The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019071	Escherichia coli strain CRE1493 chromosome, complete genome	4877335	511206	519258	4877335	transposase	Enterobacteria_phage(33.33%)	11	NA	NA
AUL61914.1|511206_512697_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
AUL61915.1|512744_513434_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
AUL61916.1|513430_514306_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
AUL61917.1|514302_514767_+	hypothetical protein	NA	NA	NA	NA	NA
AUL61918.1|514826_515813_-	hypothetical protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.1e-73
AUL66020.1|515855_516107_-	hypothetical protein	NA	Q7Y2I5	Escherichia_phage	96.4	1.1e-38
AUL61919.1|516097_516580_+|transposase	transposase	transposase	Q6H9S3	Enterobacteria_phage	100.0	4.8e-75
AUL61920.1|516506_516758_-	hypothetical protein	NA	NA	NA	NA	NA
AUL61921.1|516792_517218_-	hypothetical protein	NA	NA	NA	NA	NA
AUL61922.1|517171_518695_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AUL61923.1|518769_519258_+|transposase	transposase	transposase	Q6H9S3	Enterobacteria_phage	98.1	1.0e-85
>prophage 2
CP019071	Escherichia coli strain CRE1493 chromosome, complete genome	4877335	1117220	1130403	4877335		Escherichia_phage(50.0%)	12	NA	NA
AUL62493.1|1117220_1117982_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
AUL62494.1|1117975_1118602_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AUL62495.1|1118741_1119881_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AUL62496.1|1119943_1120936_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AUL62497.1|1121029_1122394_-	permease	NA	NA	NA	NA	NA
AUL62498.1|1122482_1123259_-	hypothetical protein	NA	NA	NA	NA	NA
AUL62499.1|1123263_1123902_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AUL62500.1|1123898_1125161_-	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
AUL62501.1|1125157_1126066_-	oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
AUL62502.1|1126261_1127029_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AUL62503.1|1127079_1127736_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
AUL62504.1|1127841_1130403_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 3
CP019071	Escherichia coli strain CRE1493 chromosome, complete genome	4877335	1731760	1741201	4877335		Enterobacteria_phage(85.71%)	10	NA	NA
AUL63051.1|1731760_1732687_+	ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
AUL63052.1|1732691_1733423_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AUL63053.1|1733403_1733511_-	hypothetical protein	NA	NA	NA	NA	NA
AUL63054.1|1733570_1734302_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AUL63055.1|1734523_1736209_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AUL63056.1|1736205_1736925_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL63057.1|1736971_1737442_+	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
AUL63058.1|1737481_1737943_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AUL63059.1|1738067_1740068_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
AUL63060.1|1740064_1741201_-	hypothetical protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 4
CP019071	Escherichia coli strain CRE1493 chromosome, complete genome	4877335	1825997	1887264	4877335	transposase	Enterobacteria_phage(14.29%)	69	NA	NA
AUL63123.1|1825997_1826672_+	hypothetical protein	NA	A0A1V0E6Q2	Klebsiella_phage	25.2	6.4e-09
AUL63124.1|1826707_1828036_+	hypothetical protein	NA	NA	NA	NA	NA
AUL66071.1|1828115_1828508_+	transferase	NA	A0A191KBJ5	Streptococcus_virus	41.1	6.8e-11
AUL63125.1|1828679_1830086_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
AUL63126.1|1830310_1831375_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	4.4e-105
AUL63127.1|1831401_1832271_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	9.8e-111
AUL63128.1|1832302_1833193_+	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	33.2	3.7e-28
AUL63129.1|1833207_1833762_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.8	1.0e-52
AUL63130.1|1833942_1835109_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
AUL63131.1|1835301_1836309_+	protein CapI	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
AUL63132.1|1836884_1837094_-	hypothetical protein	NA	NA	NA	NA	NA
AUL63133.1|1837231_1837507_+|transposase	transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
AUL63134.1|1837425_1837929_+|transposase	transposase	transposase	U5P0U6	Shigella_phage	99.4	1.7e-94
AUL63135.1|1838882_1840160_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL63136.1|1840162_1843804_+	mannosyltransferase	NA	A0A218MKE2	uncultured_virus	29.6	1.5e-22
AUL66072.1|1843867_1845013_+	mannosyltransferase	NA	NA	NA	NA	NA
AUL63137.1|1845022_1846138_+	glycosyl transferase family 1	NA	NA	NA	NA	NA
AUL63138.1|1846176_1846785_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
AUL63139.1|1846778_1847555_-	imidazole glycerol phosphate synthase cyclase subunit	NA	NA	NA	NA	NA
AUL63140.1|1847536_1848274_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
AUL63141.1|1848273_1848864_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
AUL63142.1|1848863_1849931_-	bifunctional imidazole glycerol-phosphate dehydratase/histidinol phosphatase	NA	NA	NA	NA	NA
AUL63143.1|1849930_1851001_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AUL63144.1|1850997_1852302_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
AUL63145.1|1852307_1853207_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
AUL66073.1|1853352_1853403_-	his operon leader peptide	NA	NA	NA	NA	NA
AUL63146.1|1853686_1853938_+	antitoxin YefM	NA	NA	NA	NA	NA
AUL63147.1|1853934_1854189_+	toxin YoeB	NA	NA	NA	NA	NA
AUL63148.1|1854271_1855096_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL63149.1|1855141_1856071_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL63150.1|1856337_1857696_+	low-affinity putrescine importer PlaP	NA	NA	NA	NA	NA
AUL63151.1|1857874_1858933_+	hypothetical protein	NA	NA	NA	NA	NA
AUL63152.1|1858946_1859174_+	hypothetical protein	NA	NA	NA	NA	NA
AUL63153.1|1859216_1860644_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AUL63154.1|1860852_1862019_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	98.5	3.6e-225
AUL63155.1|1862137_1862611_+	DNA gyrase inhibitor	NA	NA	NA	NA	NA
AUL63156.1|1862808_1863867_+	FUSC family protein	NA	NA	NA	NA	NA
AUL63157.1|1863972_1864368_+	hypothetical protein	NA	NA	NA	NA	NA
AUL66074.1|1864468_1864723_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66075.1|1865104_1865434_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66076.1|1866291_1866405_-	hypothetical protein	NA	NA	NA	NA	NA
AUL63158.1|1866417_1866621_-	hypothetical protein	NA	NA	NA	NA	NA
AUL63159.1|1866617_1866995_-	toxin	NA	NA	NA	NA	NA
AUL63160.1|1867084_1867453_-	antitoxin	NA	NA	NA	NA	NA
AUL63161.1|1867502_1867616_-	hypothetical protein	NA	NA	NA	NA	NA
AUL63162.1|1867615_1867837_-	hypothetical protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AUL63163.1|1867899_1868376_-	hypothetical protein	NA	NA	NA	NA	NA
AUL63164.1|1868391_1868865_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
AUL63165.1|1869206_1870025_-	hypothetical protein	NA	A0A2C9CX26	Yersinia_phage	40.1	4.2e-47
AUL63166.1|1870045_1870180_-	cytoplasmic protein	NA	NA	NA	NA	NA
AUL63167.1|1870179_1870338_-	hypothetical protein	NA	NA	NA	NA	NA
AUL63168.1|1873418_1874960_+|transposase	transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
AUL63169.1|1874974_1875721_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AUL63170.1|1876212_1877085_-	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
AUL63171.1|1877169_1878087_-	hypothetical protein	NA	NA	NA	NA	NA
AUL63172.1|1878219_1878435_+	hypothetical protein	NA	NA	NA	NA	NA
AUL63173.1|1878918_1879116_-	hypothetical protein	NA	NA	NA	NA	NA
AUL63174.1|1879286_1879895_-	hypothetical protein	NA	NA	NA	NA	NA
AUL63175.1|1879983_1880190_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUL66077.1|1880230_1880389_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL63176.1|1880330_1880597_+	hypothetical protein	NA	NA	NA	NA	NA
AUL63177.1|1880897_1881074_+	hemolysin activation protein	NA	NA	NA	NA	NA
AUL63178.1|1881419_1881620_-	hypothetical protein	NA	NA	NA	NA	NA
AUL63179.1|1881818_1882388_+	hypothetical protein	NA	NA	NA	NA	NA
AUL63180.1|1882553_1882946_+	hypothetical protein	NA	NA	NA	NA	NA
AUL63181.1|1884108_1884513_+	hypothetical protein	NA	NA	NA	NA	NA
AUL63182.1|1884803_1885142_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL63183.1|1885799_1886951_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AUL63184.1|1886907_1887264_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	92.5	4.4e-33
>prophage 5
CP019071	Escherichia coli strain CRE1493 chromosome, complete genome	4877335	2761398	2817440	4877335	integrase,head,tRNA,holin,tail,portal,terminase,capsid,transposase	Escherichia_phage(45.28%)	75	2769590:2769604	2817542:2817556
AUL64002.1|2761398_2762505_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUL66122.1|2762540_2763182_+	lysogenization protein HflD	NA	NA	NA	NA	NA
AUL64003.1|2763185_2764556_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
AUL64004.1|2764724_2765396_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AUL64005.1|2765395_2766856_+	sensor protein PhoQ	NA	NA	NA	NA	NA
AUL64006.1|2766931_2768053_+	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AUL64007.1|2768101_2769328_-	peptidase T	NA	NA	NA	NA	NA
AUL64008.1|2769383_2769599_+	hypothetical protein	NA	NA	NA	NA	NA
AUL64009.1|2769577_2770714_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2769590:2769604	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
AUL64010.1|2770697_2771561_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AUL64011.1|2771793_2772015_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	78.3	1.9e-18
AUL64012.1|2772127_2772784_+	methyltransferase	NA	NA	NA	NA	NA
AUL64013.1|2772728_2772866_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AUL64014.1|2772838_2772967_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	85.7	5.2e-13
AUL64015.1|2773021_2773552_-	chaperone of endosialidase	NA	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
AUL66123.1|2773634_2773886_-	hypothetical protein	NA	Q7Y2I5	Escherichia_phage	96.4	1.1e-38
AUL64016.1|2773876_2774359_+|transposase	transposase	transposase	Q6H9S3	Enterobacteria_phage	100.0	4.8e-75
AUL64017.1|2774285_2774537_-	hypothetical protein	NA	NA	NA	NA	NA
AUL64018.1|2774571_2774997_-	hypothetical protein	NA	NA	NA	NA	NA
AUL64019.1|2774950_2776474_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AUL64020.1|2777002_2777083_+|transposase	transposase	transposase	A0A0N7BTS3	Escherichia_phage	96.2	4.5e-07
AUL64021.1|2780427_2781027_-	enterobacterial Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
AUL64022.1|2781094_2784574_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
AUL64023.1|2784634_2785282_-|tail	phage tail protein	tail	A5LH42	Enterobacteria_phage	94.4	2.6e-108
AUL64024.1|2785179_2785923_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
AUL64025.1|2785928_2786627_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
AUL64026.1|2786626_2786968_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.4	1.2e-40
AUL64027.1|2786960_2790188_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
AUL64028.1|2790234_2790513_-|tail	phage tail protein	tail	A0A1B5FP87	Escherichia_phage	95.7	5.3e-42
AUL64029.1|2790536_2790908_-|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
AUL64030.1|2790922_2791627_-|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
AUL64031.1|2791687_2792032_-	hypothetical protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
AUL64032.1|2792028_2792478_-	hypothetical protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
AUL64033.1|2792474_2792813_-|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
AUL64034.1|2792821_2793139_-	hypothetical protein	NA	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
AUL64035.1|2793215_2794433_-|capsid	phage capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
AUL64036.1|2795038_2796265_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
AUL64037.1|2796412_2798170_-|terminase	terminase	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
AUL64038.1|2798169_2798652_-|terminase	terminase	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
AUL64039.1|2798799_2799150_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
AUL64040.1|2799442_2799583_-	Rz1 lytic protein	NA	U5P461	Shigella_phage	84.6	1.0e-09
AUL64041.1|2799675_2799969_+	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
AUL64042.1|2800059_2800242_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
AUL64043.1|2800294_2800522_+	hypothetical protein	NA	NA	NA	NA	NA
AUL64044.1|2800458_2800992_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
AUL64045.1|2801055_2801406_-	hypothetical protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
AUL64046.1|2801410_2801626_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
AUL64047.1|2801775_2801937_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
AUL64048.1|2801933_2802137_-	hypothetical protein	NA	H6WZJ9	Escherichia_phage	95.2	7.7e-27
AUL64049.1|2802382_2802718_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
AUL64050.1|2802788_2803001_+	hypothetical protein	NA	NA	NA	NA	NA
AUL64051.1|2803489_2803606_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	93.5	3.6e-05
AUL64052.1|2803970_2804792_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
AUL64053.1|2804788_2805169_-	hypothetical protein	NA	V5URS4	Shigella_phage	63.6	1.3e-35
AUL64054.1|2805169_2806228_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
AUL64055.1|2806229_2806508_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
AUL64056.1|2806675_2806888_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
AUL64057.1|2806972_2807116_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	64.7	5.8e-05
AUL64058.1|2807090_2807309_-	hypothetical protein	NA	NA	NA	NA	NA
AUL64059.1|2807922_2808105_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
AUL64060.1|2808198_2808612_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	2.0e-58
AUL64061.1|2808612_2809035_-	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
AUL64062.1|2809075_2810146_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
AUL64063.1|2810217_2810643_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUL64064.1|2810626_2810869_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
AUL66124.1|2811074_2811599_+	LexA family transcriptional repressor	NA	H9C160	Pectobacterium_phage	28.0	2.2e-12
AUL64065.1|2811810_2811969_+	hypothetical protein	NA	NA	NA	NA	NA
AUL64066.1|2811952_2812252_+	hypothetical protein	NA	NA	NA	NA	NA
AUL64067.1|2812323_2812542_+	hypothetical protein	NA	NA	NA	NA	NA
AUL64068.1|2812506_2812761_-	hypothetical protein	NA	NA	NA	NA	NA
AUL64069.1|2813110_2813299_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AUL64070.1|2813295_2813487_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUL64071.1|2813580_2816022_+	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
AUL64072.1|2816083_2816353_+	excisionase	NA	NA	NA	NA	NA
AUL64073.1|2816321_2817440_+|integrase	integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
2817542:2817556	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 6
CP019071	Escherichia coli strain CRE1493 chromosome, complete genome	4877335	3363258	3396479	4877335	transposase	Escherichia_phage(33.33%)	32	NA	NA
AUL64591.1|3363258_3363534_+|transposase	transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AUL64592.1|3363452_3363956_+|transposase	transposase	transposase	Q71TF0	Escherichia_phage	97.0	2.0e-92
AUL64593.1|3364013_3365108_+	phosphoadenosine phosphosulfate reductase	NA	L0P6Z6	Lactobacillus_phage	31.6	2.5e-47
AUL64594.1|3365080_3365710_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
AUL64595.1|3365710_3366871_-	methionine aminotransferase	NA	NA	NA	NA	NA
AUL64596.1|3366979_3368068_+	oxidoreductase	NA	NA	NA	NA	NA
AUL64597.1|3368077_3368275_-	hypothetical protein	NA	NA	NA	NA	NA
AUL64598.1|3368457_3370563_-	carbon starvation protein A	NA	NA	NA	NA	NA
AUL64599.1|3370743_3371157_-	proofreading thioesterase EntH	NA	NA	NA	NA	NA
AUL64600.1|3371159_3371906_-	2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase	NA	NA	NA	NA	NA
AUL64601.1|3371905_3372763_-	isochorismatase	NA	NA	NA	NA	NA
AUL64602.1|3372776_3374387_-	2,3-dihydroxybenzoate-AMP ligase	NA	NA	NA	NA	NA
AUL64603.1|3374396_3375572_-	isochorismate synthase EntC	NA	NA	NA	NA	NA
AUL64604.1|3375736_3375943_+	hypothetical protein	NA	NA	NA	NA	NA
AUL64605.1|3375946_3376903_+	ferrienterobactin-binding periplasmic protein	NA	NA	NA	NA	NA
AUL64606.1|3376906_3378157_-	enterobactin exporter EntS	NA	NA	NA	NA	NA
AUL64607.1|3378267_3379272_+	ferric anguibactin ABC transporter permease	NA	NA	NA	NA	NA
AUL64608.1|3379268_3380261_+	ferric anguibactin ABC transporter permease	NA	NA	NA	NA	NA
AUL64609.1|3380257_3381073_+	ferric enterobactin transport ATP-binding protein FepC	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
AUL64610.1|3381069_3382203_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
AUL64611.1|3382418_3386300_-	enterobactin synthase component F	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
AUL64612.1|3386296_3386515_-	enterobactin biosynthesis protein YbdZ	NA	NA	NA	NA	NA
AUL64613.1|3386517_3387720_-	enterochelin esterase	NA	NA	NA	NA	NA
AUL64614.1|3387962_3390203_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUL66140.1|3390377_3390998_+	enterobactin synthase component D	NA	NA	NA	NA	NA
AUL64615.1|3391116_3391257_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL64616.1|3391279_3392392_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUL64617.1|3392468_3392621_-	protein HokE	NA	NA	NA	NA	NA
AUL64618.1|3392718_3393570_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	7.8e-113
AUL64619.1|3393566_3394088_-	DNA-binding protein	NA	A0A2I6AZV8	Macacine_betaherpesvirus	100.0	2.7e-92
AUL64620.1|3394518_3395637_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AUL64621.1|3395774_3396479_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 7
CP019071	Escherichia coli strain CRE1493 chromosome, complete genome	4877335	3720093	3793930	4877335	integrase,head,plate,holin,tail,portal,terminase,capsid,transposase	Shigella_phage(53.45%)	94	3750124:3750172	3790026:3790074
AUL64920.1|3720093_3720306_-|transposase	transposase	transposase	U5N3F9	Enterobacteria_phage	86.2	6.0e-06
AUL64921.1|3720597_3720813_-	hypothetical protein	NA	NA	NA	NA	NA
AUL64922.1|3721287_3721896_-	hypothetical protein	NA	NA	NA	NA	NA
AUL64923.1|3721983_3722190_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AUL64924.1|3722161_3722359_-	hypothetical protein	NA	NA	NA	NA	NA
AUL64925.1|3722574_3723366_-	hypothetical protein	NA	NA	NA	NA	NA
AUL64926.1|3723960_3724152_+	hypothetical protein	NA	NA	NA	NA	NA
AUL66154.1|3724238_3724361_+	hemolysin expression modulating protein	NA	NA	NA	NA	NA
AUL64927.1|3724447_3724588_+	hemolysin activation protein	NA	NA	NA	NA	NA
AUL64928.1|3724819_3725419_+	hypothetical protein	NA	NA	NA	NA	NA
AUL64929.1|3725498_3725720_-	hypothetical protein	NA	NA	NA	NA	NA
AUL64930.1|3725790_3726174_+	hypothetical protein	NA	NA	NA	NA	NA
AUL64931.1|3726170_3726596_+	hypothetical protein	NA	NA	NA	NA	NA
AUL64932.1|3726818_3727046_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66155.1|3727397_3727649_-	hypothetical protein	NA	Q7Y2I5	Escherichia_phage	96.4	1.1e-38
AUL64933.1|3727639_3728122_+|transposase	transposase	transposase	Q6H9S3	Enterobacteria_phage	100.0	4.8e-75
AUL64934.1|3728048_3728300_-	hypothetical protein	NA	NA	NA	NA	NA
AUL64935.1|3728334_3728760_-	hypothetical protein	NA	NA	NA	NA	NA
AUL64936.1|3728713_3730237_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AUL64937.1|3730311_3730800_+|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	95.6	2.0e-84
AUL64938.1|3731402_3731753_-	polyketide synthase	NA	NA	NA	NA	NA
AUL64939.1|3731765_3733358_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
AUL66156.1|3733457_3734414_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
AUL64940.1|3734663_3736217_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	1.9e-19
AUL64941.1|3736210_3737257_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
AUL64942.1|3737256_3738255_+	histidine kinase	NA	NA	NA	NA	NA
AUL64943.1|3738281_3739304_+	autoinducer 2 ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL64944.1|3739332_3740208_+	autoinducer 2 aldolase	NA	NA	NA	NA	NA
AUL64945.1|3740256_3740547_+	autoinducer-2 (AI-2) modifying protein LsrG	NA	NA	NA	NA	NA
AUL64946.1|3740557_3741301_+	epimerase	NA	NA	NA	NA	NA
AUL66157.1|3741675_3741933_+	hypothetical protein	NA	NA	NA	NA	NA
AUL64947.1|3744557_3745628_-	hypothetical protein	NA	NA	NA	NA	NA
AUL64948.1|3745605_3747312_-	hypothetical protein	NA	NA	NA	NA	NA
AUL64949.1|3747304_3748513_-	DNA methylase	NA	NA	NA	NA	NA
AUL64950.1|3748754_3749963_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.7e-130
3750124:3750172	attL	AAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AUL64951.1|3750667_3751648_-	hypothetical protein	NA	NA	NA	NA	NA
AUL64952.1|3752406_3753621_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	6.1e-34
AUL64953.1|3753655_3755131_-	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	49.7	7.2e-106
AUL64954.1|3755492_3756266_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.0	3.2e-36
AUL64955.1|3756326_3756881_-	DNA-invertase	NA	A0A1S6L009	Salmonella_phage	88.4	2.2e-87
AUL64956.1|3756910_3757417_+	hypothetical protein	NA	NA	NA	NA	NA
AUL64957.1|3757419_3757830_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.3	2.2e-20
AUL64958.1|3757810_3758044_-	hypothetical protein	NA	NA	NA	NA	NA
AUL64959.1|3758775_3759360_-	hypothetical protein	NA	O22003	Shigella_phage	100.0	1.1e-113
AUL64960.1|3759350_3760409_-|plate	phage baseplate protein	plate	U5P424	Shigella_phage	98.9	2.5e-201
AUL64961.1|3760395_3760824_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	6.8e-81
AUL64962.1|3760820_3761369_-|plate	baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	6.6e-97
AUL64963.1|3761368_3762448_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	98.9	6.5e-205
AUL64964.1|3762444_3763821_-	DNA circularization protein	NA	U5P4I0	Shigella_phage	98.7	4.8e-253
AUL64965.1|3763845_3765753_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	99.1	0.0e+00
AUL64966.1|3765837_3766161_-|tail	phage tail protein	tail	U5P0R5	Shigella_phage	99.1	1.1e-51
AUL64967.1|3766157_3766514_-|tail	phage tail protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
AUL64968.1|3766513_3768010_-|tail	phage tail protein	tail	U5P0H3	Shigella_phage	99.6	1.0e-277
AUL64969.1|3767993_3768164_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	1.2e-25
AUL64970.1|3768172_3768733_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	1.2e-104
AUL64971.1|3768729_3769236_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.3	5.0e-83
AUL64972.1|3769210_3769621_-|head,tail	phage head-tail adapter protein	head,tail	M1FJ87	Enterobacteria_phage	94.1	3.9e-70
AUL64973.1|3769617_3769941_-	hypothetical protein	NA	U5P072	Shigella_phage	99.1	1.1e-56
AUL64974.1|3769943_3770144_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	6.5e-26
AUL64975.1|3770192_3771398_-|capsid	capsid protein	capsid	U5P0G9	Shigella_phage	100.0	8.2e-225
AUL64976.1|3771412_3772063_-	primosome assembly protein PriA	NA	U5P4H2	Shigella_phage	100.0	2.5e-119
AUL64977.1|3772040_3773282_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	7.6e-242
AUL64978.1|3773281_3773464_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
AUL64979.1|3773475_3775209_-|terminase	terminase	terminase	U5P0Q5	Shigella_phage	98.6	0.0e+00
AUL64980.1|3775205_3775700_-|terminase	terminase	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
AUL64981.1|3775825_3776176_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	3.1e-63
AUL64982.1|3776303_3776738_-	hypothetical protein	NA	NA	NA	NA	NA
AUL64983.1|3777263_3777656_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	86.2	1.4e-53
AUL64984.1|3777639_3778116_-	lysozyme	NA	U5P0A9	Shigella_phage	98.7	6.4e-88
AUL64985.1|3778119_3778446_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
AUL64986.1|3778725_3779547_+	hypothetical protein	NA	NA	NA	NA	NA
AUL64987.1|3779570_3780056_+	hypothetical protein	NA	NA	NA	NA	NA
AUL64988.1|3780077_3780425_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	87.6	4.7e-56
AUL64989.1|3780442_3781438_-	hypothetical protein	NA	U5P0K4	Shigella_phage	97.9	5.3e-193
AUL64990.1|3781439_3782249_-	DNA-binding protein	NA	Q8SBE6	Shigella_phage	98.1	2.4e-151
AUL64991.1|3782268_3782658_-	hypothetical protein	NA	K7PH72	Enterobacteria_phage	96.9	1.9e-66
AUL64992.1|3782654_3782981_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
AUL64993.1|3782980_3783475_-	hypothetical protein	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	1.1e-85
AUL64994.1|3783471_3784413_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	6.4e-140
AUL64995.1|3784402_3784582_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AUL66158.1|3784757_3785309_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
AUL64996.1|3785346_3785547_-	cell division protein	NA	NA	NA	NA	NA
AUL64997.1|3785644_3786271_+	LexA family transcriptional repressor	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
AUL64998.1|3786456_3786753_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
AUL64999.1|3786670_3786916_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66159.1|3787056_3787266_-	hypothetical protein	NA	A5LH65	Enterobacteria_phage	61.7	2.1e-11
AUL65000.1|3787429_3787966_+	hypothetical protein	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
AUL65001.1|3787956_3788319_+	hypothetical protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
AUL65002.1|3788318_3788624_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
AUL65003.1|3788623_3788974_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
AUL65004.1|3788850_3790014_+|integrase	integrase	integrase	U5P434	Shigella_phage	99.7	5.3e-229
AUL65005.1|3790218_3791472_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3790026:3790074	attR	AAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AUL65006.1|3791483_3792587_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AUL65007.1|3792874_3793930_+	outer membrane pore protein E	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
>prophage 8
CP019071	Escherichia coli strain CRE1493 chromosome, complete genome	4877335	4139632	4222038	4877335	integrase,tRNA,holin,transposase	Escherichia_phage(19.35%)	90	4202552:4202566	4216023:4216037
AUL65316.1|4139632_4139857_-|transposase	transposase	transposase	A0A2L1IV22	Escherichia_phage	97.3	1.2e-36
AUL65317.1|4139788_4140061_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL65318.1|4140222_4141455_+	MFS transporter	NA	NA	NA	NA	NA
AUL65319.1|4141495_4142776_+	hypothetical protein	NA	NA	NA	NA	NA
AUL65320.1|4142891_4144043_+	hypothetical protein	NA	NA	NA	NA	NA
AUL65321.1|4144052_4144820_+	hypothetical protein	NA	NA	NA	NA	NA
AUL65322.1|4144816_4145074_+	hypothetical protein	NA	NA	NA	NA	NA
AUL65323.1|4145138_4145999_+	hypothetical protein	NA	NA	NA	NA	NA
AUL65324.1|4146066_4147245_+	MFS transporter	NA	NA	NA	NA	NA
AUL65325.1|4147257_4147812_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
AUL65326.1|4148060_4148744_+	hypothetical protein	NA	NA	NA	NA	NA
AUL65327.1|4148740_4149202_+	hypothetical protein	NA	NA	NA	NA	NA
AUL65328.1|4149214_4150387_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
AUL65329.1|4150451_4151363_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL65330.1|4151355_4151748_-	anti-adapter protein IraD	NA	NA	NA	NA	NA
AUL65331.1|4153346_4154120_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL65332.1|4154333_4155794_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.4	1.4e-48
AUL65333.1|4155874_4157059_-	mannonate dehydratase	NA	NA	NA	NA	NA
AUL66174.1|4157010_4157241_-	hypothetical protein	NA	NA	NA	NA	NA
AUL65334.1|4157398_4158742_+	gluconate transporter	NA	NA	NA	NA	NA
AUL65335.1|4158915_4159080_-	fimH domain protein	NA	NA	NA	NA	NA
AUL65336.1|4159140_4159416_+|transposase	transposase	transposase	Q71TE9	Escherichia_phage	97.8	1.7e-45
AUL65337.1|4159334_4159838_+|transposase	transposase	transposase	U5P0U6	Shigella_phage	98.8	8.2e-94
AUL65338.1|4159847_4160168_+	hypothetical protein	NA	NA	NA	NA	NA
AUL65339.1|4161043_4161760_+	N-acetylneuraminic acid outer membrane channel protein NanC	NA	NA	NA	NA	NA
AUL65340.1|4161779_4162886_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
AUL65341.1|4162950_4163931_+	sialate O-acetylesterase	NA	H6WZJ9	Escherichia_phage	56.3	1.6e-101
AUL65342.1|4163938_4164061_-	HNH endonuclease	NA	NA	NA	NA	NA
AUL66175.1|4165106_4165487_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
AUL65343.1|4165483_4165831_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	99.1	6.3e-61
AUL65344.1|4165880_4167266_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	1.9e-257
AUL65345.1|4167504_4168863_-	esterase-like activity of phytase	NA	NA	NA	NA	NA
AUL65346.1|4169241_4169451_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.9e-06
AUL65347.1|4169613_4169871_-	biofilm development YmgB/AriR family protein	NA	NA	NA	NA	NA
AUL65348.1|4171210_4171411_+	hypothetical protein	NA	NA	NA	NA	NA
AUL65349.1|4171621_4172143_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AUL65350.1|4172139_4173093_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL65351.1|4173179_4175504_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUL65352.1|4175548_4176451_+	iron-dicitrate transporter substrate-binding subunit	NA	NA	NA	NA	NA
AUL65353.1|4176447_4177446_+	iron-dicitrate transporter permease subunit	NA	NA	NA	NA	NA
AUL65354.1|4177442_4178399_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AUL65355.1|4178399_4179167_+	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AUL65356.1|4179724_4180138_-	hypothetical protein	NA	NA	NA	NA	NA
AUL65357.1|4180632_4182156_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AUL65358.1|4182109_4182535_+	hypothetical protein	NA	NA	NA	NA	NA
AUL65359.1|4182569_4182821_+	hypothetical protein	NA	NA	NA	NA	NA
AUL65360.1|4182747_4183230_-|transposase	transposase	transposase	Q6H9S3	Enterobacteria_phage	100.0	4.8e-75
AUL65361.1|4183220_4183472_+	hypothetical protein	NA	Q7Y2I5	Escherichia_phage	96.4	1.1e-38
AUL65362.1|4183514_4183625_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL65363.1|4183631_4184021_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.2	1.9e-61
AUL65364.1|4184071_4184290_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL65365.1|4184356_4184656_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL65366.1|4184652_4185519_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	1.1e-50
AUL65367.1|4185798_4187076_-	hypothetical protein	NA	NA	NA	NA	NA
AUL65368.1|4187035_4187194_-|holin	choline transporter	holin	NA	NA	NA	NA
AUL65369.1|4187138_4189142_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AUL65370.1|4189289_4190429_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
AUL65371.1|4190609_4191554_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AUL65372.1|4191618_4192569_-	VirG localization protein VirK	NA	NA	NA	NA	NA
AUL65373.1|4192573_4193662_-	glycosyl transferase	NA	NA	NA	NA	NA
AUL65374.1|4193664_4194456_-	carbohydrate transporter	NA	NA	NA	NA	NA
AUL65375.1|4194692_4194995_+	hypothetical protein	NA	Q716C1	Shigella_phage	96.5	1.2e-36
AUL65376.1|4195050_4195476_+|transposase	transposase	transposase	S5FNT8	Shigella_phage	96.7	1.0e-65
AUL65377.1|4195688_4196114_-	hypothetical protein	NA	NA	NA	NA	NA
AUL65378.1|4196067_4197591_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AUL65379.1|4197665_4198154_+|transposase	transposase	transposase	Q6H9S3	Enterobacteria_phage	98.1	1.0e-85
AUL65380.1|4199311_4199497_-	hypothetical protein	NA	NA	NA	NA	NA
AUL65381.1|4199752_4200685_-	RNA-dependent DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	29.4	1.8e-25
AUL65382.1|4200686_4201655_-	hypothetical protein	NA	NA	NA	NA	NA
AUL65383.1|4202300_4202573_-	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	44.9	6.3e-08
4202552:4202566	attL	ATTCCGGACATTTAA	NA	NA	NA	NA
AUL65384.1|4202578_4203130_-	phage polarity suppression protein	NA	NA	NA	NA	NA
AUL65385.1|4203126_4203870_-	septation initiation protein	NA	NA	NA	NA	NA
AUL65386.1|4203941_4204274_+	hypothetical protein	NA	NA	NA	NA	NA
AUL65387.1|4204270_4206943_-	alkaline-shock protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	4.1e-59
AUL65388.1|4206939_4207323_-	hypothetical protein	NA	NA	NA	NA	NA
AUL65389.1|4207319_4207604_-	hypothetical protein	NA	NA	NA	NA	NA
AUL65390.1|4207635_4207995_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66176.1|4207987_4208572_-	hypothetical protein	NA	NA	NA	NA	NA
AUL65391.1|4208633_4208864_-	dipicolinate synthase	NA	NA	NA	NA	NA
AUL65392.1|4209240_4209879_-	hypothetical protein	NA	NA	NA	NA	NA
AUL65393.1|4209908_4211171_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	35.6	2.4e-65
AUL65394.1|4211615_4212635_+	aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
AUL65395.1|4212762_4214265_+	hypothetical protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	1.4e-83
AUL65396.1|4214218_4214443_+	hypothetical protein	NA	NA	NA	NA	NA
AUL65397.1|4214425_4215508_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AUL65398.1|4215507_4216608_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
4216023:4216037	attR	TTAAATGTCCGGAAT	NA	NA	NA	NA
AUL65399.1|4216874_4218386_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AUL65400.1|4218369_4218591_-	hypothetical protein	NA	NA	NA	NA	NA
AUL65401.1|4218739_4219183_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AUL65402.1|4219182_4222038_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
>prophage 9
CP019071	Escherichia coli strain CRE1493 chromosome, complete genome	4877335	4614986	4655096	4877335	integrase,head,plate,lysis,holin,tail,portal,terminase,capsid,transposase	Escherichia_phage(52.08%)	50	4611862:4611876	4655178:4655192
4611862:4611876	attL	TGTAGGCCTGATAAG	NA	NA	NA	NA
AUL65757.1|4614986_4615838_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	7.8e-113
AUL65758.1|4615834_4616356_-	DNA-binding protein	NA	A0A2I6AZV8	Macacine_betaherpesvirus	100.0	2.7e-92
AUL66191.1|4616428_4616647_-	transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
AUL65759.1|4616728_4617892_-	hypothetical protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
AUL65760.1|4617891_4618371_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
AUL65761.1|4618385_4620833_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.2	0.0e+00
AUL66192.1|4620825_4620945_-|tail	phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AUL65762.1|4620977_4621253_-	hypothetical protein	NA	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
AUL65763.1|4621309_4621828_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AUL65764.1|4621840_4623031_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
AUL65765.1|4623090_4623693_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	95.3	3.5e-99
AUL65766.1|4623700_4625236_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
AUL65767.1|4625284_4625632_-|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AUL65768.1|4625628_4626033_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
AUL65769.1|4626174_4626690_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	56.8	5.0e-46
AUL66193.1|4626704_4627307_+|tail	phage tail protein	tail	M1SV83	Escherichia_phage	75.5	2.5e-81
AUL65770.1|4627278_4627695_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.0	3.4e-21
AUL65771.1|4628989_4629601_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.4e-116
AUL65772.1|4629593_4630502_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	3.7e-161
AUL65773.1|4630506_4630854_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
AUL65774.1|4630850_4631486_-|plate	baseplate assembly protein	plate	U5N3F0	Enterobacteria_phage	98.1	2.5e-111
AUL65775.1|4631552_4632005_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	4.5e-75
AUL65776.1|4631997_4632465_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	3.3e-81
AUL65777.1|4632427_4632601_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
AUL65778.1|4632572_4632998_-	protein lysB	NA	A0A0F7L9Y0	Escherichia_phage	94.3	1.3e-63
AUL65779.1|4632985_4633411_-	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	92.9	3.7e-55
AUL65780.1|4633425_4633923_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
AUL65781.1|4633922_4634204_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AUL65782.1|4634207_4634411_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	98.5	2.6e-30
AUL65783.1|4634410_4634920_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	4.3e-90
AUL65784.1|4635019_4635763_-|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	96.4	4.6e-125
AUL65785.1|4635766_4636840_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	98.9	2.2e-200
AUL65786.1|4636898_4637753_-|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.6	1.7e-136
AUL65787.1|4637926_4639699_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
AUL65788.1|4639698_4640733_+|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.1	1.6e-200
AUL65789.1|4640771_4640981_-	hypothetical protein	NA	M1TAP7	Escherichia_phage	83.0	2.7e-14
AUL65790.1|4641104_4643588_+	helicase	NA	NA	NA	NA	NA
AUL65791.1|4644905_4645652_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AUL65792.1|4645666_4647208_-|transposase	transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
AUL65793.1|4648682_4648958_-	hypothetical protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
AUL65794.1|4648954_4649179_-	hypothetical protein	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
AUL65795.1|4649178_4649481_-	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
AUL65796.1|4649480_4649705_-	hypothetical protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AUL66194.1|4649768_4650269_-	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AUL65797.1|4650438_4650711_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
AUL65798.1|4650847_4651141_+	transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
AUL65799.1|4651210_4652191_+|integrase	integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
AUL66195.1|4652377_4652878_-	periplasmic protein CpxP	NA	NA	NA	NA	NA
AUL65800.1|4653027_4653726_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AUL65801.1|4653722_4655096_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
4655178:4655192	attR	CTTATCAGGCCTACA	NA	NA	NA	NA
>prophage 1
CP019074	Escherichia coli strain CRE1493 plasmid p1493-3, complete sequence	73992	2581	46288	73992	integrase,transposase	Escherichia_phage(40.0%)	54	NA	NA
AUL66302.1|2581_3085_-|transposase	transposase	transposase	U5P0U6	Shigella_phage	93.4	2.1e-89
AUL66303.1|3159_3246_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL66304.1|3208_3319_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL66305.1|3329_3962_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.0	1.6e-123
AUL66306.1|3952_4141_+	hypothetical protein	NA	NA	NA	NA	NA
AUL66307.1|4228_5665_+	glutathione synthase	NA	NA	NA	NA	NA
AUL66308.1|6082_7087_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUL66309.1|7696_7885_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66310.1|8039_8309_+	hypothetical protein	NA	NA	NA	NA	NA
AUL66311.1|8305_8587_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AUL66312.1|8742_8952_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.9e-06
AUL66313.1|9114_9372_-	biofilm development YmgB/AriR family protein	NA	NA	NA	NA	NA
AUL66314.1|10010_10436_-	ester cyclase	NA	NA	NA	NA	NA
AUL66315.1|10444_11434_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL66316.1|11449_12226_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66317.1|12601_13105_-|transposase	transposase	transposase	U5P0U6	Shigella_phage	93.8	3.1e-85
AUL66318.1|13179_13380_+	hypothetical protein	NA	NA	NA	NA	NA
AUL66319.1|13794_14499_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AUL66320.1|14444_15239_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	100.0	9.2e-132
AUL66321.1|15342_16311_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	100.0	2.5e-187
AUL66322.1|16453_17314_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AUL66323.1|17326_17869_+	tunicamycin resistance protein	NA	NA	NA	NA	NA
AUL66324.1|18350_18542_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66325.1|18547_18793_+	hypothetical protein	NA	NA	NA	NA	NA
AUL66326.1|19296_20001_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AUL66327.1|20135_21149_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUL66380.1|21078_21297_+	hypothetical protein	NA	NA	NA	NA	NA
AUL66328.1|21293_21791_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AUL66381.1|21947_22193_+	hypothetical protein	NA	NA	NA	NA	NA
AUL66329.1|22198_22990_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AUL66330.1|23203_23320_+	hypothetical protein	NA	NA	NA	NA	NA
AUL66331.1|23474_23867_+	NimC/NimA family protein	NA	NA	NA	NA	NA
AUL66332.1|24186_24570_-	bleomycin resistance family protein	NA	NA	NA	NA	NA
AUL66333.1|24575_25280_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AUL66334.1|25599_26775_+	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
AUL66335.1|26798_29951_+	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
AUL66336.1|30020_30500_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL66337.1|30601_31306_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	4.5e-138
AUL66338.1|31416_31803_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66339.1|32650_34447_-|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
AUL66382.1|34405_34798_+	isochorismatase	NA	NA	NA	NA	NA
AUL66340.1|34935_35820_+	EamA family transporter	NA	NA	NA	NA	NA
AUL66383.1|35851_37069_-	TetA family tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
AUL66341.1|37129_37807_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL66342.1|37838_38081_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL66343.1|38003_38168_+	hypothetical protein	NA	NA	NA	NA	NA
AUL66344.1|38157_38460_+	hypothetical protein	NA	NA	NA	NA	NA
AUL66345.1|38689_38830_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL66346.1|38852_39965_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUL66347.1|40460_41465_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUL66348.1|41543_41978_-	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AUL66349.1|42049_42400_+	mercuric transporter	NA	NA	NA	NA	NA
AUL66350.1|42561_45567_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
AUL66351.1|45730_46288_+|transposase	transposase	transposase	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
>prophage 1
CP019075	Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence	96986	0	94954	96986	protease,tail,terminase,portal,holin,lysis,head,plate	Escherichia_phage(63.21%)	111	NA	NA
AUL66388.1|2290_2656_-	ddrA	NA	A0A1B0V846	Salmonella_phage	98.3	9.3e-47
AUL66389.1|4572_5175_-	odaE	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
AUL66390.1|5161_5605_-|lysis	lysis protein	lysis	A0A077SK09	Escherichia_phage	100.0	1.3e-82
AUL66391.1|5601_5931_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
AUL66392.1|6005_6269_-	hypothetical protein	NA	Q71TD9	Escherichia_phage	62.4	4.0e-23
AUL66393.1|6704_7277_-	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	85.6	1.5e-83
AUL66495.1|7307_7796_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	72.2	1.7e-59
AUL66394.1|7795_8398_+|tail	phage tail protein	tail	M1SV83	Escherichia_phage	86.0	9.8e-94
AUL66395.1|8369_8786_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	47.6	4.1e-22
AUL66396.1|12021_12456_-|tail	phage tail protein	tail	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
AUL66397.1|12534_13371_-|tail	phage tail protein	tail	A0A1B0V7F2	Salmonella_phage	98.2	8.4e-152
AUL66398.1|13370_14804_-	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	99.8	8.2e-272
AUL66399.1|14800_15157_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
AUL66496.1|15156_18504_-	transglycosylase	NA	A0A1B0VDM8	Salmonella_phage	92.0	0.0e+00
AUL66400.1|18933_19815_-	morphogenetic protein	NA	Q71TC9	Escherichia_phage	98.6	2.7e-172
AUL66401.1|19829_20441_-|tail	phage tail protein	tail	Q71TN8	Escherichia_phage	99.5	2.9e-109
AUL66402.1|20451_21018_-	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	99.5	1.1e-99
AUL66403.1|21248_22142_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	30.3	3.4e-26
AUL66404.1|22193_22670_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66405.1|22692_23043_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66406.1|23401_23521_+	hypothetical protein	NA	NA	NA	NA	NA
AUL66407.1|23539_23761_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	9.3e-26
AUL66408.1|23757_24849_+	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	79.8	7.1e-159
AUL66409.1|25013_25814_+	DNA-binding protein	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
AUL66410.1|25843_26689_+	Replication protein repL	NA	Q1MVK3	Enterobacteria_phage	97.5	1.8e-149
AUL66411.1|26953_28009_+	ATPase	NA	H2BD62	Pseudomonas_phage	70.8	9.0e-143
AUL66412.1|28078_28366_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66413.1|28655_29252_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	100.0	6.3e-109
AUL66414.1|29423_29933_-|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
AUL66415.1|29944_30526_-	hypothetical protein	NA	Q71TM4	Escherichia_phage	99.5	3.8e-103
AUL66416.1|30561_31377_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.9	9.8e-113
AUL66417.1|31386_32976_-	hypothetical protein	NA	Q71TB2	Escherichia_phage	98.5	1.9e-301
AUL66418.1|33036_34743_-	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	94.4	4.7e-311
AUL66419.1|34969_35971_-	chromosome partitioning protein ParB	NA	Q38420	Escherichia_phage	99.7	4.8e-178
AUL66420.1|35987_37184_-	chromosome partitioning protein ParA	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
AUL66421.1|37741_38602_-	replication protein RepA	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
AUL66422.1|38928_39330_-	hypothetical protein	NA	Q71TL7	Escherichia_phage	54.0	5.5e-32
AUL66423.1|39400_39760_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	69.1	4.6e-38
AUL66424.1|39937_40360_-	ppfA	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
AUL66425.1|40399_41188_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	96.9	1.7e-117
AUL66426.1|41196_41481_-	alanine racemase	NA	Q71TL3	Escherichia_phage	98.9	3.8e-48
AUL66427.1|41649_41934_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	97.9	2.5e-47
AUL66428.1|41926_42832_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
AUL66429.1|42828_45093_+	multidrug DMT transporter permease	NA	A0A077SL51	Escherichia_phage	66.8	0.0e+00
AUL66430.1|45892_46078_-	hypothetical protein	NA	Q71T99	Escherichia_phage	100.0	1.5e-16
AUL66497.1|46466_46658_-	hypothetical protein	NA	Q71T98	Escherichia_phage	98.4	3.9e-28
AUL66431.1|46850_47087_+	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	50.0	2.1e-07
AUL66432.1|47067_47895_+|protease	serine protease	protease	A0A077SLJ6	Escherichia_phage	100.0	1.6e-131
AUL66433.1|48078_48294_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66434.1|48284_49649_+	replicative DNA helicase	NA	O80281	Escherichia_phage	99.8	1.6e-253
AUL66435.1|49648_50647_+	hypothetical protein	NA	Q71TK3	Escherichia_phage	99.1	8.1e-194
AUL66436.1|50693_51326_-|plate	baseplate protein	plate	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
AUL66437.1|51318_52335_-|tail	phage tail tape measure protein	tail	A0A077SLQ1	Escherichia_phage	99.7	4.5e-192
AUL66438.1|52336_53122_-|plate	baseplate	plate	A0A1B0V7N6	Salmonella_phage	99.6	3.6e-144
AUL66439.1|53108_53837_-|tail	phage tail protein	tail	A0A077SK19	Escherichia_phage	100.0	9.3e-139
AUL66440.1|53840_55058_-|tail	phage tail protein	tail	A0A077SL53	Escherichia_phage	100.0	1.1e-224
AUL66441.1|55067_55445_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
AUL66442.1|55591_55837_+	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
AUL66443.1|55839_56418_+	norphogenetic protein	NA	Q71T85	Escherichia_phage	99.5	5.7e-107
AUL66444.1|56484_56640_+	norphogenetic protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
AUL66445.1|56581_57244_+	norphogenetic protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
AUL66446.1|57141_57768_+	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
AUL66447.1|57764_58442_+	serine/threonine protein phosphatase	NA	Q71TJ1	Escherichia_phage	99.6	1.1e-133
AUL66448.1|58438_59140_+	hypothetical protein	NA	Q71TJ0	Escherichia_phage	99.6	2.1e-143
AUL66449.1|59221_59440_+	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
AUL66450.1|59441_60704_+	hypothetical protein	NA	Q71TI8	Escherichia_phage	99.8	9.2e-235
AUL66451.1|60776_61283_+	3'-phosphatase	NA	A0A1B0VAK0	Salmonella_phage	99.4	1.8e-93
AUL66452.1|61477_62206_+	hypothetical protein	NA	Q71T76	Escherichia_phage	99.1	1.7e-140
AUL66453.1|62289_62493_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
AUL66454.1|62485_62725_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	97.5	1.3e-36
AUL66455.1|62721_63447_+	hypothetical protein	NA	A0A0U2QW67	Escherichia_phage	49.8	7.5e-48
AUL66456.1|63443_63743_+	hypothetical protein	NA	Q716F3	Shigella_phage	100.0	1.5e-58
AUL66457.1|63744_64302_+	hypothetical protein	NA	A0A0N7BYR8	Escherichia_phage	62.8	5.1e-36
AUL66458.1|64303_64567_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
AUL66459.1|64577_65177_+	hypothetical protein	NA	A0A1B0V865	Salmonella_phage	92.6	7.5e-78
AUL66460.1|65259_65493_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	97.4	1.6e-36
AUL66461.1|65671_65965_+	hypothetical protein	NA	A0A077SK23	Escherichia_phage	91.8	9.1e-45
AUL66462.1|65971_66346_+	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	97.6	1.1e-66
AUL66498.1|66342_67260_+	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	97.7	9.2e-176
AUL66463.1|67256_67619_+	hypothetical protein	NA	Q71TI4	Escherichia_phage	100.0	2.2e-56
AUL66464.1|67929_68127_+	hypothetical protein	NA	Q71TI2	Escherichia_phage	98.5	7.5e-27
AUL66465.1|68104_68245_+	upfO	NA	Q71TI1	Escherichia_phage	97.8	7.2e-16
AUL66466.1|68280_68532_+	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	94.0	4.6e-37
AUL66467.1|68655_69045_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
AUL66468.1|69117_69339_+	prevent-host-death family protein	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AUL66469.1|69338_69719_+	death-on-curing family protein	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
AUL66470.1|69723_69903_+	PdcA protein	NA	Q71TH5	Escherichia_phage	98.3	2.7e-23
AUL66471.1|69930_70974_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.8	2.2e-205
AUL66472.1|71062_71515_+	Late promoter-activating protein	NA	Q71T63	Escherichia_phage	98.7	1.1e-78
AUL66473.1|71601_72795_+|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	99.0	4.1e-208
AUL66474.1|72794_74279_+|terminase	terminase	terminase	Q5QBP2	Enterobacteria_phage	100.0	2.5e-292
AUL66475.1|74303_75155_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
AUL66476.1|75265_75475_-	c1 repressor inactivator	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
AUL66477.1|75440_75536_-	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
AUL66478.1|75554_75668_-	peptidase	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
AUL66479.1|76078_76300_+	creatininase	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
AUL66480.1|76307_77339_+	recombinase	NA	Q71TG5	Escherichia_phage	99.7	2.2e-194
AUL66481.1|77389_77701_+	lysogeny establishment protein	NA	A0A077SK03	Escherichia_phage	99.0	2.3e-46
AUL66482.1|77946_78507_+	recombinase	NA	Q5QBN4	Enterobacteria_phage	95.7	2.3e-97
AUL66483.1|78695_79337_+	maturation control protein	NA	A0A077SK30	Escherichia_phage	98.1	1.6e-113
AUL66484.1|80746_80995_-	modulator protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
AUL66485.1|80991_81432_-	peptide-binding protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
AUL66486.1|81465_88233_-	helicase	NA	Q1MVN7	Enterobacteria_phage	98.7	0.0e+00
AUL66487.1|88308_90018_+|portal	phage portal protein	portal	Q1MVN6	Enterobacteria_phage	99.6	0.0e+00
AUL66488.1|90010_91030_+|head	head processing protein	head	Q71TR6	Escherichia_phage	89.7	7.6e-163
AUL66489.1|91033_91186_-|holin	antiholin	holin	Q71TR5	Escherichia_phage	88.0	4.4e-19
AUL66490.1|91321_91879_-	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
AUL66491.1|92047_92536_+	ssDNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	87.7	1.1e-74
AUL66492.1|92738_93527_+	hypothetical protein	NA	A0A077SK34	Escherichia_phage	99.2	8.0e-144
AUL66493.1|93519_94614_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	36.7	6.7e-40
AUL66494.1|94645_94954_-	hypothetical protein	NA	O21974	Escherichia_phage	97.1	5.4e-48
>prophage 1
CP019076	Escherichia coli strain CRE1493 plasmid p1493-5, complete sequence	127772	30841	112453	127772	integrase,transposase,protease	Escherichia_phage(30.0%)	96	77764:77823	93430:94252
AUL66537.1|30841_31219_-|transposase	transposase	transposase	U5P0U6	Shigella_phage	99.2	6.4e-67
AUL66538.1|31259_31535_-|transposase	transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
AUL66539.1|31941_33336_-	porin	NA	NA	NA	NA	NA
AUL66540.1|33530_34961_-	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	24.5	1.2e-28
AUL66541.1|34960_36238_-	MFS transporter	NA	NA	NA	NA	NA
AUL66542.1|36300_38427_-	alpha-galactosidase	NA	NA	NA	NA	NA
AUL66543.1|38522_39533_-	transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.1	6.2e-16
AUL66544.1|39690_40434_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	60.7	3.3e-83
AUL66545.1|40409_40529_-	nitrite extrusion protein 2 domain protein	NA	NA	NA	NA	NA
AUL66546.1|40539_40905_+|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
AUL66547.1|40862_41768_+|transposase	transposase	transposase	Q9ZXG3	Shigella_phage	98.3	4.5e-175
AUL66548.1|41788_42322_+	hypothetical protein	NA	NA	NA	NA	NA
AUL66549.1|43676_44240_-	SAM-dependent methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	40.0	3.0e-20
AUL66550.1|44287_45649_-	hydrolase	NA	NA	NA	NA	NA
AUL66551.1|45700_45931_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66639.1|46154_46274_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AUL66552.1|46418_46607_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66553.1|46967_47159_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66554.1|47155_47578_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66555.1|47624_48050_-	antirestriction protein	NA	NA	NA	NA	NA
AUL66556.1|48463_49234_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66557.1|49278_49713_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66558.1|49726_49948_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66559.1|49948_50632_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.0	1.1e-29
AUL66560.1|51016_51943_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66561.1|51956_52229_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66562.1|52656_53628_-	protein SopB	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
AUL66563.1|53627_54794_-	protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
AUL66564.1|55381_56137_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
AUL66565.1|56858_57665_-	resolvase	NA	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
AUL66566.1|57665_57971_-	toxin CcdB	NA	NA	NA	NA	NA
AUL66567.1|57972_58191_-	antitoxin CcdA	NA	NA	NA	NA	NA
AUL66640.1|58192_58471_+	hypothetical protein	NA	NA	NA	NA	NA
AUL66641.1|58435_58633_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66568.1|58750_58981_+	antitoxin	NA	NA	NA	NA	NA
AUL66569.1|58977_59394_+	VapC toxin family PIN domain ribonuclease	NA	NA	NA	NA	NA
AUL66570.1|59468_61034_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AUL66571.1|61018_62041_+	DNA helicase UvrD	NA	NA	NA	NA	NA
AUL66572.1|62861_62948_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL66573.1|62910_63021_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL66574.1|63130_63634_-|transposase	transposase	transposase	Q71TF0	Escherichia_phage	97.0	2.0e-92
AUL66575.1|63552_63828_-|transposase	transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AUL66576.1|64290_64449_+	copper resistance protein	NA	NA	NA	NA	NA
AUL66577.1|64438_64945_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
AUL66578.1|65127_65943_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit C	NA	NA	NA	NA	NA
AUL66579.1|66101_66287_+	hypothetical protein	NA	NA	NA	NA	NA
AUL66580.1|66235_68176_+	iron permease	NA	NA	NA	NA	NA
AUL66581.1|68216_68744_+	iron transporter	NA	NA	NA	NA	NA
AUL66582.1|68847_70227_+	hypothetical protein	NA	NA	NA	NA	NA
AUL66583.1|70229_71513_+	ABC transporter permease	NA	NA	NA	NA	NA
AUL66584.1|71502_72633_+	ABC transporter permease	NA	NA	NA	NA	NA
AUL66585.1|72637_73333_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
AUL66586.1|73319_73805_+	thioredoxin	NA	NA	NA	NA	NA
AUL66587.1|73829_74315_+	hypothetical protein	NA	NA	NA	NA	NA
AUL66588.1|74436_75180_+	histidine acid phosphatase	NA	NA	NA	NA	NA
AUL66589.1|75356_77804_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	58.0	2.6e-265
77764:77823	attL	AGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
AUL66590.1|77828_78533_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUL66591.1|78898_79078_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL66592.1|79036_80050_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUL66642.1|80207_80681_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
AUL66593.1|80811_81600_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
AUL66594.1|81805_82153_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AUL66595.1|82146_82986_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUL66596.1|82915_83095_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66597.1|83113_83317_+	hypothetical protein	NA	NA	NA	NA	NA
AUL66598.1|83472_84678_+	chromate transporter	NA	NA	NA	NA	NA
AUL66599.1|84688_84994_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AUL66600.1|85220_85985_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AUL66601.1|86175_86364_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66602.1|86477_87062_-	macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AUL66603.1|87061_88300_-	MFS transporter	NA	NA	NA	NA	NA
AUL66604.1|88296_89202_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AUL66605.1|89323_90028_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUL66606.1|90004_90097_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL66607.1|90110_90971_+	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
AUL66608.1|90983_91526_+	tunicamycin resistance protein	NA	NA	NA	NA	NA
AUL66609.1|91617_91929_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL66610.1|92719_93424_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUL66611.1|95745_96078_+	tryptophan synthase subunit beta like protein	NA	NA	NA	NA	NA
93430:94252	attR	GCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTATTTTTCGGGGATCTGATTGCCCTCTGGCAATATCATTCAGCACGCCATAGTCGGCATCATGGTCCATTCGCCAGAAAACCGAAGCACCGGCATCAGCCAGGCGTGGAGAAAACTGGTATCCCAGCAGCCAGAAAAGGCCAAAGACAAGTTCGCTGGCACCTGCTGTATCGGTCATAATTTCGGTTGGATTCAGCCCGGTCTCCTGTTCCAGAAGACCTTCCAGCACAAAGATAGAGTCCCTCAGCGTCCCCGGTATAACGATGCCATGAAAGCCGGAATACTGATCGGACACAAAGTTGTACCAGGTGATCCCTCTGTTATTACCAAAGTATTTGCGGTTCGGTCCGGCATTGATTGTTCTGACTGGCGTAACAAAGCGCATTCCATCTGCAGATGCCACTTCTCCTCCACCCCATATCTGTGCCAGTGGCAGCGTTGCCTGAAAATCAACCAGTCTGGCATTAGCGCTGGTGATAGTTTCAGCCCGCAGATAGTTCGCTTTTGTCCAGTTCAGCCGGTGTCGGGTCAGTGCAGGAACATTTGATCTGATCAGTGGTTCCAGACCGATATTGCAGGCTTCAGCCATCAGCACGGCGCTGATGCTGACGGGCAGATCATCAACTCTGGCACTGGCTTCACTAGCATGGAAAAACTCATCAGCAAATCCGGTATGGGCGTTAATTTCGAGCAGCAACTCCGTTAAATCCACCGGAGGGAGTAGATCACTGATCATTTTGCTCAGTCGTTTCAGACTGTCCGGCT	NA	NA	NA	NA
AUL66612.1|96124_97000_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AUL66613.1|97152_97275_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66614.1|97608_98313_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUL66643.1|98944_99775_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AUL66644.1|99905_100505_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AUL66615.1|100603_101308_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUL66645.1|101343_102888_+|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	1.4e-293
AUL66646.1|102929_103172_+	relaxase	NA	NA	NA	NA	NA
AUL66616.1|103203_103881_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL66647.1|103941_105159_+	TetA family tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
AUL66617.1|105190_106075_-	EamA family transporter	NA	NA	NA	NA	NA
AUL66648.1|106212_106605_-	isochorismatase	NA	NA	NA	NA	NA
AUL66618.1|107381_107987_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
AUL66619.1|108081_110979_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AUL66620.1|111115_111448_-	mRNA interferase PemK	NA	NA	NA	NA	NA
AUL66621.1|111449_111707_-	antitoxin PemI	NA	NA	NA	NA	NA
AUL66622.1|111799_112453_-|protease	CAAX protease family protein	protease	NA	NA	NA	NA
