|1521832_1522084_+	hypothetical protein	NA	NA	NA	NA	NA
AUL84216.1|1522168_1522453_+	hypothetical protein	NA	NA	NA	NA	NA
AUL84217.1|1522633_1523944_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AUL84218.1|1523943_1526088_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AUL84219.1|1526290_1526776_+	phosphohistidine phosphatase	NA	NA	NA	NA	NA
AUL84220.1|1527450_1528014_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AUL84221.1|1530995_1531520_+	fimbrial protein	NA	NA	NA	NA	NA
AUL84222.1|1531521_1532379_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
AUL84223.1|1532500_1533052_-	endonuclease SmrB	NA	NA	NA	NA	NA
AUL84224.1|1533217_1534150_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUL84225.1|1534184_1535270_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
AUL84226.1|1535273_1536098_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AUL84227.1|1536097_1536907_+	hypothetical protein	NA	NA	NA	NA	NA
AUL84228.1|1536906_1537455_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AUL84229.1|1537488_1537767_+	hypothetical protein	NA	NA	NA	NA	NA
AUL84230.1|1537887_1539894_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AUL84231.1|1540052_1541273_+	beta-ketoacyl-[acyl-carrier-protein] synthase I	NA	NA	NA	NA	NA
AUL87713.1|1541418_1541640_-	hypothetical protein	NA	NA	NA	NA	NA
AUL84232.1|1541581_1542760_+	arabinose transporter	NA	NA	NA	NA	NA
AUL84233.1|1542756_1543752_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AUL84234.1|1544020_1544914_-	type VI secretion protein	NA	NA	NA	NA	NA
AUL84235.1|1544918_1545251_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AUL84236.1|1545513_1545654_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
AUL84237.1|1545845_1546106_-	hypothetical protein	NA	NA	NA	NA	NA
AUL84238.1|1548108_1549322_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
AUL84239.1|1549470_1549794_-|tail	phage tail protein	tail	A0A0A7NQ97	Enterobacteria_phage	100.0	1.1e-43
AUL84240.1|1549951_1551136_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
AUL84241.1|1551135_1551648_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
AUL84242.1|1551702_1552068_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
AUL84243.1|1551995_1552232_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	1.9e-21
AUL84244.1|1552218_1555026_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.8	0.0e+00
AUL84245.1|1555032_1555527_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.1e-85
AUL87714.1|1555779_1556256_+	serine acetyltransferase	NA	NA	NA	NA	NA
AUL84246.1|1556299_1556878_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.9e-95
AUL84247.1|1556877_1559340_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	97.2	8.1e-110
AUL84248.1|1559342_1559873_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	5.1e-94
AUL84249.1|1559865_1560762_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.1e-154
AUL84250.1|1560765_1561116_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	2.7e-59
AUL84251.1|1561189_1562402_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
AUL84252.1|1563495_1564653_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.3	1.7e-22
AUL84253.1|1564718_1565732_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL84254.1|1565731_1566544_+|tRNA	tRNA pseudouridine(38-40) synthase	tRNA	NA	NA	NA	NA
AUL84255.1|1566626_1567286_+	protein DedA	NA	NA	NA	NA	NA
AUL84256.1|1567441_1568356_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
AUL84257.1|1568425_1569694_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AUL84258.1|1569683_1570346_+	cell division protein DedD	NA	NA	NA	NA	NA
AUL84259.1|1570604_1571093_+	colicin V production protein	NA	NA	NA	NA	NA
AUL84260.1|1571129_1572647_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
AUL84261.1|1572741_1573311_+	3-octaprenyl-4-hydroxybenzoate carboxy-lyase	NA	NA	NA	NA	NA
AUL84262.1|1573576_1574359_+	lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT	NA	NA	NA	NA	NA
AUL84263.1|1574579_1575362_+	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
AUL84264.1|1575451_1576138_+	histidine ABC transporter permease	NA	NA	NA	NA	NA
AUL84265.1|1576134_1576851_+	histidine ABC transporter permease	NA	NA	NA	NA	NA
AUL84266.1|1576858_1577632_+	histidine transport ATP-binding protein HisP	NA	G9BWD6	Planktothrix_phage	38.1	2.4e-23
AUL84267.1|1577828_1578719_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	43.9	1.2e-66
>prophage 3
CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	1755388	1867507	5267207	lysis,tRNA,integrase,holin,terminase,tail,transposase,capsid	Enterobacteria_phage(38.81%)	107	1753099:1753115	1834477:1834493
1753099:1753115	attL	GAATTATTTAGAGTATA	NA	NA	NA	NA
AUL84411.1|1755388_1756084_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
AUL84412.1|1756080_1756479_-	hypothetical protein	NA	NA	NA	NA	NA
AUL87721.1|1756718_1757669_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
AUL84413.1|1758056_1758140_-	hypothetical protein	NA	NA	NA	NA	NA
AUL84414.1|1758363_1759800_+	multidrug transporter permease	NA	NA	NA	NA	NA
AUL84415.1|1759852_1760614_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AUL84416.1|1760743_1761322_-	DedA family protein	NA	NA	NA	NA	NA
AUL84417.1|1761491_1762079_+	YIP1 family protein	NA	NA	NA	NA	NA
AUL84418.1|1762252_1763185_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
AUL84419.1|1763222_1764938_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
AUL84420.1|1765133_1767431_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
AUL84421.1|1767682_1768600_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL84422.1|1768606_1769764_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AUL84423.1|1769756_1770683_+	ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	3.3e-24
AUL84424.1|1770687_1771419_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AUL84425.1|1771399_1771507_-	hypothetical protein	NA	NA	NA	NA	NA
AUL84426.1|1771566_1772268_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.9e-102
AUL84427.1|1772288_1773575_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
AUL84428.1|1773608_1773863_-	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
AUL84429.1|1773881_1774016_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
AUL84430.1|1774019_1774262_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
AUL87722.1|1774349_1774610_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	82.3	1.5e-43
AUL84431.1|1775100_1775871_-	hypothetical protein	NA	Q6H9Z5	Enterobacteria_phage	98.8	6.2e-141
AUL84432.1|1775867_1776089_-	conjugal transfer protein TraR	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
AUL84433.1|1776187_1776469_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
AUL84434.1|1776479_1776671_-	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
AUL87723.1|1776643_1776826_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
AUL84435.1|1776822_1777503_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
AUL84436.1|1777499_1778285_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AUL84437.1|1778290_1778587_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
AUL84438.1|1778766_1779980_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
AUL84439.1|1780091_1780475_-	antitermination protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
AUL84440.1|1781130_1782177_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	99.4	1.3e-205
AUL84441.1|1782170_1782632_-	hypothetical protein	NA	G9L674	Escherichia_phage	99.3	1.9e-76
AUL84442.1|1782698_1783040_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	98.2	2.8e-61
AUL84443.1|1783100_1783808_-	phage repressor protein C	NA	G9L676	Escherichia_phage	100.0	1.5e-133
AUL84444.1|1783886_1784114_+	DNA-binding protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
AUL84445.1|1784252_1784549_+	hypothetical protein	NA	Q6H9X8	Enterobacteria_phage	100.0	5.2e-48
AUL84446.1|1784581_1785520_+	Replication protein O	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
AUL84447.1|1785516_1786218_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	8.4e-129
AUL84448.1|1786214_1786505_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
AUL84449.1|1786560_1787019_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.6e-80
AUL84450.1|1787015_1787543_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	98.9	2.3e-99
AUL84451.1|1787724_1788774_+	hypothetical protein	NA	Q9T208	Enterobacteria_phage	100.0	1.3e-181
AUL84452.1|1788925_1789648_+	DNA-binding protein	NA	O48426	Enterobacteria_phage	96.7	3.6e-127
AUL84453.1|1789647_1790253_+	protein NinG	NA	Q5TJL9	Enterobacteria_phage	99.0	8.1e-96
AUL84454.1|1790249_1790921_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.9	1.6e-129
AUL84455.1|1790911_1791400_+	antiterminator	NA	Q5TJL7	Enterobacteria_phage	99.4	7.7e-89
AUL84456.1|1792477_1794328_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
AUL84457.1|1794451_1794613_-	hypothetical protein	NA	NA	NA	NA	NA
AUL84458.1|1794611_1794827_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AUL84459.1|1794826_1795324_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
AUL84460.1|1795320_1795758_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
AUL84461.1|1795960_1796458_+	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
AUL84462.1|1796454_1796712_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
AUL84463.1|1796788_1796923_-	hypothetical protein	NA	NA	NA	NA	NA
AUL84464.1|1797174_1797402_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
AUL84465.1|1797443_1797809_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	4.0e-66
AUL84466.1|1797777_1797915_+	DNase	NA	H6WZK7	Escherichia_phage	75.0	6.6e-06
AUL84467.1|1798098_1798662_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
AUL84468.1|1798658_1800320_+|terminase	terminase	terminase	A0A0P0ZEI4	Stx2-converting_phage	98.6	0.0e+00
AUL84469.1|1800383_1802321_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
AUL87724.1|1802365_1802587_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
AUL84470.1|1805790_1806237_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AUL84471.1|1806233_1806578_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AUL84472.1|1807772_1808054_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
AUL84473.1|1811333_1811675_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	96.5	6.9e-60
AUL84474.1|1811674_1812373_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.7	3.1e-131
AUL84475.1|1813025_1813706_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	96.4	4.1e-112
AUL84476.1|1813941_1817418_+|tail	phage tail protein	tail	A0A0P0ZCI5	Stx2-converting_phage	97.3	0.0e+00
AUL84477.1|1817484_1818084_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	100.0	1.0e-111
AUL84478.1|1818148_1819462_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.9	4.8e-77
AUL84479.1|1819463_1819733_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	4.9e-45
AUL84480.1|1819843_1820425_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.0	4.3e-54
AUL84481.1|1820756_1822001_-	hypothetical protein	NA	H6WZN2	Escherichia_phage	91.1	2.0e-229
AUL87725.1|1822653_1823682_-	secretion protein EspV	NA	Q6H9S1	Enterobacteria_phage	99.4	2.0e-195
AUL84482.1|1823850_1824544_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL84483.1|1824742_1826428_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.3	8.1e-303
AUL84484.1|1826424_1827144_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL84485.1|1827190_1827661_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.6e-81
AUL84486.1|1827700_1828162_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	99.3	2.4e-76
AUL84487.1|1828286_1829684_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	67.0	2.9e-237
AUL84488.1|1829680_1830817_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.2e-162
AUL84489.1|1830809_1833089_-	hypothetical protein	NA	NA	NA	NA	NA
AUL84490.1|1833099_1834188_-	MoxR family ATPase	NA	NA	NA	NA	NA
AUL84491.1|1834493_1834811_-	hypothetical protein	NA	NA	NA	NA	NA
1834477:1834493	attR	GAATTATTTAGAGTATA	NA	NA	NA	NA
AUL84492.1|1842447_1844481_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
AUL84493.1|1844612_1845722_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
AUL84494.1|1845984_1846266_+	DUF2574 domain-containing protein	NA	NA	NA	NA	NA
AUL84495.1|1846557_1847100_+	hypothetical protein	NA	NA	NA	NA	NA
AUL84496.1|1847180_1847855_+	fimbrial assembly protein	NA	NA	NA	NA	NA
AUL84497.1|1849265_1849960_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL84498.1|1851138_1852173_+	adhesin	NA	NA	NA	NA	NA
AUL84499.1|1852254_1852593_-	heavy metal resistance protein	NA	NA	NA	NA	NA
AUL84500.1|1852814_1853660_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AUL84501.1|1853780_1854053_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL84502.1|1854275_1855064_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AUL84503.1|1855060_1855861_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AUL84504.1|1855925_1856744_+	hypothetical protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
AUL84505.1|1856795_1857542_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL84506.1|1858477_1859482_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	2.2e-13
AUL84507.1|1861011_1862064_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AUL84508.1|1862371_1863226_+	tagatose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AUL84509.1|1864531_1864984_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
AUL84510.1|1865014_1865299_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
AUL84511.1|1865302_1866658_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
AUL84512.1|1866813_1867507_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	1889773	1900606	5267207	tail,integrase,terminase,lysis	Enterobacteria_phage(45.45%)	17	1895122:1895136	1900439:1900453
AUL84533.1|1889773_1890463_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
AUL84534.1|1890673_1891390_+	hypothetical protein	NA	NA	NA	NA	NA
AUL84535.1|1891933_1892161_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	90.4	4.2e-21
AUL84536.1|1892627_1892891_-	hypothetical protein	NA	NA	NA	NA	NA
AUL84537.1|1893016_1893550_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	95.5	2.4e-99
AUL84538.1|1893672_1893888_+	hypothetical protein	NA	NA	NA	NA	NA
AUL84539.1|1894039_1894507_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	87.7	2.1e-67
AUL84540.1|1894589_1894730_+	hypothetical protein	NA	NA	NA	NA	NA
AUL84541.1|1894970_1895285_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
1895122:1895136	attL	GCCGGACTCCGGTTT	NA	NA	NA	NA
AUL84542.1|1895366_1895591_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
AUL84543.1|1895985_1896483_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.5	1.0e-11
AUL84544.1|1897642_1897909_+	hypothetical protein	NA	Q9ZXG3	Shigella_phage	95.5	1.6e-43
AUL84545.1|1897931_1898303_+|integrase	integrase	integrase	K7PH54	Enterobacteria_phage	95.1	1.1e-58
AUL84546.1|1898426_1899215_-	cell division protein	NA	A5LH49	Enterobacteria_phage	98.1	1.6e-144
AUL87726.1|1899321_1899507_+	hypothetical protein	NA	NA	NA	NA	NA
AUL84547.1|1899481_1900363_-	T3SS effector protein NleH	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
AUL84548.1|1900468_1900606_-|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	95.6	3.7e-17
1900439:1900453	attR	GCCGGACTCCGGTTT	NA	NA	NA	NA
>prophage 5
CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	1978074	2067654	5267207	head,lysis,plate,holin,protease,transposase,tail	Escherichia_phage(38.81%)	109	NA	NA
AUL84612.1|1978074_1979226_-|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AUL84613.1|1979716_1980775_+	FUSC family protein	NA	NA	NA	NA	NA
AUL84614.1|1980946_1981276_+	hypothetical protein	NA	NA	NA	NA	NA
AUL84615.1|1981376_1981511_-	ethanolamine utilization protein	NA	NA	NA	NA	NA
AUL84616.1|1981968_1983181_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
AUL84617.1|1984887_1985010_+	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
AUL84618.1|1985161_1985707_+	adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase	NA	NA	NA	NA	NA
AUL84619.1|1985703_1986447_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
AUL84620.1|1986458_1987538_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
AUL84621.1|1987602_1988535_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AUL84622.1|1988991_1989909_+	nitrogen assimilation regulatory protein nac	NA	NA	NA	NA	NA
AUL84623.1|1990010_1990961_+	transcriptional regulator Cbl	NA	NA	NA	NA	NA
AUL84624.1|1991234_1992722_+	MATE family multidrug exporter	NA	NA	NA	NA	NA
AUL84625.1|1993096_1993306_+	hypothetical protein	NA	NA	NA	NA	NA
AUL84626.1|1993350_1994067_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUL84627.1|1994409_1995864_-	AMP nucleosidase	NA	NA	NA	NA	NA
AUL84628.1|1995965_1997282_-	MFS transporter	NA	NA	NA	NA	NA
AUL84629.1|1997596_1998649_+	hypothetical protein	NA	NA	NA	NA	NA
AUL84630.1|2002206_2003420_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	3.5e-167
AUL87731.1|2007788_2008586_-	protein MtfA	NA	NA	NA	NA	NA
AUL84631.1|2009525_2009951_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUL84632.1|2010022_2011093_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	8.5e-64
AUL84633.1|2011099_2011846_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	82.8	1.8e-113
AUL84634.1|2011867_2012584_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
AUL87732.1|2012616_2012898_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
AUL84635.1|2012894_2013122_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
AUL84636.1|2013114_2013426_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
AUL84637.1|2013772_2014330_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
AUL84638.1|2014563_2014776_+	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
AUL84639.1|2014895_2015240_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
AUL84640.1|2015361_2015634_+	hypothetical protein	NA	NA	NA	NA	NA
AUL84641.1|2015635_2016685_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
AUL84642.1|2016697_2017057_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
AUL84643.1|2017065_2017620_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	66.9	6.8e-65
AUL84644.1|2017844_2018042_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	95.4	7.5e-27
AUL84645.1|2018176_2018890_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL84646.1|2019643_2020381_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
AUL84647.1|2020334_2020535_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUL87733.1|2020802_2021114_+	hypothetical protein	NA	NA	NA	NA	NA
AUL84648.1|2021152_2021398_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
AUL84649.1|2021433_2021616_-	DUF1378 domain-containing protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
AUL84650.1|2021762_2023802_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
AUL84651.1|2023901_2024462_-	DNA-invertase	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
AUL84652.1|2024475_2024661_-	hypothetical protein	NA	NA	NA	NA	NA
AUL87735.1|2024683_2024887_+|tail	phage tail protein	tail	NA	NA	NA	NA
AUL87734.1|2024966_2025488_+|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
AUL84653.1|2025522_2026434_-|tail	phage tail protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
AUL84654.1|2026433_2026994_-	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
AUL84655.1|2026984_2028070_-	hypothetical protein	NA	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
AUL84656.1|2028066_2028504_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
AUL84657.1|2028496_2029111_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
AUL84658.1|2029100_2030225_-|tail	phage tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
AUL84659.1|2030208_2031579_-	multidrug DMT transporter permease	NA	C9DGQ2	Escherichia_phage	33.1	1.0e-53
AUL84660.1|2031544_2033620_-|tail	tail tape measure protein	tail	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
AUL84661.1|2033622_2033805_-	hypothetical protein	NA	C9DGQ0	Escherichia_phage	54.8	3.2e-08
AUL84662.1|2033746_2034223_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
AUL84663.1|2034237_2034603_-|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
AUL84664.1|2034611_2036114_-|tail	phage tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
AUL84665.1|2036110_2036356_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
AUL84666.1|2036356_2036917_-	DUF1834 domain-containing protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
AUL84667.1|2036913_2037333_-	DUF1320 domain-containing protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
AUL84668.1|2037329_2037734_-	hypothetical protein	NA	NA	NA	NA	NA
AUL84669.1|2037777_2038725_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
AUL84670.1|2038724_2039849_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
AUL84671.1|2040025_2040499_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	1.7e-37
AUL84672.1|2040620_2041952_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
AUL87736.1|2041935_2043525_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
AUL84673.1|2043524_2045189_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
AUL84674.1|2045188_2045770_-	DUF3486 domain-containing protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
AUL84675.1|2045772_2046063_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
AUL84676.1|2046059_2046368_-	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
AUL84677.1|2046348_2046576_-	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AUL87737.1|2046585_2047032_-	lysozyme	NA	B6SD19	Bacteriophage	48.0	1.2e-11
AUL84678.1|2047250_2047751_-	endolysin	NA	B6SD29	Bacteriophage	42.6	3.0e-27
AUL84679.1|2047822_2048248_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL84680.1|2048317_2048827_-	DUF1018 domain-containing protein	NA	A0A0C4UQU3	Shigella_phage	41.9	1.1e-26
AUL84681.1|2048823_2049120_-	hypothetical protein	NA	NA	NA	NA	NA
AUL84682.1|2049109_2049307_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
AUL87738.1|2049299_2049632_-	hypothetical protein	NA	NA	NA	NA	NA
AUL84683.1|2049647_2050016_-	hypothetical protein	NA	NA	NA	NA	NA
AUL84684.1|2050012_2050324_-	hypothetical protein	NA	NA	NA	NA	NA
AUL84685.1|2050320_2050872_-	AsnC family protein	NA	NA	NA	NA	NA
AUL84686.1|2050875_2051391_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
AUL84687.1|2051390_2051924_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.7	5.9e-66
AUL84688.1|2051927_2052470_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	39.4	4.9e-28
AUL84689.1|2052567_2053098_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
AUL84690.1|2053109_2053403_-	hypothetical protein	NA	NA	NA	NA	NA
AUL84691.1|2053407_2053680_-	hypothetical protein	NA	NA	NA	NA	NA
AUL84692.1|2053676_2053958_-	host nuclease inhibitor protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
AUL84693.1|2053959_2054214_-	hypothetical protein	NA	NA	NA	NA	NA
AUL84694.1|2054226_2054448_-	hypothetical protein	NA	NA	NA	NA	NA
AUL84695.1|2054450_2055383_-	transcriptional regulator	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
AUL84696.1|2055454_2057545_-|transposase	transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	4.0e-166
AUL84697.1|2057546_2057795_-	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
AUL84698.1|2057962_2058547_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	4.2e-17
AUL84699.1|2058823_2059078_+	hypothetical protein	NA	H6WZJ6	Escherichia_phage	98.8	1.0e-36
AUL84700.1|2058968_2059235_+	hypothetical protein	NA	NA	NA	NA	NA
AUL84701.1|2059555_2061493_+	sialate O-acetylesterase	NA	A0A0P0ZBP4	Stx2-converting_phage	96.7	0.0e+00
AUL84702.1|2061628_2061808_+	DUF1378 domain-containing protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
AUL84703.1|2061848_2062094_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
AUL84704.1|2062171_2062387_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
AUL84705.1|2062391_2062925_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	97.7	1.3e-100
AUL84706.1|2063199_2063769_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
AUL84707.1|2063925_2064393_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	87.7	2.1e-67
AUL84708.1|2064475_2064616_+	hypothetical protein	NA	NA	NA	NA	NA
AUL84709.1|2064856_2065171_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AUL84710.1|2065237_2066450_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
AUL84711.1|2066858_2067101_-	hypothetical protein	NA	NA	NA	NA	NA
AUL84712.1|2067123_2067654_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	1.6e-55
>prophage 6
CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	2457414	2542109	5267207	lysis,integrase,holin,portal,terminase,protease,transposase,tail,capsid	Enterobacteria_phage(35.94%)	101	2463439:2463454	2523332:2523347
AUL85088.1|2457414_2458109_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL85089.1|2458194_2458569_+	type III effector	NA	A5LH48	Enterobacteria_phage	83.1	2.1e-54
AUL85090.1|2458634_2459204_+	effector protein NleF	NA	NA	NA	NA	NA
AUL85091.1|2460370_2460649_-	secretion protein EspO	NA	NA	NA	NA	NA
AUL85092.1|2461037_2461223_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85093.1|2461359_2462007_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
AUL85094.1|2462190_2462781_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
2463439:2463454	attL	GAGAATATTTTTCATT	NA	NA	NA	NA
AUL87757.1|2464514_2464943_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
AUL87758.1|2465548_2465767_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85095.1|2466253_2467384_-|integrase	integrase	integrase	O21940	Phage_21	51.1	1.7e-102
AUL85096.1|2467361_2467610_-	excisionase	NA	NA	NA	NA	NA
AUL85097.1|2467674_2470119_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.3	8.4e-176
AUL85098.1|2470211_2470400_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUL85099.1|2470396_2470585_-	cell division inhibitor	NA	NA	NA	NA	NA
AUL87760.1|2470493_2470685_+	hypothetical protein	NA	NA	NA	NA	NA
AUL87759.1|2470838_2471147_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85100.1|2471150_2471369_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85101.1|2471398_2471569_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85102.1|2471528_2471684_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
AUL85103.1|2471873_2472281_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
AUL85104.1|2472358_2472586_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL85105.1|2472569_2473121_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85106.1|2473921_2474587_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	3.5e-84
AUL85107.1|2474621_2475380_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	68.4	1.2e-80
AUL85108.1|2475439_2475625_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85109.1|2475972_2476521_+	hypothetical protein	NA	A0A2R2Z302	Escherichia_phage	75.4	1.4e-41
AUL85110.1|2476517_2476691_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	80.6	3.1e-08
AUL85111.1|2476735_2476948_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
AUL85112.1|2477050_2477368_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL85113.1|2477360_2477732_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUL85114.1|2477955_2478183_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85115.1|2478236_2478506_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	2.7e-11
AUL85116.1|2478507_2479557_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
AUL85117.1|2479569_2479944_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
AUL85118.1|2479940_2480762_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
AUL85119.1|2480988_2481186_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
AUL85120.1|2481337_2482396_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
AUL85121.1|2482990_2484937_+	sialate O-acetylesterase	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.3	0.0e+00
AUL85122.1|2485071_2485251_+	DUF1378 domain-containing protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
AUL85123.1|2485291_2485564_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
AUL85124.1|2485640_2485856_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
AUL85125.1|2485859_2486651_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
AUL85126.1|2487162_2487696_+	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
AUL85127.1|2487994_2488462_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	100.0	7.7e-78
AUL85128.1|2488874_2489351_+	DUF1441 domain-containing protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
AUL85129.1|2489347_2491471_+|terminase	terminase	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
AUL85130.1|2491443_2491680_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	100.0	4.5e-34
AUL85131.1|2491679_2493182_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	99.8	3.1e-290
AUL87761.1|2493195_2495151_+	peptidase S14	NA	S5M7Q8	Escherichia_phage	99.8	0.0e+00
AUL85132.1|2495238_2495565_+	DUF2190 domain-containing protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
AUL85133.1|2495557_2495839_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
AUL85134.1|2495841_2496465_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	99.5	2.5e-100
AUL85135.1|2496477_2496876_+|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
AUL85136.1|2496883_2497636_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
AUL85137.1|2497649_2498072_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	3.3e-72
AUL85138.1|2498098_2498407_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
AUL85139.1|2501091_2501421_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AUL85140.1|2501420_2502119_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
AUL85141.1|2502129_2502873_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	1.5e-147
AUL85142.1|2502770_2503451_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.2	9.7e-114
AUL85143.1|2503686_2507163_+|tail	phage tail protein	tail	Q687E8	Enterobacteria_phage	96.3	0.0e+00
AUL85144.1|2507229_2507829_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	5.9e-107
AUL85145.1|2507893_2509207_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	3.6e-80
AUL85146.1|2509208_2509478_+|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	98.9	1.9e-44
AUL85147.1|2509590_2510166_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	1.8e-89
AUL85148.1|2510238_2510868_+	T3SS effector protein NleG8	NA	B6DZB9	Enterobacteria_phage	92.8	4.6e-78
AUL85149.1|2510949_2511591_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
AUL85150.1|2511621_2511756_+|capsid	capsid protein	capsid	NA	NA	NA	NA
AUL85151.1|2511752_2512001_-	DNA damage-inducible protein DinI	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
AUL85152.1|2512824_2512929_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85153.1|2513118_2513331_+	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	6.8e-26
AUL85154.1|2513498_2513777_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	4.8e-11
AUL85155.1|2513778_2514828_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.9e-108
AUL85156.1|2514840_2515200_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.1	6.8e-34
AUL85157.1|2515196_2515886_+	antiterminator	NA	I6PDF8	Cronobacter_phage	47.6	2.7e-55
AUL87762.1|2516098_2516296_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
AUL85158.1|2518270_2518537_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85159.1|2518951_2520802_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
AUL85160.1|2521240_2521456_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AUL85161.1|2521944_2522412_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	80.1	1.8e-58
AUL85162.1|2522494_2522635_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85163.1|2522876_2523191_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AUL85164.1|2523272_2523497_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
2523332:2523347	attR	GAGAATATTTTTCATT	NA	NA	NA	NA
AUL85165.1|2523538_2523904_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
AUL85166.1|2524192_2524663_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.1	1.3e-77
AUL85167.1|2525835_2527284_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.4	8.4e-06
AUL85168.1|2527296_2527476_+	chemotaxis protein	NA	NA	NA	NA	NA
AUL87763.1|2527513_2528437_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL85169.1|2528653_2529997_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
AUL85170.1|2530221_2531877_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
AUL85171.1|2531797_2532001_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85172.1|2532016_2532241_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85173.1|2532303_2532840_+	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
AUL85174.1|2532834_2533815_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85175.1|2533938_2534931_+	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
AUL85176.1|2534927_2535521_+	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
AUL85177.1|2535823_2536492_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85178.1|2537023_2538232_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.5	3.2e-208
AUL85179.1|2538271_2539486_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
AUL85180.1|2539538_2540075_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUL85181.1|2540147_2542109_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.9	9.2e-24
>prophage 7
CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	2646292	2703388	5267207	head,lysis,transposase,tail,capsid	Stx2-converting_phage(46.88%)	53	NA	NA
AUL85268.1|2646292_2647429_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AUL85269.1|2648197_2649394_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUL85270.1|2649388_2649631_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85271.1|2653443_2655102_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	8.3e-26
AUL85272.1|2655681_2656376_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL85273.1|2656600_2656813_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85274.1|2656888_2657506_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AUL85275.1|2657772_2659272_+	L-asparagine permease	NA	NA	NA	NA	NA
AUL85276.1|2659386_2660448_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85277.1|2660530_2660656_+	tonB-dependent receptor yncD	NA	NA	NA	NA	NA
AUL87767.1|2660595_2660775_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85278.1|2660689_2662792_+	TonB-dependent siderophore receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
AUL85279.1|2662827_2663493_-	colanic acid/biofilm transcriptional regulator	NA	NA	NA	NA	NA
AUL85280.1|2664032_2664727_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL85281.1|2664792_2665263_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85282.1|2665306_2667352_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
AUL87768.1|2667258_2667477_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85283.1|2667488_2668235_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL85284.1|2668323_2669010_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL85285.1|2669187_2669391_+	selenoprotein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
AUL87769.1|2671660_2672032_+	DUF1076 domain-containing protein	NA	A0A0P0ZBX1	Stx2-converting_phage	99.2	1.7e-67
AUL85286.1|2672256_2673132_-	secretion protein EspS	NA	A0A0P0ZCT1	Stx2-converting_phage	99.3	2.1e-161
AUL85287.1|2673272_2673542_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	98.9	1.1e-44
AUL85288.1|2673543_2674857_-|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.9	4.8e-77
AUL85289.1|2674921_2675521_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	4.2e-105
AUL85290.1|2675587_2678980_-|tail	phage tail protein	tail	A0A0P0ZDT4	Stx2-converting_phage	88.0	0.0e+00
AUL85291.1|2679113_2679641_+	superoxide dismutase	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
AUL85292.1|2679671_2679875_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85293.1|2679828_2680509_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	91.2	2.3e-107
AUL85294.1|2680406_2681150_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	6.8e-145
AUL85295.1|2681160_2681859_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	96.6	8.4e-129
AUL85296.1|2681858_2682200_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
AUL85297.1|2685482_2685764_-|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
AUL85298.1|2685787_2686162_-|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
AUL85299.1|2686167_2686884_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	2.8e-127
AUL85300.1|2686942_2687287_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AUL85301.1|2687283_2687730_-	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AUL85302.1|2687726_2688077_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AUL85303.1|2688086_2688413_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
AUL85304.1|2690939_2691161_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
AUL85305.1|2691205_2693143_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.8	0.0e+00
AUL85306.1|2694163_2694529_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
AUL85307.1|2694570_2694798_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
AUL85308.1|2695166_2695391_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85309.1|2695387_2695882_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	93.8	4.0e-77
AUL85310.1|2695883_2696102_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	93.3	1.0e-16
AUL85311.1|2696179_2696713_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
AUL85312.1|2696763_2697108_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
AUL85313.1|2697765_2699616_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
AUL85314.1|2699664_2699793_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85315.1|2699937_2700204_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85316.1|2701729_2701942_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
AUL85317.1|2702019_2703388_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
>prophage 8
CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	2751060	2802406	5267207	lysis,tRNA,integrase,holin,portal,terminase,tail	Escherichia_phage(42.11%)	65	2751695:2751720	2797044:2797069
AUL85352.1|2751060_2751495_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	4.0e-28
2751695:2751720	attL	AAGAAAGAACAATACAACCTGAACAA	NA	NA	NA	NA
AUL85353.1|2752075_2752717_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
AUL85354.1|2752798_2753428_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
AUL85355.1|2753500_2754076_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
AUL85356.1|2754188_2754458_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
AUL85357.1|2754459_2755782_-|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	98.6	2.0e-75
AUL85358.1|2755846_2756446_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
AUL85359.1|2756513_2759987_-|tail	phage tail protein	tail	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
AUL85360.1|2760227_2760905_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.9	2.6e-111
AUL85361.1|2760802_2761546_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.8e-146
AUL85362.1|2761551_2762250_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	97.4	5.8e-130
AUL85363.1|2762249_2762579_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AUL85364.1|2762575_2765221_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.7	0.0e+00
AUL85365.1|2765264_2765573_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
AUL85366.1|2765599_2766022_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	3.3e-72
AUL85367.1|2766035_2766788_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
AUL85368.1|2766795_2767194_-|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
AUL85369.1|2767206_2767830_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	98.6	2.9e-104
AUL85370.1|2767832_2768114_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
AUL85371.1|2768106_2768433_-	DUF2190 domain-containing protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
AUL87771.1|2768520_2770476_-	peptidase S14	NA	S5M7Q8	Escherichia_phage	99.7	0.0e+00
AUL85372.1|2770489_2771992_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
AUL85373.1|2771991_2772228_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	100.0	4.5e-34
AUL85374.1|2772200_2774324_-|terminase	terminase	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
AUL85375.1|2774320_2774797_-	DUF1441 domain-containing protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
AUL85376.1|2774853_2775102_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85377.1|2775251_2775719_-|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	100.0	1.2e-78
AUL85378.1|2775872_2776442_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
AUL85379.1|2776712_2777246_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
AUL85380.1|2777250_2777466_-|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
AUL85381.1|2777543_2777789_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
AUL85382.1|2777829_2778009_-	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AUL85383.1|2778145_2780092_-	sialate O-acetylesterase	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.6	0.0e+00
AUL85384.1|2780793_2781336_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	72.3	3.9e-73
AUL85385.1|2781332_2781623_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	8.2e-46
AUL85386.1|2781622_2782222_-	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	92.5	1.0e-106
AUL85387.1|2782293_2782545_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85388.1|2782618_2782807_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85389.1|2782781_2782994_-	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.2e-17
AUL85390.1|2783116_2784238_-	DNA-binding protein	NA	NA	NA	NA	NA
AUL85391.1|2784224_2784875_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85392.1|2785029_2785260_-	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	76.8	4.1e-16
AUL85393.1|2785256_2785679_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.8e-63
AUL85394.1|2785694_2786507_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	8.5e-117
AUL85395.1|2786478_2787225_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	80.9	4.8e-114
AUL85396.1|2787231_2788020_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.0	5.1e-42
AUL85397.1|2788097_2788520_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	5.9e-69
AUL85398.1|2788516_2788759_-	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
AUL85399.1|2788855_2789275_+	transcriptional regulator	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
AUL85400.1|2789581_2789734_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
AUL85401.1|2789739_2789940_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85402.1|2790145_2790994_+	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	60.8	5.9e-60
AUL85403.1|2791040_2791262_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
AUL87772.1|2791261_2791432_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
AUL85404.1|2791512_2794182_+	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	61.3	4.2e-205
AUL85405.1|2794174_2794984_+	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
AUL87773.1|2795040_2795235_+	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
AUL85406.1|2795227_2795416_+	hypothetical protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
AUL85407.1|2795515_2795731_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AUL85408.1|2795732_2796968_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.0	4.3e-237
AUL85409.1|2797019_2797955_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.2	1.2e-146
2797044:2797069	attR	AAGAAAGAACAATACAACCTGAACAA	NA	NA	NA	NA
AUL85410.1|2798083_2799457_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	1.5e-52
AUL85411.1|2799486_2799660_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85412.1|2799935_2800919_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AUL87774.1|2801173_2802406_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	4.0e-17
>prophage 9
CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	2973226	3137666	5267207	head,lysis,tRNA,integrase,holin,terminase,protease,transposase,tail,capsid	Enterobacteria_phage(25.0%)	198	3123602:3123622	3147750:3147770
AUL85563.1|2973226_2973920_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL87783.1|2974084_2974996_+	hemolysin HlyE	NA	NA	NA	NA	NA
AUL85564.1|2975202_2975664_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
AUL85565.1|2975740_2976400_-	isomerase/hydrolase	NA	NA	NA	NA	NA
AUL85566.1|2976471_2976765_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85567.1|2977006_2977408_+	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
AUL85568.1|2977527_2977896_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85569.1|2978051_2978279_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85570.1|2978418_2979114_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
AUL85571.1|2979137_2979950_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
AUL85572.1|2979953_2980220_+	cell division topological specificity factor	NA	NA	NA	NA	NA
AUL85573.1|2981049_2981235_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85574.1|2981335_2981509_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85575.1|2981510_2981855_+	glycine zipper family protein	NA	NA	NA	NA	NA
AUL85576.1|2981864_2982194_+	hypothetical protein	NA	NA	NA	NA	NA
AUL87784.1|2982250_2984572_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.3	1.8e-90
AUL87785.1|2985150_2985294_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85577.1|2985298_2985517_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85578.1|2987501_2987750_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85579.1|2987862_2988129_-	RcsB connector protein for regulation of biofilm and acid-resistance	NA	NA	NA	NA	NA
AUL85580.1|2988157_2988430_-	two-component-system connector protein YmgA	NA	NA	NA	NA	NA
AUL85581.1|2988472_2988709_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
AUL85582.1|2989022_2990234_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AUL85583.1|2990438_2991170_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
AUL85584.1|2991390_2991795_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AUL85585.1|2992490_2992811_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	64.7	1.1e-38
AUL85586.1|2992878_2993031_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
AUL87786.1|2993510_2993948_+	acetyltransferase	NA	NA	NA	NA	NA
AUL85587.1|2994204_2994558_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUL85588.1|2994840_2995221_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
AUL85589.1|2995217_2995565_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AUL85590.1|2997167_2997377_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85591.1|2997511_2998465_+|protease	outer membrane protease PgtE	protease	NA	NA	NA	NA
AUL85592.1|2998651_3000136_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUL85593.1|3000319_3000625_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
AUL87787.1|3000723_3001350_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL85594.1|3001847_3002030_+	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AUL85595.1|3002108_3002609_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AUL85596.1|3002645_3003152_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AUL85597.1|3003170_3004061_+	Mn-containing catalase	NA	NA	NA	NA	NA
AUL85598.1|3004180_3004762_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.5e-102
AUL85599.1|3004761_3007833_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	1.9e-68
AUL85600.1|3007897_3008419_-|tail	phage tail tape measure protein	tail	A0A291AWV3	Escherichia_phage	100.0	2.2e-41
AUL85601.1|3009868_3010075_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AUL85602.1|3010071_3011997_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
AUL85603.1|3011971_3012517_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	3.1e-94
AUL85604.1|3012905_3013100_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	3.7e-26
AUL85605.1|3013264_3013471_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
AUL85606.1|3013756_3014167_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
AUL85607.1|3014458_3014752_+	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
AUL85608.1|3014783_3015245_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	100.0	1.9e-76
AUL85609.1|3015241_3015718_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	96.8	1.0e-85
AUL85610.1|3015704_3016022_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.1	3.3e-40
AUL87788.1|3016331_3016877_-	antiterminator	NA	I6PDF8	Cronobacter_phage	49.7	3.4e-45
AUL85611.1|3017150_3017387_+	excisionase	NA	NA	NA	NA	NA
AUL85612.1|3017376_3018519_+|integrase	integrase	integrase	Q77Z02	Phage_21	99.4	1.2e-204
AUL85613.1|3018632_3019883_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	1.9e-22
AUL85614.1|3020054_3020708_+	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AUL85615.1|3020717_3021179_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AUL85616.1|3021232_3022339_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUL87789.1|3022374_3023016_+	lysogenization protein HflD	NA	NA	NA	NA	NA
AUL85617.1|3023019_3024390_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	3.2e-108
AUL85618.1|3024558_3025230_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AUL85619.1|3025229_3026690_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
AUL85620.1|3026765_3027887_+	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AUL85621.1|3027935_3029162_-	peptidase T	NA	NA	NA	NA	NA
AUL85622.1|3029217_3029433_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85623.1|3029411_3030548_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
AUL85624.1|3030531_3031395_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.2	2.0e-10
AUL85625.1|3032441_3033092_+	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
AUL85626.1|3033166_3034225_+	type III effector	NA	NA	NA	NA	NA
AUL85627.1|3034352_3034988_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
AUL85628.1|3035055_3035637_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
AUL85629.1|3035748_3036018_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
AUL85630.1|3036019_3037333_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
AUL87790.1|3037397_3038021_-	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	8.7e-69
AUL85631.1|3038089_3041569_-|tail	phage tail protein	tail	B6DZB5	Enterobacteria_phage	94.5	0.0e+00
AUL85632.1|3041804_3042485_-|tail	phage tail protein	tail	Q9EYE5	Enterobacteria_phage	90.6	1.0e-107
AUL85633.1|3042382_3043126_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	7.3e-147
AUL85634.1|3043136_3043835_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
AUL85635.1|3043834_3044176_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	93.8	6.4e-58
AUL85636.1|3047453_3047735_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
AUL87791.1|3047758_3048154_-|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	97.6	7.7e-63
AUL85637.1|3048918_3049263_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AUL85638.1|3049259_3049706_-	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AUL85639.1|3049702_3050053_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AUL85640.1|3050063_3050390_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	99.1	2.0e-53
AUL85641.1|3052914_3053136_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	2.9e-35
AUL85642.1|3053180_3055118_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.8	0.0e+00
AUL85643.1|3055181_3056843_-|terminase	terminase	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
AUL85644.1|3056839_3057403_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
AUL85645.1|3057693_3058059_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.0	7.8e-62
AUL85646.1|3058100_3058286_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	6.4e-20
AUL85647.1|3058415_3058556_-	hypothetical protein	NA	NA	NA	NA	NA
AUL87792.1|3058697_3058916_-	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	73.3	6.4e-11
AUL85648.1|3058912_3059137_-	hypothetical protein	NA	NA	NA	NA	NA
AUL87793.1|3059160_3059628_-|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.1	7.2e-68
AUL85649.1|3059785_3059977_-	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	63.9	7.8e-05
AUL85650.1|3060054_3060588_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
AUL85651.1|3060620_3060815_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85652.1|3060783_3061020_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85653.1|3060968_3061313_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85654.1|3061275_3061491_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
AUL85655.1|3061772_3063623_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	99.0	0.0e+00
AUL85656.1|3064036_3064303_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85657.1|3064193_3064625_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	3.6e-66
AUL85658.1|3064803_3065025_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.0e-20
AUL85659.1|3065077_3065302_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85660.1|3065681_3066740_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	91.5	1.2e-192
AUL85661.1|3066890_3067088_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	98.5	4.0e-28
AUL85662.1|3067306_3067990_-	antiterminator	NA	I6PDF8	Cronobacter_phage	48.9	1.2e-55
AUL85663.1|3067986_3068346_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.8	1.7e-37
AUL85664.1|3068358_3069408_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.5e-110
AUL85665.1|3069409_3069688_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	6.3e-11
AUL87794.1|3069628_3069826_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85666.1|3069803_3070289_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
AUL85667.1|3070307_3070487_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85668.1|3070818_3071163_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	92.1	9.7e-54
AUL85669.1|3071166_3071454_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	95.8	2.5e-47
AUL85670.1|3071456_3071816_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	78.6	1.3e-37
AUL85671.1|3071981_3072164_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	95.0	1.0e-25
AUL85672.1|3072311_3072617_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.0	1.5e-50
AUL85673.1|3072613_3072931_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	71.6	3.0e-33
AUL85674.1|3072927_3073644_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.0e-73
AUL85675.1|3073665_3074412_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.2	8.1e-114
AUL87795.1|3074418_3075387_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	52.4	9.0e-73
AUL85676.1|3075409_3075835_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUL85677.1|3075831_3076059_-	cell division protein	NA	NA	NA	NA	NA
AUL85678.1|3076155_3076803_+	helix-turn-helix domain-containing protein	NA	A0A1P8DTH0	Proteus_phage	25.9	4.7e-09
AUL85679.1|3077076_3077229_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
AUL85680.1|3077618_3077807_+	cell division inhibitor	NA	NA	NA	NA	NA
AUL85681.1|3077803_3077992_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUL85682.1|3078084_3080628_+	exonuclease	NA	V5UQJ3	Shigella_phage	69.8	7.1e-234
AUL87796.1|3080689_3080959_+	excisionase	NA	NA	NA	NA	NA
AUL85683.1|3080927_3082046_+|integrase	integrase	integrase	Q77Z04	Phage_21	44.7	3.5e-84
AUL85684.1|3082122_3082590_-	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
AUL85685.1|3082567_3082771_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85686.1|3083119_3083332_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85687.1|3083452_3084814_+	type III secretion protein GogB	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
AUL85688.1|3084874_3085150_+	secretion protein EspO	NA	NA	NA	NA	NA
AUL85689.1|3085229_3085355_-	NleB	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
AUL85690.1|3085377_3085965_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85691.1|3087545_3088239_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL85692.1|3088236_3090297_-	type III effector	NA	A0A0N7KZG3	Stx2-converting_phage	29.1	2.8e-63
AUL85693.1|3090887_3093236_-	type III secretion system effector HECT-type E3 ubiquitin transferase	NA	NA	NA	NA	NA
AUL85694.1|3093451_3093721_-|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
AUL85695.1|3093722_3095036_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	2.0e-78
AUL85696.1|3095100_3095700_-	Ail/Lom family protein	NA	A0A0P0ZBV0	Stx2-converting_phage	99.0	2.0e-110
AUL85697.1|3095766_3099243_-|tail	phage tail protein	tail	Q687E8	Enterobacteria_phage	96.4	0.0e+00
AUL85698.1|3099489_3100170_-|tail	phage tail protein	tail	Q9EYE5	Enterobacteria_phage	90.2	2.3e-107
AUL85699.1|3100067_3100811_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.6	9.2e-150
AUL85700.1|3100821_3101520_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.7e-129
AUL85701.1|3101519_3101861_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	96.5	2.0e-59
AUL85702.1|3105138_3105420_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
AUL85703.1|3105443_3105806_-|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.3	4.6e-62
AUL85704.1|3106599_3106944_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AUL85705.1|3106940_3107387_-	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AUL85706.1|3107307_3107733_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	99.1	2.8e-58
AUL85707.1|3107743_3108070_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	99.1	2.0e-53
AUL85708.1|3110425_3110647_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
AUL85709.1|3110691_3112629_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.2	0.0e+00
AUL85710.1|3112692_3114354_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	100.0	0.0e+00
AUL85711.1|3114350_3114914_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
AUL85712.1|3115029_3115209_-	hypothetical protein	NA	H6WZK7	Escherichia_phage	91.1	8.6e-22
AUL85713.1|3115205_3115571_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
AUL85714.1|3115612_3115840_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
AUL85715.1|3116207_3116675_-|lysis	lysis protein	lysis	A0A0P0ZDL0	Stx2-converting_phage	100.0	9.0e-79
AUL85716.1|3116828_3117380_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	96.3	2.3e-97
AUL85717.1|3117650_3118184_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	99.4	4.3e-101
AUL87797.1|3118234_3118579_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
AUL85718.1|3118583_3118799_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
AUL85719.1|3119233_3121084_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
AUL85720.1|3121497_3121764_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85721.1|3121654_3122086_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	3.6e-66
AUL85722.1|3122651_3123473_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
AUL85723.1|3123469_3123844_-	hypothetical protein	NA	V5URS4	Shigella_phage	62.7	1.3e-32
3123602:3123622	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
AUL85724.1|3123856_3124906_-	hypothetical protein	NA	U5P0K4	Shigella_phage	54.3	7.7e-110
AUL85725.1|3124907_3125180_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
AUL85726.1|3125301_3125646_-	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
AUL85727.1|3125765_3125978_-	hypothetical protein	NA	A0A0P0ZAX5	Stx2-converting_phage	98.6	8.6e-29
AUL85728.1|3126211_3126769_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
AUL85729.1|3126770_3126989_-	sugar acetyltransferase inhibitor	NA	A0A2R2Z311	Escherichia_phage	70.8	3.1e-21
AUL85730.1|3127116_3127428_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
AUL85731.1|3127420_3127648_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
AUL87798.1|3127644_3127926_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	3.6e-30
AUL85732.1|3127958_3128675_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.0	1.6e-71
AUL85733.1|3128696_3129443_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	1.4e-113
AUL85734.1|3129449_3130520_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	66.2	4.5e-65
AUL85735.1|3130591_3131017_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUL85736.1|3131000_3131324_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
AUL85737.1|3131448_3131925_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
AUL85738.1|3132243_3132396_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
AUL85739.1|3132885_3133074_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AUL85740.1|3133070_3133262_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUL85741.1|3133355_3135827_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
AUL85742.1|3135888_3136158_+	excisionase	NA	NA	NA	NA	NA
AUL85743.1|3136126_3137245_+|integrase	integrase	integrase	Q77Z04	Phage_21	44.2	2.9e-83
AUL85744.1|3137321_3137666_-	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.5	4.3e-09
3147750:3147770	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 10
CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	3281715	3309289	5267207	lysis,integrase,holin,terminase,protease,transposase,tail	Escherichia_phage(30.43%)	38	3297511:3297526	3315007:3315022
AUL85883.1|3281715_3281985_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	95.5	7.8e-43
AUL87807.1|3283364_3283988_-	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.3e-69
AUL87808.1|3284056_3285739_-|tail	phage tail protein	tail	Q6H9T2	Enterobacteria_phage	98.8	7.0e-307
AUL85884.1|3286561_3287071_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AUL85885.1|3287473_3287698_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
AUL85886.1|3287779_3288094_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AUL85887.1|3288336_3288477_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85888.1|3288559_3289027_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	93.5	2.2e-72
AUL85889.1|3289028_3289142_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
AUL85890.1|3289362_3289896_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
AUL85891.1|3289940_3290123_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85892.1|3290091_3290328_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85893.1|3290276_3290621_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85894.1|3290583_3290799_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
AUL87809.1|3292457_3293682_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.1e-176
AUL85895.1|3294957_3295731_-	iroE	NA	NA	NA	NA	NA
AUL85896.1|3296278_3296491_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
AUL85897.1|3296658_3296937_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
AUL85898.1|3296938_3297988_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
3297511:3297526	attL	GGCGGAAAAAATCCGC	NA	NA	NA	NA
AUL85899.1|3298000_3298372_+	hypothetical protein	NA	V5URS4	Shigella_phage	63.7	1.3e-35
AUL85900.1|3298361_3298733_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
AUL85901.1|3298884_3299703_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUL85902.1|3299989_3300187_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
AUL85903.1|3300812_3301085_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
AUL85904.1|3301193_3301595_+	XRE family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
AUL85905.1|3301622_3301814_+	antitoxin	NA	NA	NA	NA	NA
AUL85906.1|3301813_3302101_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUL85907.1|3302377_3302533_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AUL85908.1|3302534_3302663_+	hypothetical protein	NA	NA	NA	NA	NA
AUL85909.1|3302674_3303064_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	30.0	1.5e-05
AUL85910.1|3303250_3303436_-	hypothetical protein	NA	NA	NA	NA	NA
AUL87810.1|3303437_3303743_-	hypothetical protein	NA	NA	NA	NA	NA
AUL85911.1|3304009_3304198_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AUL85912.1|3304194_3304386_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUL85913.1|3304479_3306915_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	6.4e-59
AUL85914.1|3306982_3307225_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AUL85915.1|3307202_3308222_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
AUL85916.1|3308629_3309289_+	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	48.5	6.2e-41
3315007:3315022	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
>prophage 11
CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	3625261	3636977	5267207	holin,transposase,integrase,tail	Enterobacteria_phage(43.75%)	17	3623498:3623512	3637051:3637065
3623498:3623512	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
AUL87826.1|3625261_3625507_-|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	98.5	2.4e-30
AUL86195.1|3625731_3625947_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
AUL86196.1|3626813_3627530_-	hypothetical protein	NA	NA	NA	NA	NA
AUL86197.1|3627809_3628433_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
AUL86198.1|3628429_3629095_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	98.6	7.2e-130
AUL86199.1|3629247_3629430_+	recombinase	NA	A0A1I9LJN0	Stx_converting_phage	98.3	7.2e-24
AUL86200.1|3629426_3630107_+	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.3	5.6e-130
AUL86201.1|3630103_3630265_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
AUL86202.1|3630257_3630815_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
AUL86203.1|3630825_3631107_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
AUL86204.1|3631205_3631463_+	conjugal transfer protein TraR	NA	A0A1I9LJM6	Stx_converting_phage	97.1	2.0e-32
AUL86205.1|3631468_3632681_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	8.4e-169
AUL86206.1|3633136_3633505_-	hypothetical protein	NA	Q716C1	Shigella_phage	97.7	2.5e-39
AUL86207.1|3633648_3634257_+	eae-like domain protein	NA	Q9MCR3	Enterobacteria_phage	96.4	5.0e-21
AUL86208.1|3634387_3635086_+	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	81.9	1.5e-101
AUL86209.1|3635310_3635622_+	hypothetical protein	NA	A0A1I9LJL8	Stx_converting_phage	100.0	2.1e-55
AUL86210.1|3635906_3636977_+|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
3637051:3637065	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 12
CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	4073332	4116014	5267207	transposase,integrase	Enterobacteria_phage(33.33%)	39	4073275:4073334	4102208:4102974
4073275:4073334	attL	GGGTGATGCCTCTAATTAGTTGAATCTGATGTATAATACGGGCTTTTGAGGTTATCTCAT	NA	NA	NA	NA
AUL86598.1|4073332_4074026_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL86599.1|4074873_4075764_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL86600.1|4075884_4080138_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
AUL86601.1|4080703_4081555_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
AUL86602.1|4081581_4082571_+	aldo/keto reductase	NA	NA	NA	NA	NA
AUL86603.1|4082602_4083538_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL86604.1|4083958_4084060_+	hypothetical protein	NA	NA	NA	NA	NA
AUL87845.1|4084423_4084687_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
AUL86605.1|4084686_4084827_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
AUL86606.1|4084861_4085089_-	hypothetical protein	NA	NA	NA	NA	NA
AUL86607.1|4085863_4086073_+	hypothetical protein	NA	NA	NA	NA	NA
AUL86608.1|4086047_4086742_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL86609.1|4087253_4087889_+	fimbrial protein	NA	NA	NA	NA	NA
AUL86610.1|4087946_4088615_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
AUL86611.1|4088800_4090014_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
AUL86612.1|4090065_4090218_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AUL86613.1|4090265_4090481_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AUL86614.1|4090646_4091861_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
AUL86615.1|4092216_4093470_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
AUL86616.1|4093481_4094585_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AUL86617.1|4095965_4096367_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
AUL86618.1|4096424_4097669_-	esterase	NA	NA	NA	NA	NA
AUL86619.1|4097760_4098219_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AUL86620.1|4098479_4099937_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
AUL86621.1|4099993_4100608_-	peptide chain release factor H	NA	NA	NA	NA	NA
AUL86622.1|4101690_4101954_-	hypothetical protein	NA	NA	NA	NA	NA
AUL86623.1|4102265_4102959_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL86624.1|4103211_4104267_-	DNA polymerase IV	NA	NA	NA	NA	NA
4102208:4102974	attR	GGGTGATGCCTCTAATTAGTTGAATCTGATGTATAATACGGGCTTTTGAGGTTATCTCATGGCCAGCGTTAATATTCATTGTCCCCGTTGTCAGTCAGCTCAGGTTTACCGCCATGGTCAGAACCCTAAAGGCCGTGACAGATTTCGCTGCCGTGACTGCCACCGTGTGTTTCAGCTCACTTATACTTATCAAGCACGTAAGCCGGGTATGAAAGAGCTGATAACTGAAATGGCCTTTAATGGTGCCGGGGTTCGCGATACCGCCAGGACACTGAAAATTGGTATTAACACCGTCATCCGGACTTTAAAAAACTCGCGCCAAAGCGAATAACGTCTTCGCCTGTTGCCCATGCTGATGTGGCGCTTATCTGCGAGCTTGATGAGCAATGGAGCTACGTTGGCAGTAAAGCCCGGCAACACTGGCTCTGGTACGCGTACAACACCAAAACAGGCGGTGTACTGGCCTACACTTTTGGTCCCCGAACCGATCAAACGTGCCGGGAGCTACTGGCACTGCTTACACCCTTCAACATCGGCATGCTGACCAGCGATGACTGGGGCAGCTATGGCCGGGAGGTGCCGAAGAATAAGCATCTGACCGGCAAAATATTCACCCAACGCATTGAGCGTAATAATCTGACGCTACGCACCCGCATTAAGCGGTTGGCTCGTAAAACAATCTGCTTCTCACGCTCAGTTGAGATCCACGAAAAAGTGATCGGAGCGTTTATCGAAAAACACATGTTCTACTAATTGGATGCACTACC	NA	NA	NA	NA
AUL86625.1|4104337_4105108_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
AUL86626.1|4105742_4106003_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
AUL86627.1|4106005_4106284_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
AUL86628.1|4106439_4107180_+	transpeptidase	NA	NA	NA	NA	NA
AUL86629.1|4107150_4107918_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AUL86630.1|4108123_4108702_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	31.4	3.3e-14
AUL86631.1|4108941_4111386_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL86632.1|4111428_4111902_-	inhibitor of vertebrate lysozyme	NA	NA	NA	NA	NA
AUL86633.1|4112055_4112826_+	amidohydrolase	NA	NA	NA	NA	NA
AUL86634.1|4114413_4114713_-	hypothetical protein	NA	NA	NA	NA	NA
AUL86635.1|4115320_4116014_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
>prophage 13
CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	4121453	4192546	5267207	transposase,tRNA,plate,protease	Enterobacteria_phage(11.11%)	56	NA	NA
AUL86639.1|4121453_4121867_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AUL86640.1|4121870_4123721_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AUL86641.1|4125387_4126601_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
AUL86642.1|4128057_4128801_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AUL86643.1|4128739_4130218_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AUL86644.1|4130296_4133761_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AUL86645.1|4135147_4135630_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUL86646.1|4135673_4136588_+	hypothetical protein	NA	NA	NA	NA	NA
AUL86647.1|4136597_4137077_+	hypothetical protein	NA	NA	NA	NA	NA
AUL86648.1|4137213_4137999_-	hypothetical protein	NA	NA	NA	NA	NA
AUL87846.1|4138537_4139269_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
AUL86649.1|4139333_4139801_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AUL86650.1|4139797_4140520_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL86651.1|4140553_4141309_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AUL86652.1|4141380_4142739_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	1.3e-08
AUL86653.1|4142787_4143411_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL86654.1|4143414_4144215_-	EEP domain-containing protein	NA	NA	NA	NA	NA
AUL86655.1|4144472_4145167_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL86656.1|4151062_4151638_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AUL86657.1|4151825_4152857_+	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	1.2e-35
AUL86658.1|4152849_4153503_+	methionine ABC transporter	NA	NA	NA	NA	NA
AUL86659.1|4153542_4154358_+	methionine ABC transporter substrate-binding protein MetQ	NA	NA	NA	NA	NA
AUL86660.1|4154475_4154880_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
AUL86661.1|4154876_4155584_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AUL86662.1|4155694_4157413_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AUL86663.1|4158443_4159154_-	copper homeostasis/adhesion lipoprotein NlpE	NA	NA	NA	NA	NA
AUL86664.1|4159167_4159590_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUL86665.1|4160017_4160218_+	hypothetical protein	NA	NA	NA	NA	NA
AUL87847.1|4160210_4160465_+	protein rof	NA	NA	NA	NA	NA
AUL86666.1|4160513_4161812_-|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
AUL86667.1|4161876_4162266_-	VOC family protein	NA	NA	NA	NA	NA
AUL86668.1|4162322_4164464_-	lysine decarboxylase	NA	NA	NA	NA	NA
AUL86669.1|4164562_4165522_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AUL86670.1|4165534_4169017_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	1.1e-208
AUL86671.1|4169053_4169650_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
AUL86672.1|4169646_4170795_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AUL86673.1|4170794_4171583_-	acyl-[acyl-carrier-protein]--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AUL86674.1|4171586_4172042_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AUL86675.1|4172146_4173172_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AUL86676.1|4173175_4173661_-	chaperone protein Skp	NA	NA	NA	NA	NA
AUL86677.1|4173782_4176215_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AUL86678.1|4176244_4177597_-|protease	zinc metalloprotease RseP	protease	NA	NA	NA	NA
AUL86679.1|4177608_4178466_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AUL86680.1|4178478_4179237_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
AUL86681.1|4179425_4180622_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AUL86682.1|4180713_4181271_-	ribosome-recycling factor	NA	NA	NA	NA	NA
AUL86683.1|4181562_4182288_-	UMP kinase	NA	NA	NA	NA	NA
AUL86684.1|4182434_4183286_-	elongation factor Ts	NA	NA	NA	NA	NA
AUL86685.1|4183304_4183592_+	hypothetical protein	NA	NA	NA	NA	NA
AUL86686.1|4183543_4184269_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AUL86687.1|4184636_4185431_+	methionine aminopeptidase	NA	NA	NA	NA	NA
AUL86688.1|4185492_4188165_+	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
AUL86689.1|4188195_4189020_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AUL86690.1|4189334_4189721_+	hypothetical protein	NA	NA	NA	NA	NA
AUL86691.1|4189809_4190967_-	carbohydrate diacid regulon transcriptional regulator CdaR	NA	NA	NA	NA	NA
AUL86692.1|4191121_4192546_-|protease	periplasmic serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 14
CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	4373522	4414709	5267207	tRNA,tail	Enterobacteria_phage(23.53%)	41	NA	NA
AUL86844.1|4373522_4374209_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AUL86845.1|4374608_4374749_-	hypothetical protein	NA	NA	NA	NA	NA
AUL86846.1|4374844_4375561_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL86847.1|4375620_4376973_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
AUL86848.1|4377030_4378455_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	3.6e-09
AUL86849.1|4378454_4379144_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
AUL86850.1|4379156_4379630_-	protein CreA	NA	NA	NA	NA	NA
AUL86851.1|4379840_4380710_+	right origin-binding protein	NA	NA	NA	NA	NA
AUL86852.1|4380706_4381354_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
AUL87856.1|4381405_4381918_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
AUL86853.1|4382064_4382391_-	Trp operon repressor	NA	NA	NA	NA	NA
AUL86854.1|4382480_4384418_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.7	2.3e-11
AUL87857.1|4384526_4384655_-	methionine aminopeptidase	NA	NA	NA	NA	NA
AUL86855.1|4384628_4386296_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
AUL86856.1|4386602_4387835_-	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
AUL86857.1|4387855_4389238_-	DNA repair protein RadA	NA	NA	NA	NA	NA
AUL86858.1|4389286_4390255_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
AUL86859.1|4390360_4391005_+	hypothetical protein	NA	NA	NA	NA	NA
AUL86860.1|4391032_4392049_+	lipoate-protein ligase LplA	NA	NA	NA	NA	NA
AUL86861.1|4392049_4393381_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL86862.1|4393547_4394267_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
AUL86863.1|4394323_4395547_-	phosphopentomutase	NA	NA	NA	NA	NA
AUL86864.1|4395598_4396921_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	6.8e-79
AUL86865.1|4397087_4397867_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
AUL86866.1|4398125_4399676_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
AUL86867.1|4399647_4399800_+	hypothetical protein	NA	NA	NA	NA	NA
AUL86868.1|4399806_4400511_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
AUL86869.1|4400623_4401406_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AUL86870.1|4401402_4402476_-	patatin family protein	NA	NA	NA	NA	NA
AUL86871.1|4402597_4402777_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
AUL86872.1|4402885_4403491_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AUL86873.1|4403883_4405470_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
AUL86874.1|4405689_4405938_+	damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
AUL86875.1|4406306_4406576_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
AUL86876.1|4406577_4407891_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.2	3.2e-81
AUL86877.1|4407955_4408555_-	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	5.9e-107
AUL86878.1|4408621_4412101_-|tail	phage tail protein	tail	B6DZB5	Enterobacteria_phage	96.4	0.0e+00
AUL86879.1|4412337_4413018_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.1	1.6e-108
AUL86880.1|4412915_4413659_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.3	9.8e-144
AUL86881.1|4413669_4414368_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	2.0e-130
AUL86882.1|4414367_4414709_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
>prophage 15
CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	4473732	4571779	5267207	head,lysis,tRNA,integrase,holin,terminase,tail,transposase,capsid	Stx2-converting_phage(37.8%)	109	4525746:4525763	4574718:4574735
AUL86934.1|4473732_4474427_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL86935.1|4474587_4475313_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL86936.1|4475270_4475948_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AUL86937.1|4475984_4476773_-	hydroxamate siderophore iron reductase FhuF	NA	NA	NA	NA	NA
AUL86938.1|4476874_4477150_+	DUF1435 domain-containing protein	NA	NA	NA	NA	NA
AUL86939.1|4477710_4478742_-	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
AUL86940.1|4478844_4479258_+	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
AUL86941.1|4479226_4479673_+	ribosomal-protein-alanine N-acetyltransferase RimI	NA	NA	NA	NA	NA
AUL86942.1|4479687_4480365_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
AUL86943.1|4480430_4480532_+	peptide chain release factor 3	NA	NA	NA	NA	NA
AUL86944.1|4480750_4481974_+|integrase	integrase	integrase	A0A291AWU1	Escherichia_phage	98.0	1.3e-233
AUL87861.1|4482145_4483051_-	hypothetical protein	NA	NA	NA	NA	NA
AUL86945.1|4483924_4484119_-	DNA-binding protein	NA	A5LH59	Enterobacteria_phage	98.4	5.8e-32
AUL87862.1|4484118_4484451_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	100.0	1.5e-43
AUL86946.1|4484953_4485640_-	hypothetical protein	NA	H6WZG2	Escherichia_phage	87.1	3.7e-121
AUL86947.1|4485636_4485858_-	conjugal transfer protein TraR	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
AUL86948.1|4485956_4486238_-	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	100.0	3.2e-47
AUL86949.1|4486248_4486440_-	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
AUL87863.1|4486417_4486594_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	1.3e-22
AUL86950.1|4486590_4487271_-	exonuclease	NA	A0A0P0ZFI7	Escherichia_phage	98.2	1.9e-130
AUL86951.1|4487267_4488218_-	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	96.8	2.0e-173
AUL86952.1|4488234_4488516_-	hypothetical protein	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
AUL86953.1|4488536_4488818_-	AbrB family transcriptional regulator	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
AUL86954.1|4488829_4489042_-	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
AUL86955.1|4489112_4490012_-	hypothetical protein	NA	A0A0P0ZG86	Escherichia_phage	96.2	1.4e-139
AUL86956.1|4490515_4491469_-	restriction endonuclease	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
AUL86957.1|4491465_4492935_-	SAM-dependent methyltransferase	NA	A0A2L1IV91	Escherichia_phage	99.6	1.9e-284
AUL86958.1|4493029_4493743_-	LexA family transcriptional repressor	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
AUL86959.1|4493838_4494042_+	Cro/Cl family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	98.5	9.8e-30
AUL86960.1|4494212_4494407_+	hypothetical protein	NA	NA	NA	NA	NA
AUL86961.1|4494573_4494951_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	98.4	7.6e-60
AUL86962.1|4494944_4496465_+	ATP-dependent helicase	NA	A0A2R2Z335	Escherichia_phage	99.8	8.3e-307
AUL86963.1|4496454_4497426_+	DNA primase	NA	A0A0H4IPK0	Shigella_phage	100.0	1.9e-195
AUL86964.1|4497425_4497875_+	DUF1367 domain-containing protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
AUL86965.1|4497882_4498446_+	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
AUL86966.1|4498442_4498637_+	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	98.4	1.4e-30
AUL86967.1|4498629_4499064_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
AUL86968.1|4499052_4499298_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
AUL86969.1|4499312_4499465_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
AUL86970.1|4499853_4500813_+	Shiga toxin Stx2 subunit A	NA	Q5TJL6	Enterobacteria_phage	99.7	9.6e-176
AUL86971.1|4500824_4501094_+	Shiga toxin Stx2 subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
AUL86972.1|4501390_4501714_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
AUL86973.1|4501901_4502596_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL86974.1|4502731_4504669_+	sialate O-acetylesterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.1	0.0e+00
AUL86975.1|4504805_4504985_+	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AUL86976.1|4505025_4505298_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
AUL86977.1|4505374_4505590_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
AUL86978.1|4505589_4506087_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
AUL86979.1|4506083_4506521_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
AUL86980.1|4506723_4507221_+	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
AUL86981.1|4507217_4507475_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
AUL86982.1|4507551_4507686_-	hypothetical protein	NA	NA	NA	NA	NA
AUL86983.1|4507937_4508165_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
AUL86984.1|4508206_4508572_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	4.0e-66
AUL87864.1|4508540_4508678_+	DNase	NA	H6WZK7	Escherichia_phage	75.0	8.6e-06
AUL86985.1|4508861_4509425_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
AUL86986.1|4509421_4511083_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
AUL86987.1|4511146_4513084_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.5	0.0e+00
AUL87865.1|4513128_4513350_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
AUL86988.1|4515870_4516197_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
AUL86989.1|4516207_4516558_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	99.1	1.0e-58
AUL86990.1|4516554_4517001_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AUL86991.1|4517068_4517341_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.9	3.9e-42
AUL86992.1|4517406_4518123_+|tail	phage tail protein	tail	B6DZA6	Enterobacteria_phage	99.6	2.8e-127
AUL86993.1|4518137_4518512_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
AUL86994.1|4519814_4520129_+	hypothetical protein	NA	A0A0P0ZE78	Stx2-converting_phage	97.8	1.2e-34
AUL86995.1|4522093_4522435_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
AUL86996.1|4522434_4523133_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	2.0e-130
AUL86997.1|4523143_4523887_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.3	9.8e-144
AUL86998.1|4524700_4528180_+|tail	phage tail protein	tail	B6DZB5	Enterobacteria_phage	96.4	0.0e+00
4525746:4525763	attL	TGCCGGTATGGAACGGCC	NA	NA	NA	NA
AUL86999.1|4528246_4528846_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	5.9e-107
AUL87000.1|4528910_4530224_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	3.6e-80
AUL87001.1|4530225_4530495_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	1.9e-44
AUL87002.1|4530704_4530896_+	hypothetical protein	NA	NA	NA	NA	NA
AUL87003.1|4530924_4531911_+	peptidase M85	NA	NA	NA	NA	NA
AUL87004.1|4532282_4532498_-	DinI family protein	NA	Q687E4	Enterobacteria_phage	98.6	1.9e-31
AUL87005.1|4532596_4532977_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
AUL87006.1|4532973_4533321_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AUL87007.1|4533370_4534909_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	6.5e-299
AUL87008.1|4537722_4537869_+	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	55.3	1.9e-06
AUL87009.1|4537908_4538602_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL87010.1|4538711_4538957_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
AUL87011.1|4539571_4539772_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUL87012.1|4539725_4540463_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	7.5e-104
AUL87013.1|4540916_4541954_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AUL87014.1|4542880_4543441_-	DNA-invertase	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
AUL87866.1|4543454_4543640_-	hypothetical protein	NA	NA	NA	NA	NA
AUL87015.1|4543566_4543890_+|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	56.4	1.2e-21
AUL87867.1|4543924_4544446_-|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
AUL87868.1|4544525_4544729_-|tail	phage tail protein	tail	NA	NA	NA	NA
AUL87016.1|4545412_4545973_-	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	49.1	3.9e-44
AUL87017.1|4545963_4547049_-	hypothetical protein	NA	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
AUL87018.1|4547193_4548480_-|integrase	site-specific integrase	integrase	A0A0N7KZF5	Stx2-converting_phage	100.0	5.8e-253
AUL87019.1|4548513_4548768_-	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
AUL87020.1|4548786_4548921_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
AUL87021.1|4550048_4550399_-	Eae protein	NA	A0A0P0ZBF8	Stx2-converting_phage	100.0	7.0e-60
AUL87022.1|4550389_4550926_-	HD family hydrolase	NA	A0A0P0ZCH9	Stx2-converting_phage	100.0	9.7e-101
AUL87023.1|4551053_4551878_-	DUF2303 domain-containing protein	NA	A0A0P0ZBZ4	Stx2-converting_phage	100.0	2.7e-150
AUL87024.1|4551943_4552306_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AUL87025.1|4552399_4553093_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL87026.1|4553707_4557697_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	45.1	5.2e-308
AUL87027.1|4559059_4559754_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL87028.1|4559844_4561107_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	38.2	1.7e-79
AUL87029.1|4561573_4562593_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	2.4e-44
AUL87030.1|4564386_4565469_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AUL87031.1|4565468_4566569_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AUL87032.1|4566835_4568347_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	1.0e-46
AUL87869.1|4568480_4568924_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AUL87033.1|4568923_4571779_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	7.9e-141
4574718:4574735	attR	TGCCGGTATGGAACGGCC	NA	NA	NA	NA
>prophage 16
CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	4649569	4703505	5267207	transposase,tRNA,protease	Vibrio_phage(15.38%)	48	NA	NA
AUL87109.1|4649569_4650721_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AUL87110.1|4650677_4651040_-	hypothetical protein	NA	NA	NA	NA	NA
AUL87111.1|4651058_4651460_-	DUF2170 domain-containing protein	NA	NA	NA	NA	NA
AUL87112.1|4651586_4652318_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AUL87113.1|4652498_4654940_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	2.9e-67
AUL87114.1|4654978_4655404_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL87115.1|4655608_4656907_-	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
AUL87116.1|4657010_4657208_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
AUL87117.1|4657289_4658294_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
AUL87118.1|4658296_4659556_-|protease	protease modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
AUL87119.1|4659641_4660922_-	GTPase HflX	NA	NA	NA	NA	NA
AUL87120.1|4660998_4661307_-	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AUL87121.1|4661392_4662343_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AUL87122.1|4662335_4664183_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	3.4e-60
AUL87123.1|4664192_4665527_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
AUL87124.1|4665545_4666007_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
AUL87125.1|4665978_4667526_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AUL87126.1|4667524_4668664_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AUL87127.1|4669564_4670110_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
AUL87128.1|4670204_4671257_+	ribosome small subunit-dependent GTPase	NA	NA	NA	NA	NA
AUL87129.1|4671353_4672322_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AUL87130.1|4672343_4675667_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
AUL87131.1|4676605_4677299_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL87132.1|4678312_4679290_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
AUL87133.1|4679614_4681423_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
AUL87134.1|4681415_4682150_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AUL87135.1|4682160_4682556_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
AUL87136.1|4682566_4682926_+	fumarate reductase subunit D	NA	NA	NA	NA	NA
AUL87137.1|4682988_4684122_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
AUL87138.1|4684210_4684744_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
AUL87139.1|4684740_4685058_-	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
AUL87140.1|4685239_4685386_-	entericidin B	NA	NA	NA	NA	NA
AUL87141.1|4685496_4685622_-	entericidin A	NA	NA	NA	NA	NA
AUL87142.1|4685673_4686240_-	elongation factor P	NA	NA	NA	NA	NA
AUL87143.1|4686281_4687310_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
AUL87144.1|4687704_4688574_+	hypothetical protein	NA	NA	NA	NA	NA
AUL87145.1|4688776_4689130_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
AUL87146.1|4689267_4690914_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
AUL87147.1|4690957_4691251_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
AUL87148.1|4691526_4692783_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
AUL87149.1|4692798_4693275_-	suppressor of F exclusion of phage T7	NA	NA	NA	NA	NA
AUL87150.1|4693611_4695048_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
AUL87151.1|4695165_4696467_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
AUL87152.1|4696582_4696921_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
AUL87153.1|4696896_4698594_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
AUL87154.1|4698630_4699206_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL87155.1|4700453_4701667_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
AUL87156.1|4702232_4703505_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	4.9e-175
>prophage 17
CP024056	Escherichia coli strain SMN197SH3 chromosome, complete genome	5267207	4825223	4876840	5267207	lysis,integrase,holin,terminase,transposase,tail	Enterobacteria_phage(31.25%)	59	4825210:4825269	4844232:4844997
4825210:4825269	attL	GGTAGTGCATCCAATTAGTAGAACATGTGTTTTTCGATAAACGCTCCGATCACTTTTTCG	NA	NA	NA	NA
AUL87268.1|4825223_4825918_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL87269.1|4826569_4826716_-|integrase	integrase	integrase	NA	NA	NA	NA
AUL87270.1|4826674_4826956_+	hypothetical protein	NA	NA	NA	NA	NA
AUL87271.1|4827054_4827591_-	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
AUL87272.1|4827845_4830668_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
AUL87273.1|4830702_4831059_-	hypothetical protein	NA	NA	NA	NA	NA
AUL87274.1|4831062_4831479_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
AUL87275.1|4831589_4832303_-	acid phosphatase AphA	NA	NA	NA	NA	NA
AUL87276.1|4833428_4834622_-	aromatic amino acid transaminase	NA	NA	NA	NA	NA
AUL87277.1|4834874_4835954_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	4.0e-29
AUL87278.1|4836006_4837422_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
AUL87279.1|4837504_4838488_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AUL87280.1|4840832_4843547_+	DUF4765 domain-containing protein	NA	A0A0N7KZG3	Stx2-converting_phage	100.0	0.0e+00
AUL87281.1|4843582_4844276_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AUL87282.1|4844276_4844993_+	DUF4765 domain-containing protein	NA	A0A0N7KZG3	Stx2-converting_phage	100.0	6.6e-129
AUL87283.1|4845170_4845500_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	61.5	1.7e-31
4844232:4844997	attR	CGAAAAAGTGATCGGAGCGTTTATCGAAAAACACATGTTCTACTAATTGGATGCACTACCGAATTAACAAAAGAATCAAACTCTAACATTTACTCAGGTACATTTACCGATAACGGTAAAAATTCATTAGTAAAGTTTTATAAAGACTCTGATGGTAACTTTTATCAAGCTGACGGATTAAAAGGAGGTGGACTTATTCGACATACGGATAAGCCATATTCAGAACTGAAAGAAGGCGATATAGGATATGATGAGGAGCTTCTCGATATTACTGATGACTCACCTGAGTTAGAGGAAACGTTGCCAGCGATATCAGAGGACTTATATCCTAGCGAAGAAGAAAATGTACAAAATATCTACAAAAAATTCAAAAACGGTGATCATGATGCAGGAATGACAGAGGTAACATTATGCCGAGGAACTATTGCCTCTCAGGCTGAAAACATTGTTTCTTATAGTACCGCAGGGGGAGCCGAGATTGCAAACCCAAATGTAAGTCCTGTTTCTGAAGATATTGCAAAACTGCAAATAAAAAGTGGTAGAATTGAACCAGAATACACAACAGATATTAGCGTTGCTGACCGATTTAGCCGTGGACATCACTTAGTTATCGTCAAAGCAAAAGTTAAATATCTTACAAGAGGCAGTATCAGTGAAAGTGGTTGGATCATTCCCAAAAATGCCCCCGTAGAACCAGTAGGATTAATTGACAGGACATTTGGCCAATCAGAAAACATACAGCAAGCGAATGCATCAAAATAATATA	NA	NA	NA	NA
AUL87284.1|4847186_4847456_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	98.9	1.9e-44
AUL87285.1|4847457_4848771_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	5.5e-81
AUL87286.1|4848835_4849435_-	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	2.0e-110
AUL87287.1|4849501_4852978_-|tail	phage tail protein	tail	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
AUL87288.1|4852982_4853246_-	hypothetical protein	NA	A0A0N7KZG0	Stx2-converting_phage	100.0	3.7e-45
AUL87289.1|4853242_4853806_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
AUL87290.1|4854093_4854459_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
AUL87291.1|4854500_4854728_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
AUL87292.1|4855090_4855558_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	96.1	1.8e-74
AUL87293.1|4855559_4855778_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	93.3	1.0e-16
AUL87294.1|4855855_4856389_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
AUL87295.1|4856439_4856784_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
AUL87296.1|4856788_4857004_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
AUL87297.1|4857442_4859293_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
AUL87298.1|4859706_4859973_-	hypothetical protein	NA	NA	NA	NA	NA
AUL87299.1|4860737_4861796_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	86.7	4.9e-181
AUL87300.1|4861946_4862150_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	1.8e-31
AUL87301.1|4862420_4862867_+	hypothetical protein	NA	NA	NA	NA	NA
AUL87302.1|4862951_4863317_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	81.8	7.9e-54
AUL87303.1|4863334_4864324_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
AUL87304.1|4864331_4865147_-	DNA-binding protein	NA	U5P4K5	Shigella_phage	99.6	2.9e-149
AUL87305.1|4865309_4865705_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	96.0	9.1e-64
AUL87306.1|4865701_4866355_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.5	3.3e-127
AUL87307.1|4866449_4867256_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.1	7.9e-123
AUL87879.1|4867252_4867477_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	94.6	8.5e-35
AUL87308.1|4867481_4868027_-	immunity protein	NA	Q8SBF3	Shigella_phage	98.9	4.0e-94
AUL87880.1|4867989_4868169_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	94.9	5.0e-30
AUL87309.1|4868315_4868867_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
AUL87310.1|4868910_4869111_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
AUL87311.1|4869201_4869876_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	99.1	8.6e-131
AUL87312.1|4869945_4870176_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	97.4	2.5e-13
AUL87313.1|4870277_4870472_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	100.0	1.0e-31
AUL87314.1|4870544_4870907_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AUL87315.1|4870971_4871796_+	DUF2303 domain-containing protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AUL87316.1|4871923_4872460_+	HD family hydrolase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
AUL87317.1|4872450_4872813_+	hypothetical protein	NA	S5MC15	Escherichia_phage	99.2	2.1e-67
AUL87318.1|4872809_4873013_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	5.2e-31
AUL87319.1|4873005_4873245_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	100.0	4.4e-37
AUL87320.1|4873241_4873796_+	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	99.5	4.1e-102
AUL87321.1|4873797_4873989_+	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	98.4	1.6e-26
AUL87322.1|4874998_4875571_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	100.0	2.4e-110
AUL87323.1|4875607_4875889_+	pyocin activator protein PrtN	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
AUL87324.1|4876306_4876840_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	99.4	5.3e-99
>prophage 1
CP024055	Escherichia coli strain SMN197SH3 plasmid pO177A3, complete sequence	88839	3623	68417	88839	transposase	Stx2-converting_phage(40.0%)	54	NA	NA
AUL82724.1|3623_5162_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	6.5e-299
AUL82725.1|5211_5559_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AUL82726.1|5555_5936_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
AUL82790.1|6169_6535_-	hypothetical protein	NA	NA	NA	NA	NA
AUL82727.1|6545_6737_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	41.3	3.5e-05
AUL82728.1|7041_10944_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	40.4	5.5e-238
AUL82729.1|11386_12925_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	6.5e-299
AUL82730.1|12974_13322_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AUL82731.1|13581_13962_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
AUL82732.1|13958_14306_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AUL82733.1|14355_15894_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	6.5e-299
AUL82734.1|16487_17486_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AUL82735.1|17559_19281_-	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
AUL82736.1|19370_20477_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AUL82737.1|20476_21298_-	carbohydrate transporter	NA	NA	NA	NA	NA
AUL82738.1|21564_21807_-	hypothetical protein	NA	NA	NA	NA	NA
AUL82739.1|22753_23967_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	8.4e-169
AUL82740.1|24601_25333_-	complement resistance protein TraT	NA	NA	NA	NA	NA
AUL82741.1|25346_25784_-	conjugal transfer protein TraS	NA	NA	NA	NA	NA
AUL82742.1|25855_27017_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
AUL82743.1|27031_29809_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AUL82744.1|29805_31179_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
AUL82745.1|31165_31591_-	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
AUL82746.1|31544_31919_-	conjugal transfer protein TrbJ	NA	NA	NA	NA	NA
AUL82747.1|31815_32361_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
AUL82748.1|32347_32632_-	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
AUL82749.1|32712_32934_+	toxin ArtA	NA	NA	NA	NA	NA
AUL82750.1|32989_33337_-	protein TrbA	NA	NA	NA	NA	NA
AUL82751.1|33352_34126_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
AUL82752.1|34088_34349_-	protein TrbE	NA	NA	NA	NA	NA
AUL82791.1|34372_35764_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
AUL82753.1|36174_36462_-	hypothetical protein	NA	NA	NA	NA	NA
AUL82754.1|36486_36645_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AUL82755.1|36702_37089_-	hypothetical protein	NA	NA	NA	NA	NA
AUL82756.1|37207_37399_-	hypothetical protein	NA	NA	NA	NA	NA
AUL82757.1|37395_37818_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AUL82792.1|37864_38167_-	antirestriction protein	NA	NA	NA	NA	NA
AUL82758.1|39733_39955_-	hypothetical protein	NA	NA	NA	NA	NA
AUL82759.1|39955_40639_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.9e-29
AUL82760.1|40715_41021_-	hypothetical protein	NA	NA	NA	NA	NA
AUL82793.1|41024_41927_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AUL82761.1|41964_42237_-	hypothetical protein	NA	NA	NA	NA	NA
AUL82762.1|42578_43550_-	protein SopB	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
AUL82763.1|43549_44716_-	protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
AUL82764.1|45365_46579_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	8.4e-169
AUL82765.1|47363_48341_+	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	59.2	3.9e-100
AUL82766.1|48625_49366_-	recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
AUL82767.1|49876_50161_-	hypothetical protein	NA	NA	NA	NA	NA
AUL82768.1|51261_51651_-	cytochrome b562 family protein	NA	NA	NA	NA	NA
AUL82769.1|51694_53905_-	Catalase-peroxidase 2	NA	NA	NA	NA	NA
AUL82770.1|54080_55293_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	8.4e-169
AUL82771.1|55296_55509_-	hypothetical protein	NA	NA	NA	NA	NA
AUL82772.1|58156_67102_+	toxin B	NA	NA	NA	NA	NA
AUL82773.1|67204_68417_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
