The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019051	Escherichia coli strain CRE1540 chromosome, complete genome	4942719	301711	316552	4942719	integrase	Enterobacteria_phage(88.89%)	17	305691:305706	317690:317705
AUL66926.1|301711_303910_+	xanthine dehydrogenase	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
AUL66927.1|303919_304876_+	hypothetical protein	NA	NA	NA	NA	NA
AUL66928.1|304854_305265_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL66929.1|305515_305668_-|integrase	attP region and P4int integrase	integrase	NA	NA	NA	NA
305691:305706	attL	TGAAATCACACAGGGA	NA	NA	NA	NA
AUL66930.1|305883_308217_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
AUL66931.1|308231_308552_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66932.1|308687_309143_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
AUL66933.1|309135_309423_-	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
AUL66934.1|309415_310015_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	80.3	1.9e-49
AUL66935.1|310011_310278_-	hypothetical protein	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
AUL66936.1|310290_310482_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66937.1|310829_311564_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.4	1.4e-129
AUL66938.1|311560_312061_+	transactivation protein	NA	NA	NA	NA	NA
AUL66939.1|312134_312707_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	6.5e-95
AUL66940.1|313009_313750_-	hypothetical protein	NA	NA	NA	NA	NA
AUL66941.1|313746_315375_-	RNA-dependent DNA polymerase	NA	NA	NA	NA	NA
AUL66942.1|315367_316552_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	61.4	3.2e-144
317690:317705	attR	TGAAATCACACAGGGA	NA	NA	NA	NA
>prophage 2
CP019051	Escherichia coli strain CRE1540 chromosome, complete genome	4942719	1464011	1482852	4942719	holin,integrase	Morganella_phage(30.77%)	24	1468173:1468189	1488324:1488340
AUL67979.1|1464011_1464455_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	66.4	4.8e-45
AUL67980.1|1464471_1464849_-	hypothetical protein	NA	NA	NA	NA	NA
AUL67981.1|1464852_1465335_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	43.9	1.5e-28
AUL67982.1|1466307_1467006_-	hypothetical protein	NA	NA	NA	NA	NA
AUL67983.1|1467156_1469877_-	DNA transfer protein	NA	A5VW64	Enterobacteria_phage	60.9	7.5e-149
1468173:1468189	attL	TCATCTCCGGGCTGAGT	NA	NA	NA	NA
AUL67984.1|1469873_1471193_-	DNA transfer protein p33	NA	B6SCW4	Bacteriophage	43.2	1.6e-35
AUL67985.1|1471192_1471870_-	DNA transfer protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
AUL67986.1|1471863_1472325_-	hypothetical protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
AUL67987.1|1472341_1472503_-	hypothetical protein	NA	NA	NA	NA	NA
AUL67988.1|1472769_1473021_-	hypothetical protein	NA	NA	NA	NA	NA
AUL67989.1|1473087_1475844_-	DNA primase	NA	A0A1W6JPG0	Morganella_phage	57.0	3.4e-298
AUL67990.1|1475830_1476202_-	hypothetical protein	NA	NA	NA	NA	NA
AUL67991.1|1476194_1476536_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
AUL67992.1|1476546_1477149_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.8	8.8e-26
AUL67993.1|1477141_1477363_-	hypothetical protein	NA	NA	NA	NA	NA
AUL67994.1|1477359_1477623_-|holin	nicotinic acetylcholine receptor subunit beta	holin	NA	NA	NA	NA
AUL67995.1|1477619_1477814_-	hypothetical protein	NA	NA	NA	NA	NA
AUL67996.1|1477806_1478874_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	36.8	8.9e-13
AUL67997.1|1478867_1479050_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AUL67998.1|1479042_1479876_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	46.7	9.0e-21
AUL67999.1|1479888_1480320_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	50.3	1.8e-28
AUL68000.1|1480319_1480523_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AUL68001.1|1480629_1481580_-	hypothetical protein	NA	NA	NA	NA	NA
AUL68002.1|1481598_1482852_-|integrase	integrase	integrase	A0A1W6JPG6	Morganella_phage	78.1	3.9e-193
1488324:1488340	attR	ACTCAGCCCGGAGATGA	NA	NA	NA	NA
>prophage 3
CP019051	Escherichia coli strain CRE1540 chromosome, complete genome	4942719	1512453	1573500	4942719	integrase,tRNA,transposase	Escherichia_phage(38.1%)	68	1542581:1542640	1559252:1560071
AUL68033.1|1512453_1512564_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL68034.1|1512591_1513023_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AUL68035.1|1513163_1513415_+	glutaredoxin	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
AUL68036.1|1513477_1513945_+	protein-export protein SecB	NA	NA	NA	NA	NA
AUL68037.1|1513944_1514964_+	glycerol-3-phosphate dehydrogenase (NAD(P)(+))	NA	NA	NA	NA	NA
AUL68038.1|1515043_1515865_+	serine acetyltransferase	NA	NA	NA	NA	NA
AUL68039.1|1515917_1516391_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
AUL68040.1|1516576_1517767_-	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUL68041.1|1517763_1518540_-	transcriptional regulator LldR	NA	NA	NA	NA	NA
AUL68042.1|1518539_1520195_-	L-lactate permease	NA	NA	NA	NA	NA
AUL68043.1|1520563_1525414_-	adhesin	NA	NA	NA	NA	NA
AUL71327.1|1525457_1526039_-	hypothetical protein	NA	NA	NA	NA	NA
AUL68044.1|1526506_1526599_+	IS1 encoded protein	NA	NA	NA	NA	NA
AUL68045.1|1526684_1527047_-	hypothetical protein	NA	NA	NA	NA	NA
AUL68046.1|1527331_1527541_+	hypothetical protein	NA	NA	NA	NA	NA
AUL68047.1|1527552_1528140_-	MltR family transcriptional regulator	NA	NA	NA	NA	NA
AUL68048.1|1528139_1529288_-	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
AUL68049.1|1529517_1531431_-	PTS mannitol transporter subunit IIABC	NA	NA	NA	NA	NA
AUL68050.1|1531967_1532330_+	hypothetical protein	NA	NA	NA	NA	NA
AUL68051.1|1532332_1533469_+	hypothetical protein	NA	NA	NA	NA	NA
AUL68052.1|1533511_1534015_-	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	100.0	1.5e-95
AUL68053.1|1533933_1534209_-|transposase	transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AUL68054.1|1534242_1534434_-	hypothetical protein	NA	NA	NA	NA	NA
AUL68055.1|1534487_1535147_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AUL68056.1|1535108_1535366_-	hypothetical protein	NA	NA	NA	NA	NA
AUL68057.1|1535356_1536061_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUL68058.1|1536182_1537088_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AUL68059.1|1537084_1538323_+	MFS transporter	NA	NA	NA	NA	NA
AUL68060.1|1538322_1538907_+	macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AUL68061.1|1539020_1539209_+	hypothetical protein	NA	NA	NA	NA	NA
AUL68062.1|1539399_1540164_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	71.2	2.8e-93
AUL68063.1|1540140_1540239_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL68064.1|1540549_1540966_+	fosfomycin resistance glutathione transferase FosA3	NA	NA	NA	NA	NA
AUL71329.1|1540970_1542284_-	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	100.0	2.2e-170
AUL71330.1|1542216_1542570_+	hypothetical protein	NA	NA	NA	NA	NA
1542581:1542640	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
AUL68065.1|1542643_1543348_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUL68066.1|1543499_1544513_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUL71328.1|1544670_1545144_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IBQ4	Erwinia_phage	33.1	7.6e-17
AUL68067.1|1545274_1546063_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
AUL68068.1|1546268_1546616_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AUL68069.1|1546609_1547449_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AUL68070.1|1547378_1547558_-	hypothetical protein	NA	NA	NA	NA	NA
AUL68071.1|1547576_1547780_+	hypothetical protein	NA	NA	NA	NA	NA
AUL68072.1|1547935_1549141_+	chromate transporter	NA	NA	NA	NA	NA
AUL68073.1|1549297_1550002_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUL71331.1|1550048_1550747_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	38.1	1.2e-34
AUL68074.1|1550676_1550937_+	hypothetical protein	NA	NA	NA	NA	NA
AUL68075.1|1550950_1551139_+	hypothetical protein	NA	NA	NA	NA	NA
AUL68076.1|1551141_1552677_+	fluoroquinolone efflux MFS transporter QepA1	NA	A0A0M3UL24	Mycobacterium_phage	32.8	1.3e-41
AUL68077.1|1552704_1553073_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AUL68078.1|1553329_1554862_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AUL68079.1|1555088_1555466_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	58.1	8.2e-22
AUL68080.1|1555501_1556050_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AUL68081.1|1556130_1556886_-	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
AUL68082.1|1557055_1557916_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AUL68083.1|1558098_1558476_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	99.2	4.4e-60
AUL68084.1|1558543_1559248_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUL68085.1|1561929_1562487_+|transposase	transposase	transposase	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
1559252:1560071	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTATTTTTCGGGGATCTGATTGCCCTCTGGCAATATCATTCAGCACGCCATAGTCGGCATCATGGTCCATTCGCCAGAAAACCGAAGCACCGGCATCAGCCAGGCGTGGAGAAAACTGGTATCCCAGCAGCCAGAAAAGGCCAAAGACAAGTTCGCTGGCACCTGCTGTATCGGTCATAATTTCGGTTGGATTCAGCCCGGTCTCCTGTTCCAGAAGACCTTCCAGCACAAAGATAGAGTCCCTCAGCGTCCCCGGTATAACGATGCCATGAAAGCCGGAATACTGATCGGACACAAAGTTGTACCAGGTGATCCCTCTGTTATTACCAAAGTATTTGCGGTTCGGTCCGGCATTGATTGTTCTGACTGGCGTAACAAAGCGCATTCCATCTGCAGATGCCACTTCTCCTCCACCCCATATCTGTGCCAGTGGCAGCGTTGCCTGAAAATCAACCAGTCTGGCATTAGCGCTGGTGATAGTTTCAGCCCGCAGATAGTTCGCTTTTGTCCAGTTCAGCCGGTGTCGGGTCAGTGCAGGAACATTTGATCTGATCAGTGGTTCCAGACCGATATTGCAGGCTTCAGCCATCAGCACGGCGCTGATGCTGACGGGCAGATCATCAACTCTGGCACTGGCTTCACTAGCATGGAAAAACTCATCAGCAAATCCGGTATGGGCGTTAATTTCGAGCAGCAACTCCGTTAAATCCACCGGAGGGAGTAGATCACTGATCATTTTGCTCAGTCGTTTCAGACTGTC	NA	NA	NA	NA
AUL68086.1|1562669_1563530_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AUL68087.1|1563624_1563807_-	hypothetical protein	NA	NA	NA	NA	NA
AUL68088.1|1563837_1563996_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AUL68089.1|1564177_1564639_-	hypothetical protein	NA	NA	NA	NA	NA
AUL68090.1|1564650_1565595_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	46.7	1.7e-23
AUL68091.1|1565636_1566479_-	lyase	NA	NA	NA	NA	NA
AUL68092.1|1566583_1566967_-	hypothetical protein	NA	NA	NA	NA	NA
AUL68093.1|1566938_1571174_-	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	7.3e-26
AUL68094.1|1571402_1572011_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUL68095.1|1572108_1573500_+|tRNA	L-selenocysteinyl-tRNA(Sec) synthase	tRNA	NA	NA	NA	NA
>prophage 4
CP019051	Escherichia coli strain CRE1540 chromosome, complete genome	4942719	2229530	2253854	4942719	transposase	Sodalis_phage(20.0%)	30	NA	NA
AUL68739.1|2229530_2230262_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL71356.1|2230355_2230466_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL71357.1|2230576_2230795_+	hypothetical protein	NA	NA	NA	NA	NA
AUL68740.1|2230806_2231013_-	hypothetical protein	NA	NA	NA	NA	NA
AUL68741.1|2231446_2233051_+	hypothetical protein	NA	NA	NA	NA	NA
AUL68742.1|2234647_2235214_+	hypothetical protein	NA	NA	NA	NA	NA
AUL68743.1|2235464_2236070_+	hypothetical protein	NA	NA	NA	NA	NA
AUL68744.1|2236138_2236375_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL68745.1|2236643_2237192_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71358.1|2237210_2237459_-	osmoprotectant transport activator ProQ	NA	Q2A0A1	Sodalis_phage	39.1	8.3e-07
AUL68746.1|2237527_2237719_-	osmoprotectant transport activator ProQ	NA	NA	NA	NA	NA
AUL71359.1|2238541_2238706_-|transposase	transposase	transposase	A0A0U2RK18	Escherichia_phage	87.5	6.5e-16
AUL68747.1|2239628_2239826_-	hypothetical protein	NA	NA	NA	NA	NA
AUL68748.1|2241082_2241898_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
AUL68749.1|2241958_2242762_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
AUL68750.1|2242761_2243598_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AUL71360.1|2243816_2243981_-	hypothetical protein	NA	NA	NA	NA	NA
AUL68751.1|2243903_2244146_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL68752.1|2244177_2244855_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL71361.1|2244915_2246133_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
AUL68753.1|2246399_2246705_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL68754.1|2246732_2247947_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
AUL68755.1|2248163_2249048_-	type VI secretion protein	NA	NA	NA	NA	NA
AUL68756.1|2249078_2249792_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AUL68757.1|2249668_2249947_-	pilus assembly protein	NA	NA	NA	NA	NA
AUL68758.1|2249983_2250175_+	papI protein	NA	NA	NA	NA	NA
AUL68759.1|2250200_2250383_+	hypothetical protein	NA	NA	NA	NA	NA
AUL68760.1|2250369_2250684_+	major pilus subunit operon regulatory protein PapB	NA	NA	NA	NA	NA
AUL68761.1|2251604_2252837_-	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
AUL68762.1|2252987_2253854_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
>prophage 5
CP019051	Escherichia coli strain CRE1540 chromosome, complete genome	4942719	2548615	2555755	4942719		Escherichia_phage(83.33%)	6	NA	NA
AUL69028.1|2548615_2549254_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AUL69029.1|2549250_2550513_-	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	61.7	5.7e-136
AUL69030.1|2550509_2551418_-	oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AUL69031.1|2551613_2552381_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AUL69032.1|2552431_2553088_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
AUL69033.1|2553193_2555755_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.3e-30
>prophage 6
CP019051	Escherichia coli strain CRE1540 chromosome, complete genome	4942719	2919706	3036904	4942719	capsid,plate,holin,portal,terminase,tail,integrase,tRNA,transposase	Enterobacteria_phage(71.43%)	121	2983502:2983525	3028533:3028556
AUL69374.1|2919706_2920321_-|transposase	transposase	transposase	Q716C2	Shigella_phage	97.8	6.1e-107
AUL69375.1|2922724_2923654_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL69376.1|2923728_2924067_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL69377.1|2924060_2924348_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69378.1|2925513_2926185_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL69379.1|2926725_2927037_+|transposase	transposase	transposase	Q716C1	Shigella_phage	48.0	3.2e-16
AUL71388.1|2927248_2927902_+|transposase	transposase	transposase	Q716C2	Shigella_phage	61.9	1.8e-77
AUL69380.1|2928696_2928951_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69381.1|2928978_2932476_+	outer membrane autotransporter barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.9	1.2e-98
AUL69382.1|2932845_2933052_+	alkaline phosphatase	NA	NA	NA	NA	NA
AUL69383.1|2933336_2933483_-	addiction module toxin RelE	NA	NA	NA	NA	NA
AUL69384.1|2933509_2933866_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	92.5	2.6e-33
AUL69385.1|2933822_2934974_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	6.8e-43
AUL69386.1|2935781_2936600_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	1.5e-65
AUL69387.1|2936889_2937147_+	hypothetical protein	NA	NA	NA	NA	NA
AUL69388.1|2937143_2938169_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUL69389.1|2938140_2939430_-	MFS transporter	NA	NA	NA	NA	NA
AUL69390.1|2940663_2940903_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69391.1|2941704_2944014_+	ATPase	NA	NA	NA	NA	NA
AUL69392.1|2944017_2945334_+	ATP-binding protein	NA	NA	NA	NA	NA
AUL69393.1|2945330_2947529_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
AUL69394.1|2948010_2949027_+	hypothetical protein	NA	NA	NA	NA	NA
AUL69395.1|2950932_2951232_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL69396.1|2951228_2952095_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	1.8e-51
AUL69397.1|2953463_2953763_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL69398.1|2954000_2954603_+|transposase	transposase	transposase	U5P429	Shigella_phage	48.9	2.4e-47
AUL69399.1|2954599_2954755_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69400.1|2956021_2957212_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	57.3	7.6e-130
AUL69401.1|2957537_2958470_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
AUL69402.1|2958763_2959519_+	lipoprotein	NA	NA	NA	NA	NA
AUL69403.1|2959700_2960759_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69404.1|2961124_2962465_-	long-chain fatty acid transporter	NA	NA	NA	NA	NA
AUL69405.1|2962500_2962752_+	hypothetical protein	NA	NA	NA	NA	NA
AUL69406.1|2962836_2963121_+	hypothetical protein	NA	NA	NA	NA	NA
AUL69407.1|2963300_2964611_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AUL69408.1|2964610_2966755_+	multifunctional fatty acid oxidation complex subunit alpha	NA	NA	NA	NA	NA
AUL69409.1|2966957_2967443_+	phosphohistidine phosphatase	NA	NA	NA	NA	NA
AUL69410.1|2968117_2968681_+	fimbrial protein	NA	NA	NA	NA	NA
AUL69411.1|2968762_2971405_+	outer membrane usher protein	NA	NA	NA	NA	NA
AUL69412.1|2971424_2972177_+	fimbrial protein	NA	NA	NA	NA	NA
AUL69413.1|2972193_2972700_+	fimbrial protein	NA	NA	NA	NA	NA
AUL69414.1|2972696_2973167_+	fimbrial protein	NA	NA	NA	NA	NA
AUL69415.1|2973163_2973688_+	fimbrial protein	NA	NA	NA	NA	NA
AUL69416.1|2973674_2974547_+	fimbrial protein	NA	NA	NA	NA	NA
AUL69417.1|2974668_2975220_-	endonuclease SmrB	NA	NA	NA	NA	NA
AUL69418.1|2975385_2976318_+	ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUL69419.1|2976352_2977438_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
AUL69420.1|2977441_2978266_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AUL69421.1|2978265_2979075_+	hypothetical protein	NA	NA	NA	NA	NA
AUL69422.1|2979074_2979623_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AUL69423.1|2979656_2979935_+	hypothetical protein	NA	NA	NA	NA	NA
AUL69424.1|2980055_2982062_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AUL69425.1|2982220_2983441_+	3-oxoacyl-ACP synthase I	NA	NA	NA	NA	NA
2983502:2983525	attL	GATAAGACGCGCCAGCGTCGCATC	NA	NA	NA	NA
AUL71389.1|2983588_2983810_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69426.1|2983751_2984930_+	arabinose transporter	NA	NA	NA	NA	NA
AUL69427.1|2984926_2985922_-	flagella biosynthesis regulator	NA	NA	NA	NA	NA
AUL69428.1|2986190_2987084_-	type VI secretion protein	NA	NA	NA	NA	NA
AUL69429.1|2987088_2987421_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AUL69430.1|2987683_2987824_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
AUL69431.1|2988014_2988275_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69432.1|2988317_2989427_-	late control protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.5e-204
AUL69433.1|2989584_2990769_+|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	1.8e-224
AUL69434.1|2990768_2991281_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
AUL69435.1|2991336_2991711_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
AUL69436.1|2991638_2991875_+|tail	phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	4.3e-21
AUL69437.1|2991861_2994669_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.3	0.0e+00
AUL69438.1|2994675_2995170_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.2e-86
AUL71390.1|2995422_2995899_+	serine acetyltransferase	NA	NA	NA	NA	NA
AUL69439.1|2995942_2996521_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	89.5	3.5e-96
AUL69440.1|2996520_2998863_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	98.1	4.1e-111
AUL69441.1|2998865_2999396_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	5.6e-93
AUL69442.1|2999388_3000285_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	5.7e-154
AUL69443.1|3000288_3000639_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	7.8e-59
AUL69444.1|3000635_3001217_-|plate	baseplate assembly protein	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	3.3e-102
AUL69445.1|3001213_3001858_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	1.2e-113
AUL69446.1|3001841_3002309_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
AUL71391.1|3002295_3002475_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69447.1|3002446_3002854_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	96.3	2.5e-64
AUL69448.1|3002850_3003243_-	peptidase M15	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
AUL69449.1|3003239_3003563_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	98.1	6.1e-50
AUL69450.1|3003565_3003766_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
AUL69451.1|3003765_3004260_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	98.8	3.0e-88
AUL69452.1|3004361_3005162_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	98.1	7.8e-139
AUL69453.1|3005207_3006260_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	99.7	1.5e-198
AUL69454.1|3006283_3007120_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	3.0e-149
AUL69455.1|3007274_3009026_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.4	0.0e+00
AUL69456.1|3009025_3010072_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
AUL69457.1|3010720_3011218_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
AUL69458.1|3011257_3012100_+	hypothetical protein	NA	NA	NA	NA	NA
AUL69459.1|3012183_3012498_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	53.3	1.4e-19
AUL69460.1|3012502_3013462_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	1.3e-177
AUL69461.1|3013538_3016379_-	replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	89.0	0.0e+00
AUL69462.1|3016375_3016765_-	inositol monophosphatase	NA	NA	NA	NA	NA
AUL69463.1|3016837_3017068_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	96.1	2.6e-31
AUL69464.1|3017390_3017690_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
AUL69465.1|3017686_3017932_-	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
AUL69466.1|3017928_3018132_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
AUL69467.1|3018218_3018332_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
AUL69468.1|3018328_3018571_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	5.2e-38
AUL69469.1|3018582_3018870_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
AUL69470.1|3018880_3019222_-	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	6.6e-55
AUL69471.1|3019474_3019681_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69472.1|3019687_3019975_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
AUL71392.1|3020088_3020409_+	transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
AUL69473.1|3020505_3021510_+|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	56.0	1.5e-99
AUL69474.1|3021668_3022826_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	6.0e-23
AUL69475.1|3022891_3023905_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL69476.1|3023904_3024717_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AUL69477.1|3024799_3025459_+	hypothetical protein	NA	NA	NA	NA	NA
AUL69478.1|3025614_3026529_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
AUL69479.1|3026598_3027867_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AUL69480.1|3027856_3028519_+	cell division protein DedD	NA	NA	NA	NA	NA
AUL69481.1|3028777_3029266_+	colicin V production protein	NA	NA	NA	NA	NA
3028533:3028556	attR	GATGCGACGCTGGCGCGTCTTATC	NA	NA	NA	NA
AUL69482.1|3029302_3030820_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	1.0e-86
AUL69483.1|3030914_3031484_+	3-octaprenyl-4-hydroxybenzoate carboxy-lyase partner protein	NA	NA	NA	NA	NA
AUL69484.1|3031749_3032532_+	lysine/arginine/ornithine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL69485.1|3032752_3033535_+	histidine-binding periplasmic protein	NA	NA	NA	NA	NA
AUL69486.1|3033624_3034311_+	histidine ABC transporter permease	NA	NA	NA	NA	NA
AUL69487.1|3034307_3035024_+	histidine ABC transporter permease	NA	NA	NA	NA	NA
AUL69488.1|3035031_3035805_+	histidine transport ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
AUL69489.1|3036001_3036904_+|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	44.5	8.2e-68
>prophage 7
CP019051	Escherichia coli strain CRE1540 chromosome, complete genome	4942719	3225180	3232189	4942719	transposase	Enterobacteria_phage(62.5%)	11	NA	NA
AUL69660.1|3225180_3226107_+	ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
AUL69661.1|3226111_3226843_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AUL69662.1|3226823_3226931_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69663.1|3226990_3227722_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AUL69664.1|3227943_3229629_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AUL69665.1|3229625_3230345_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL69666.1|3230391_3230862_+	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AUL69667.1|3230902_3231037_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.2e-15
AUL69668.1|3231060_3231363_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	98.0	1.0e-46
AUL69669.1|3231491_3231995_-|transposase	transposase	transposase	Q71TF0	Escherichia_phage	99.4	5.7e-95
AUL69670.1|3231913_3232189_-|transposase	transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
>prophage 8
CP019051	Escherichia coli strain CRE1540 chromosome, complete genome	4942719	3318721	3330526	4942719		Enterobacteria_phage(33.33%)	11	NA	NA
AUL69739.1|3318721_3320116_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	3.7e-19
AUL69740.1|3320290_3321184_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AUL69741.1|3321220_3321484_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69742.1|3321555_3322641_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	3.6e-102
AUL69743.1|3322640_3323540_+	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	34.8	2.8e-28
AUL69744.1|3323597_3324476_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	64.5	3.0e-107
AUL69745.1|3324478_3325024_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.7	1.3e-52
AUL69746.1|3325054_3326329_+	Vi polysaccharide biosynthesis protein VipA/TviB	NA	A7IWZ0	Paramecium_bursaria_Chlorella_virus	25.6	5.1e-23
AUL69747.1|3326353_3327376_+	LPS biosynthesis protein WbpP	NA	A0A2K9L4U8	Tupanvirus	45.1	2.8e-72
AUL69748.1|3327488_3328694_+	hypothetical protein	NA	NA	NA	NA	NA
AUL69749.1|3328681_3330526_+	asparagine synthetase B	NA	A0A1V0SGM7	Hokovirus	27.7	1.9e-34
>prophage 9
CP019051	Escherichia coli strain CRE1540 chromosome, complete genome	4942719	3367382	3374780	4942719	transposase	Stx2-converting_phage(50.0%)	11	NA	NA
AUL69790.1|3367382_3368954_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.4e-170
AUL69791.1|3368973_3369321_-|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AUL69792.1|3369320_3369968_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.6	1.5e-15
AUL69793.1|3370204_3371356_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69794.1|3371750_3371981_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69795.1|3371988_3372333_+	hypothetical protein	NA	NA	NA	NA	NA
AUL69796.1|3372366_3372576_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71401.1|3372559_3372835_-|transposase	transposase	transposase	U5N3F9	Enterobacteria_phage	88.6	2.6e-09
AUL69797.1|3372770_3372965_+	hypothetical protein	NA	NA	NA	NA	NA
AUL69798.1|3372978_3374001_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
AUL69799.1|3373997_3374780_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.6	1.0e-138
>prophage 10
CP019051	Escherichia coli strain CRE1540 chromosome, complete genome	4942719	3380046	3421338	4942719	transposase	Shigella_phage(33.33%)	38	NA	NA
AUL69809.1|3380046_3380385_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL71402.1|3380568_3381426_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL69810.1|3382316_3383282_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69811.1|3383338_3384097_-	cytoplasmic protein	NA	NA	NA	NA	NA
AUL69812.1|3385520_3385637_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	70.6	6.0e-08
AUL69813.1|3385743_3385881_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
AUL71403.1|3385848_3385974_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL69814.1|3386092_3386305_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69815.1|3386787_3387321_-	hypothetical protein	NA	NA	NA	NA	NA
AUL71404.1|3387272_3387500_+	hypothetical protein	NA	NA	NA	NA	NA
AUL69816.1|3387427_3387610_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69817.1|3388363_3388528_+	hypothetical protein	NA	NA	NA	NA	NA
AUL69818.1|3388718_3388841_+	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
AUL69819.1|3388992_3389538_+	adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase	NA	NA	NA	NA	NA
AUL69820.1|3389534_3390278_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
AUL69821.1|3390289_3391369_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
AUL69822.1|3391433_3392366_+	transpeptidase	NA	NA	NA	NA	NA
AUL69823.1|3392823_3393741_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
AUL69824.1|3393842_3394793_+	transcriptional regulator Cbl	NA	NA	NA	NA	NA
AUL69825.1|3394913_3396554_+	MATE family multidrug exporter	NA	NA	NA	NA	NA
AUL69826.1|3397038_3397542_-|transposase	transposase	transposase	U5P0U6	Shigella_phage	98.8	1.1e-93
AUL69827.1|3397616_3397703_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL69828.1|3397665_3397776_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL69829.1|3397958_3398675_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL69830.1|3399017_3400472_-	AMP nucleosidase	NA	NA	NA	NA	NA
AUL69831.1|3400573_3401890_-	MFS transporter	NA	NA	NA	NA	NA
AUL69832.1|3401939_3402176_-	hypothetical protein	NA	NA	NA	NA	NA
AUL71405.1|3412328_3413126_-	protein MtfA	NA	NA	NA	NA	NA
AUL69833.1|3413613_3413856_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69834.1|3413878_3414409_-	cytochrome b561-like protein 1	NA	A0A0U2QLA7	Escherichia_phage	99.1	2.5e-56
AUL69835.1|3414751_3415402_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
AUL69836.1|3415658_3416294_-	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AUL69837.1|3416294_3417299_-	sulfoxide reductase	NA	NA	NA	NA	NA
AUL69838.1|3417407_3417821_-	5-hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AUL71406.1|3417953_3418625_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
AUL69839.1|3418624_3419983_+	two-component sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	3.9e-05
AUL69840.1|3420090_3420825_-	protein deglycase HchA	NA	NA	NA	NA	NA
AUL69841.1|3420834_3421338_-|transposase	transposase	transposase	U5P0U6	Shigella_phage	93.8	3.1e-85
>prophage 11
CP019051	Escherichia coli strain CRE1540 chromosome, complete genome	4942719	3441696	3477619	4942719	integrase,transposase	Escherichia_phage(28.57%)	38	3471907:3471922	3489601:3489616
AUL69867.1|3441696_3442011_-|integrase	integrase	integrase	A0A286S1S8	Klebsiella_phage	61.8	6.9e-06
AUL69868.1|3442110_3442443_+	multidrug SMR transporter	NA	NA	NA	NA	NA
AUL69869.1|3442611_3443163_+	hypothetical protein	NA	NA	NA	NA	NA
AUL69870.1|3443172_3443970_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL69871.1|3444680_3444923_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69872.1|3445345_3446509_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	92.5	3.2e-197
AUL69873.1|3446493_3447165_-	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	2.4e-80
AUL69874.1|3447273_3447507_-	SirA-like protein	NA	NA	NA	NA	NA
AUL69875.1|3447503_3448709_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69876.1|3448895_3449309_+	hypothetical protein	NA	NA	NA	NA	NA
AUL69877.1|3449342_3450830_-	alpha-amylase	NA	NA	NA	NA	NA
AUL69878.1|3450907_3451273_-	flagellar biosynthesis protein FliT	NA	NA	NA	NA	NA
AUL69879.1|3451272_3451683_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
AUL69880.1|3451707_3453114_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
AUL69881.1|3453379_3455119_+	flagellin	NA	NA	NA	NA	NA
AUL69882.1|3455438_3456158_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
AUL71409.1|3456842_3457643_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL69883.1|3457747_3458734_+	aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase family protein	NA	NA	NA	NA	NA
AUL69884.1|3458748_3459417_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL69885.1|3459413_3460166_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	4.9e-26
AUL69886.1|3460395_3461118_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
AUL69887.1|3461184_3461409_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69888.1|3461395_3461572_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69889.1|3461867_3462524_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL69890.1|3462520_3464353_+	excinuclease ABC subunit C	NA	NA	NA	NA	NA
AUL69891.1|3464409_3464958_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AUL69892.1|3466470_3467670_+|integrase	integrase	integrase	NA	NA	NA	NA
AUL69893.1|3467706_3467943_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71410.1|3468095_3468410_+	hypothetical protein	NA	NA	NA	NA	NA
AUL69894.1|3468435_3468969_+	hypothetical protein	NA	NA	NA	NA	NA
AUL69895.1|3469041_3469476_+	hypothetical protein	NA	NA	NA	NA	NA
AUL69896.1|3469812_3470736_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
AUL69897.1|3471529_3471721_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69898.1|3471795_3472299_+|transposase	transposase	transposase	U5P0U6	Shigella_phage	93.8	3.1e-85
3471907:3471922	attL	ATTGTCTGCGCTGAAA	NA	NA	NA	NA
AUL69899.1|3472865_3475466_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69900.1|3475512_3476151_-	hypothetical protein	NA	NA	NA	NA	NA
AUL69901.1|3476140_3476341_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUL69902.1|3476491_3477619_-|integrase	integrase	integrase	A0A221SAN4	Ralstonia_phage	28.2	6.9e-16
3489601:3489616	attR	ATTGTCTGCGCTGAAA	NA	NA	NA	NA
>prophage 12
CP019051	Escherichia coli strain CRE1540 chromosome, complete genome	4942719	3814728	3881879	4942719	protease,capsid,holin,portal,terminase,head,tail,integrase	Enterobacteria_phage(46.94%)	77	3811827:3811841	3862939:3862953
3811827:3811841	attL	CTGGGCGGCTGCGGC	NA	NA	NA	NA
AUL70231.1|3814728_3815550_-|protease	serine protease	protease	NA	NA	NA	NA
AUL70232.1|3815649_3815733_-	hypothetical protein	NA	NA	NA	NA	NA
AUL70233.1|3815825_3816161_-	acid-shock protein	NA	NA	NA	NA	NA
AUL70234.1|3816557_3817811_-	MFS transporter	NA	NA	NA	NA	NA
AUL70235.1|3817917_3818811_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL70236.1|3818945_3820166_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL70237.1|3820290_3820986_+	dethiobiotin synthase	NA	NA	NA	NA	NA
AUL70238.1|3820938_3822231_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
AUL70239.1|3822389_3823004_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AUL70240.1|3823046_3823901_-	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
AUL70241.1|3823902_3824520_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AUL71424.1|3824530_3826954_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
AUL70242.1|3827014_3829441_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.9e-213
AUL70243.1|3829639_3829945_-	hypothetical protein	NA	NA	NA	NA	NA
AUL71425.1|3830052_3830763_+	hypothetical protein	NA	NA	NA	NA	NA
AUL70244.1|3830765_3831326_-	spermidine acetyltransferase	NA	NA	NA	NA	NA
AUL70245.1|3831360_3831702_-	hypothetical protein	NA	NA	NA	NA	NA
AUL70246.1|3831836_3832163_+	hypothetical protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AUL70247.1|3832199_3832388_+	hypothetical protein	NA	NA	NA	NA	NA
AUL70248.1|3832368_3833583_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AUL70249.1|3833594_3834614_+	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
AUL70250.1|3834671_3834800_+	transporter	NA	NA	NA	NA	NA
AUL70251.1|3834801_3836097_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	2.3e-156
AUL70252.1|3836116_3836368_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AUL70253.1|3836440_3838912_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	1.5e-58
AUL70254.1|3839005_3839197_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUL70255.1|3839193_3839382_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AUL71426.1|3839731_3839935_+	hypothetical protein	NA	NA	NA	NA	NA
AUL70256.1|3839921_3840137_-	hypothetical protein	NA	NA	NA	NA	NA
AUL70257.1|3840166_3840295_-	hypothetical protein	NA	NA	NA	NA	NA
AUL71427.1|3840296_3840452_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
AUL70258.1|3840717_3841137_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
AUL70259.1|3841237_3841519_+	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
AUL70260.1|3841502_3841928_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUL70261.1|3841999_3843070_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
AUL70262.1|3843110_3843533_+	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
AUL70263.1|3843867_3845871_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	26.2	3.4e-21
AUL70264.1|3845934_3847212_+	hypothetical protein	NA	NA	NA	NA	NA
AUL70265.1|3847342_3848224_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL70266.1|3848220_3848913_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AUL70267.1|3848924_3850124_-	MFS transporter	NA	NA	NA	NA	NA
AUL70268.1|3850787_3851000_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	98.5	3.1e-26
AUL70269.1|3851167_3851446_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
AUL70270.1|3851447_3852497_+	hypothetical protein	NA	U5P0K4	Shigella_phage	54.6	1.1e-108
AUL70271.1|3852509_3852884_+	hypothetical protein	NA	V5URS4	Shigella_phage	62.7	8.4e-35
AUL70272.1|3852880_3853702_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	2.1e-78
AUL70273.1|3854288_3854567_+	hypothetical protein	NA	NA	NA	NA	NA
AUL70274.1|3855100_3855529_+	protein TolA	NA	NA	NA	NA	NA
AUL71428.1|3855700_3856075_+	tolA family protein	NA	NA	NA	NA	NA
AUL70275.1|3856326_3856542_+	Lysis protein S-like protein	NA	A5LH82	Enterobacteria_phage	95.8	5.9e-33
AUL70276.1|3856541_3857039_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
AUL70277.1|3857255_3857438_+	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
AUL70278.1|3857528_3857822_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AUL70279.1|3858184_3858379_-	hypothetical protein	NA	A0A0K2FIR8	Escherichia_phage	93.8	2.2e-26
AUL70280.1|3858767_3859313_+	protein convertase	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	1.5e-93
AUL70281.1|3859287_3861213_+|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
AUL70282.1|3861209_3861416_+|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	4.9e-29
AUL70283.1|3861412_3863014_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	3.6e-308
3862939:3862953	attR	CTGGGCGGCTGCGGC	NA	NA	NA	NA
AUL70284.1|3862994_3864314_+|capsid	capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	97.5	3.4e-232
AUL70285.1|3864323_3864656_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AUL70286.1|3864711_3865737_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
AUL70287.1|3865778_3866174_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
AUL70288.1|3866185_3866539_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
AUL70289.1|3866550_3867129_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
AUL70290.1|3867125_3867521_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
AUL71429.1|3867528_3868269_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	1.7e-132
AUL70291.1|3868284_3868707_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
AUL70292.1|3868688_3869123_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
AUL70293.1|3869115_3871677_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	89.6	0.0e+00
AUL70294.1|3871673_3872003_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AUL70295.1|3872002_3872701_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.1e-131
AUL70296.1|3872706_3873450_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.3e-148
AUL70297.1|3873347_3874019_+|tail	phage tail protein	tail	C6ZCZ4	Enterobacteria_phage	87.9	1.3e-99
AUL70298.1|3874079_3877493_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.8	0.0e+00
AUL70299.1|3877562_3878162_+	enterobacterial Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	95.5	3.5e-107
AUL71430.1|3878226_3881298_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	1.6e-67
AUL70300.1|3881297_3881879_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
>prophage 13
CP019051	Escherichia coli strain CRE1540 chromosome, complete genome	4942719	3992546	4034993	4942719	protease,transposase	uncultured_Caudovirales_phage(20.0%)	40	NA	NA
AUL71435.1|3992546_3993263_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AUL70391.1|3993598_3994048_-	hypothetical protein	NA	NA	NA	NA	NA
AUL70392.1|3994059_3998325_-	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.2	3.2e-21
AUL70393.1|3998405_3998648_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AUL70394.1|3998865_3999318_-	hypothetical protein	NA	NA	NA	NA	NA
AUL71436.1|3999347_4000238_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AUL70395.1|4000341_4001478_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AUL71437.1|4002064_4002274_-	hypothetical protein	NA	NA	NA	NA	NA
AUL70396.1|4002471_4006680_-	RHS element protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.3	4.1e-21
AUL70397.1|4006747_4008856_-	type IV secretion protein Rhs	NA	A0A077K8Q4	Ralstonia_phage	26.1	2.5e-27
AUL70398.1|4009676_4009889_-	hypothetical protein	NA	NA	NA	NA	NA
AUL70399.1|4009964_4010582_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUL70400.1|4010848_4012348_+	amino acid permease	NA	NA	NA	NA	NA
AUL70401.1|4012462_4013524_-	hypothetical protein	NA	NA	NA	NA	NA
AUL70402.1|4013606_4013732_+	tonB-dependent receptor yncD	NA	NA	NA	NA	NA
AUL71438.1|4013671_4013851_-	hypothetical protein	NA	NA	NA	NA	NA
AUL70403.1|4013765_4015868_+	TonB-dependent siderophore receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	8.1e-135
AUL70404.1|4015903_4016569_-	colanic acid/biofilm transcriptional regulator	NA	NA	NA	NA	NA
AUL70405.1|4016766_4017804_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL70406.1|4017984_4018503_+	L-amino acid N-acyltransferase MnaT	NA	NA	NA	NA	NA
AUL70407.1|4018499_4018949_+	hypothetical protein	NA	NA	NA	NA	NA
AUL70408.1|4018949_4019183_-	hypothetical protein	NA	NA	NA	NA	NA
AUL71439.1|4019268_4019490_-	hypothetical protein	NA	NA	NA	NA	NA
AUL71440.1|4019424_4019640_+	hypothetical protein	NA	NA	NA	NA	NA
AUL70409.1|4019636_4019732_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
AUL70410.1|4020133_4020943_-	acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	7.7e-17
AUL70411.1|4021152_4022577_-	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
AUL70412.1|4022598_4023393_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL70413.1|4023382_4024324_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AUL70414.1|4024324_4025338_-	spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
AUL70415.1|4025355_4026501_-	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL70416.1|4026745_4028152_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL70417.1|4028230_4028668_-	antitoxin	NA	A0A0R6PH90	Moraxella_phage	51.8	1.3e-31
AUL70418.1|4028692_4028869_-	mRNA interferase HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
AUL70419.1|4029090_4029321_+	hypothetical protein	NA	NA	NA	NA	NA
AUL70420.1|4029412_4031374_-|protease	protease	protease	Q6DW11	Phage_TP	28.9	7.1e-24
AUL70421.1|4031446_4031983_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUL70422.1|4032035_4033250_+	hypothetical protein	NA	NA	NA	NA	NA
AUL70423.1|4033289_4034498_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	92.5	1.5e-205
AUL71441.1|4034876_4034993_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
CP019051	Escherichia coli strain CRE1540 chromosome, complete genome	4942719	4525520	4587465	4942719	protease,tRNA,transposase	Escherichia_phage(13.64%)	56	NA	NA
AUL70895.1|4525520_4526285_-|protease	metalloprotease	protease	NA	NA	NA	NA
AUL70896.1|4526453_4527737_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUL70897.1|4527807_4528896_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
AUL70898.1|4529094_4529787_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AUL70899.1|4529916_4531677_+	ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
AUL70900.1|4532081_4532939_+	formate transporter FocA	NA	NA	NA	NA	NA
AUL70901.1|4532993_4535276_+	formate acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.0e-162
AUL70902.1|4535467_4536208_+	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
AUL70903.1|4536289_4536880_-	hypothetical protein	NA	NA	NA	NA	NA
AUL70904.1|4536979_4537888_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL70905.1|4537888_4539319_-	inner membrane transporter YcaM	NA	NA	NA	NA	NA
AUL70906.1|4539528_4540677_-	MFS transporter	NA	NA	NA	NA	NA
AUL70907.1|4540991_4541618_+	hydrolase	NA	NA	NA	NA	NA
AUL70908.1|4541653_4542517_-	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
AUL70909.1|4542518_4543136_-	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AUL70910.1|4543146_4545591_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	3.0e-221
AUL70911.1|4545829_4547122_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AUL70912.1|4547212_4548556_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AUL70913.1|4548566_4549178_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUL70914.1|4549332_4553400_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AUL70915.1|4553534_4554029_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AUL70916.1|4554573_4555539_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
AUL70917.1|4555661_4557428_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
AUL70918.1|4557428_4559150_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
AUL70919.1|4559191_4559896_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUL70920.1|4560180_4560399_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AUL70921.1|4560877_4561720_-	restriction endonuclease subunit M	NA	NA	NA	NA	NA
AUL70922.1|4561804_4562002_-	hypothetical protein	NA	NA	NA	NA	NA
AUL70923.1|4562013_4562502_-	hypothetical protein	NA	NA	NA	NA	NA
AUL70924.1|4562498_4562876_-	toxin	NA	NA	NA	NA	NA
AUL70925.1|4562964_4563333_-	antitoxin	NA	NA	NA	NA	NA
AUL70926.1|4563382_4564027_-	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	33.3	7.7e-28
AUL70927.1|4564045_4564267_-	hypothetical protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
AUL70928.1|4564335_4564812_-	hypothetical protein	NA	NA	NA	NA	NA
AUL70929.1|4564827_4565313_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	5.3e-13
AUL70930.1|4565404_4566223_-	hypothetical protein	NA	A0A2C9CX26	Yersinia_phage	39.3	2.1e-46
AUL70931.1|4566550_4569397_-	hypothetical protein	NA	NA	NA	NA	NA
AUL70932.1|4569768_4570641_-	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
AUL70933.1|4570904_4572461_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	2.2e-105
AUL70934.1|4572457_4573609_+	restriction endonuclease	NA	A0A1V0SKS6	Klosneuvirus	20.7	1.5e-05
AUL70935.1|4573730_4576847_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
AUL70936.1|4576994_4577975_-|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
AUL70937.1|4578094_4578475_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	98.4	2.7e-65
AUL70938.1|4578471_4578819_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AUL70939.1|4578868_4580407_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	94.3	2.2e-283
AUL70940.1|4580507_4580690_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUL70941.1|4580844_4581579_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL70942.1|4581668_4581803_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AUL70943.1|4581754_4582039_-	lysozyme	NA	NA	NA	NA	NA
AUL70944.1|4581983_4582268_-	type VI secretion protein	NA	NA	NA	NA	NA
AUL70945.1|4582774_4582966_+	hypothetical protein	NA	NA	NA	NA	NA
AUL70946.1|4583018_4583252_-	hypothetical protein	NA	NA	NA	NA	NA
AUL70947.1|4583347_4583971_-	DNA-binding protein	NA	NA	NA	NA	NA
AUL70948.1|4584231_4584627_+	hypothetical protein	NA	NA	NA	NA	NA
AUL70949.1|4584923_4585697_+	hypothetical protein	NA	NA	NA	NA	NA
AUL70950.1|4586559_4587465_-|transposase	transposase	transposase	Q9ZXG3	Shigella_phage	95.0	3.7e-169
>prophage 1
CP019053	Escherichia coli strain CRE1540 plasmid p1540-2, complete sequence	155802	18006	34530	155802	transposase	Escherichia_phage(80.0%)	18	NA	NA
AUL71596.1|18006_18711_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUL71597.1|18943_19804_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AUL71751.1|20172_20877_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUL71598.1|20910_21402_-	hypothetical protein	NA	NA	NA	NA	NA
AUL71599.1|21508_22246_+	resolvase	NA	NA	NA	NA	NA
AUL71600.1|22242_22467_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71601.1|22677_24171_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AUL71602.1|24201_25086_+	type VI secretion protein	NA	NA	NA	NA	NA
AUL71603.1|25302_26517_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
AUL71604.1|26544_26898_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL71605.1|28394_29072_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL71606.1|29103_29346_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL71607.1|29722_30427_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUL71608.1|30548_31454_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AUL71609.1|31450_32689_+	MFS transporter	NA	NA	NA	NA	NA
AUL71610.1|32688_33273_+	macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AUL71611.1|33386_33575_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71612.1|33765_34530_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 2
CP019053	Escherichia coli strain CRE1540 plasmid p1540-2, complete sequence	155802	39110	64595	155802	integrase,head,transposase,tail	Pandoravirus(20.0%)	35	44847:44861	71598:71612
AUL71621.1|39110_39260_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AUL71622.1|39360_40173_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
AUL71623.1|40176_40542_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
AUL71624.1|41218_42766_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AUL71625.1|43164_44004_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUL71626.1|43997_44345_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AUL71752.1|44461_45307_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA16	NA	NA	NA	NA	NA
44847:44861	attL	AAGAAATCTTCCGCG	NA	NA	NA	NA
AUL71627.1|45487_45961_-	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	G3MBI7	Bacillus_virus	29.1	1.4e-15
AUL71628.1|46093_46546_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
AUL71753.1|46642_47242_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AUL71754.1|47331_47559_-	hypothetical protein	NA	NA	NA	NA	NA
AUL71629.1|47488_48502_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUL71630.1|48460_48640_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL71755.1|48976_49681_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUL71631.1|50049_50910_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AUL71632.1|51142_51847_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUL71633.1|51907_52744_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AUL71634.1|52743_53547_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AUL71635.1|53607_54423_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AUL71636.1|54729_55041_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71637.1|55214_56000_+	cobalamin biosynthesis protein CobQ	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
AUL71638.1|56003_57185_+	chromosome partitioning protein ParB	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
AUL71639.1|57233_57506_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71640.1|57558_58194_-	restriction endonuclease subunit M	NA	NA	NA	NA	NA
AUL71641.1|58747_59125_+	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	2.2e-22
AUL71642.1|59117_59399_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71643.1|59373_60048_+	thymidylate kinase	NA	NA	NA	NA	NA
AUL71644.1|60040_60547_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71645.1|60531_60864_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71646.1|60872_61373_+	hypothetical protein	NA	I3UMJ0	Colwellia_phage	43.3	1.7e-19
AUL71647.1|61376_62804_+	DNA methyltransferase	NA	NA	NA	NA	NA
AUL71648.1|62803_63460_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71649.1|63398_63662_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71650.1|63665_63884_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71651.1|63977_64595_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
71598:71612	attR	CGCGGAAGATTTCTT	NA	NA	NA	NA
>prophage 1
CP019054	Escherichia coli strain CRE1540 plasmid p1540-3, complete sequence	116028	546	115598	116028	lysis,transposase,plate,tail,portal,head,integrase,terminase,holin	Escherichia_phage(64.08%)	129	64251:64310	78321:79141
AUL71764.1|546_1158_-|tail	phage tail protein	tail	Q71TN8	Escherichia_phage	99.5	2.9e-109
AUL71765.1|1168_1735_-	hypothetical protein	NA	A0A077SK12	Escherichia_phage	99.5	6.6e-100
AUL71766.1|1815_2355_-	hypothetical protein	NA	A0A077SL46	Escherichia_phage	99.4	6.8e-46
AUL71767.1|2358_2880_-	hypothetical protein	NA	Q1MVK8	Enterobacteria_phage	100.0	5.4e-56
AUL71768.1|3288_3459_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL71769.1|3710_4754_+	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	92.5	2.0e-171
AUL71770.1|4917_5718_+	DNA-binding protein	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
AUL71771.1|5747_6593_+	Replication protein repL	NA	Q1MVK3	Enterobacteria_phage	98.2	2.1e-150
AUL71885.1|6643_6889_+	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
AUL71772.1|7070_7226_+	protein hokC	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
AUL71773.1|7256_7397_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL71774.1|7419_8532_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUL71775.1|8691_9201_-|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
AUL71776.1|9212_9794_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	7.3e-102
AUL71777.1|9829_10645_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	7.5e-113
AUL71778.1|10654_12244_-	hypothetical protein	NA	Q71TB2	Escherichia_phage	100.0	1.1e-306
AUL71779.1|12304_14011_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	100.0	0.0e+00
AUL71780.1|14236_15238_-	chromosome partitioning protein ParB	NA	Q38420	Escherichia_phage	100.0	1.7e-178
AUL71781.1|15254_16451_-	chromosome partitioning protein ParA	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
AUL71782.1|17721_18606_-	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	100.0	9.5e-162
AUL71783.1|18940_19333_-	hypothetical protein	NA	Q71TL7	Escherichia_phage	100.0	1.5e-71
AUL71784.1|19510_19933_-	ppfA	NA	Q71TL5	Escherichia_phage	100.0	5.0e-60
AUL71785.1|19972_20761_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	93.9	1.4e-116
AUL71786.1|20769_21054_-	alanine racemase	NA	Q71TL3	Escherichia_phage	98.9	3.8e-48
AUL71787.1|21223_21508_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.7e-48
AUL71788.1|21500_22406_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.3	1.0e-158
AUL71789.1|22402_24667_+	multidrug DMT transporter permease	NA	A0A077SL51	Escherichia_phage	68.3	0.0e+00
AUL71790.1|25841_26033_-	hypothetical protein	NA	Q71T98	Escherichia_phage	100.0	6.0e-29
AUL71791.1|26224_26650_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	100.0	1.8e-70
AUL71792.1|27080_27296_-	hypothetical protein	NA	NA	NA	NA	NA
AUL71793.1|27286_28651_+	replicative DNA helicase	NA	O80281	Escherichia_phage	99.8	1.6e-253
AUL71794.1|28650_29649_+	hypothetical protein	NA	Q71TK3	Escherichia_phage	100.0	1.9e-195
AUL71795.1|29695_30328_-|plate	baseplate protein	plate	Q71TK2	Escherichia_phage	100.0	6.9e-90
AUL71796.1|30320_31337_-|tail	phage tail tape measure protein	tail	Q71T91	Escherichia_phage	100.0	2.7e-192
AUL71797.1|31338_32124_-|plate	baseplate	plate	Q71T90	Escherichia_phage	100.0	9.4e-145
AUL71798.1|32110_32839_-|tail	phage tail protein	tail	Q71TJ9	Escherichia_phage	100.0	4.2e-139
AUL71799.1|32842_34060_-|tail	phage tail protein	tail	Q71T88	Escherichia_phage	100.0	1.4e-224
AUL71800.1|34069_34447_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
AUL71801.1|34593_34839_+	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
AUL71802.1|34841_35420_+	norphogenetic protein	NA	Q71T85	Escherichia_phage	100.0	1.5e-107
AUL71803.1|35486_35642_+	norphogenetic protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
AUL71804.1|35583_36246_+	norphogenetic protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
AUL71805.1|36143_36770_+	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
AUL71806.1|36766_37444_+	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
AUL71807.1|37440_38142_+	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	100.0	4.2e-144
AUL71808.1|38223_38442_+	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
AUL71809.1|38443_39706_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.8	2.7e-234
AUL71810.1|39778_40285_+	3'-phosphatase	NA	A0A1B0VAK0	Salmonella_phage	98.2	3.5e-92
AUL71811.1|40549_43666_-	DEAD/DEAH box helicase	NA	A0A220A398	Liberibacter_phage	24.2	2.2e-27
AUL71812.1|43787_44993_-	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
AUL71886.1|44989_46546_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	2.2e-105
AUL71813.1|46728_46950_+	prevent-host-death family protein	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AUL71814.1|46949_47330_+	death-on-curing family protein	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
AUL71815.1|47334_47514_+	PdcA protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
AUL71816.1|47541_48585_+	hypothetical protein	NA	A0A1B0VBU2	Salmonella_phage	99.1	2.2e-205
AUL71817.1|48673_49126_+	Late promoter-activating protein	NA	Q71T63	Escherichia_phage	98.7	2.0e-78
AUL71818.1|49212_50406_+|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	94.0	1.3e-201
AUL71819.1|50405_51890_+|terminase	terminase	terminase	Q71T61	Escherichia_phage	100.0	1.5e-292
AUL71820.1|51915_52767_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	4.0e-157
AUL71821.1|52877_53087_-	c1 repressor inactivator	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
AUL71887.1|53052_53148_-	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
AUL71822.1|53691_53913_+	creatininase	NA	Q5QBN7	Enterobacteria_phage	98.6	1.7e-35
AUL71823.1|53920_54952_+	recombinase	NA	A0A077SLE7	Escherichia_phage	99.4	1.4e-193
AUL71824.1|55002_55314_+	lysogeny establishment protein	NA	A0A077SK03	Escherichia_phage	98.1	8.8e-46
AUL71825.1|56486_56879_+	NimC/NimA family protein	NA	NA	NA	NA	NA
AUL71826.1|57198_57585_-	bleomycin binding protein	NA	NA	NA	NA	NA
AUL71827.1|57623_57833_+	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	89.5	8.9e-10
AUL71828.1|57778_58483_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AUL71829.1|58459_58552_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL71830.1|60996_61749_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
AUL71831.1|61514_62165_-	AAC(3) family N-acetyltransferase	NA	O64018	Bacillus_phage	52.9	7.8e-28
AUL71832.1|62170_63196_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
AUL71833.1|63182_63404_-	hypothetical protein	NA	NA	NA	NA	NA
AUL71834.1|63424_64201_-	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
64251:64310	attL	CGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
AUL71835.1|64314_65019_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUL71888.1|65048_65507_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL71836.1|65509_66502_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL71837.1|66470_66971_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUL71838.1|66989_67169_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71839.1|67098_67938_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUL71840.1|67931_68279_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AUL71841.1|68442_69234_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AUL71889.1|69239_69485_-	hypothetical protein	NA	NA	NA	NA	NA
AUL71842.1|69641_70139_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AUL71891.1|70135_70354_-	hypothetical protein	NA	NA	NA	NA	NA
AUL71843.1|70283_71297_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUL71844.1|71255_71435_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL71845.1|71499_71850_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL71846.1|71975_72512_+	DNA resolvase	NA	A0A1B0V7I5	Salmonella_phage	85.2	4.9e-44
AUL71847.1|72522_72633_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL71890.1|72595_72682_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL71848.1|72756_73260_+	insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	100.0	1.5e-95
AUL71849.1|73472_74114_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AUL71850.1|74527_75331_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AUL71851.1|75330_76167_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AUL71852.1|76138_76366_-	hypothetical protein	NA	A0A1B0VFY5	Salmonella_phage	88.2	8.7e-11
AUL71853.1|76502_77318_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
AUL71854.1|77611_78316_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUL71855.1|79699_79855_+	recombination enhancement function protein	NA	Q71TG3	Escherichia_phage	95.7	1.0e-18
78321:79141	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGAAACGACTGAGCAAAATGATCAGTGATCTACTCCCTCCGGTGGATTTAACGGAGTTGCTGCTCGAAATTAACGCCCATACCGGATTTGCTGATGAGTTTTTCCATGCTAGTGAAGCCAGTGCCAGAGTTGATGATCTGCCCGTCAGCATCAGCGCCGTGCTGATGGCTGAAGCCTGCAATATCGGTCTGGAACCACTGATCAGATCAAATGTTCCTGCACTGACCCGACACCGGCTGAACTGGACAAAAGCGAACTATCTGCGGGCTGAAACTATCACCAGCGCTAATGCCAGACTGGTTGATTTTCAGGCAACGCTGCCACTGGCACAGATATGGGGTGGAGGAGAAGTGGCATCTGCAGATGGAATGCGCTTTGTTACGCCAGTCAGAACAATCAATGCCGGACCGAACCGCAAATACTTTGGTAATAACAGAGGGATCACCTGGTACAACTTTGTGTCCGATCAGTATTCCGGCTTTCATGGCATCGTTATACCGGGGACGCTGAGGGACTCTATCTTTGTGCTGGAAGGTCTTCTGGAACAGGAGACCGGGCTGAATCCAACCGAAATTATGACCGATACAGCAGGTGCCAGCGAACTTGTCTTTGGCCTTTTCTGGCTGCTGGGATACCAGTTTTCTCCACGCCTGGCTGATGCCGGTGCTTCGGTTTTCTGGCGAATGGACCATGATGCCGACTATGGCGTGCTGAATGATATTGCCAGAGGGCAATCAGATCCCCGAAAAATAGTCCTTCAGTG	NA	NA	NA	NA
AUL71856.1|80044_80686_+	maturation control protein	NA	A0A077SK30	Escherichia_phage	96.7	1.2e-110
AUL71857.1|80788_81916_+	GTP pyrophosphokinase	NA	A0A1B0VBT5	Salmonella_phage	74.1	7.6e-156
AUL71858.1|81952_82201_-	modulator protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
AUL71859.1|82197_82638_-	peptide-binding protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
AUL71860.1|82671_89439_-	helicase	NA	Q1MVN7	Enterobacteria_phage	98.8	0.0e+00
AUL71861.1|89514_91224_+|portal	phage portal protein	portal	Q1MVN6	Enterobacteria_phage	99.6	0.0e+00
AUL71862.1|91216_92236_+|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
AUL71863.1|92215_92392_-|holin	antiholin	holin	Q71TR5	Escherichia_phage	96.6	7.2e-29
AUL71892.1|92527_93085_-	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
AUL71864.1|93254_93743_+	ssDNA-binding protein	NA	Q1MVN2	Enterobacteria_phage	98.8	2.5e-87
AUL71865.1|93976_95089_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	95.7	1.0e-197
AUL71866.1|95831_96143_-	hypothetical protein	NA	A0A077SLG5	Escherichia_phage	100.0	1.8e-46
AUL71867.1|96132_99120_-	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.2	0.0e+00
AUL71868.1|99132_99498_-	ddrA	NA	A0A077SK35	Escherichia_phage	99.2	2.3e-45
AUL71869.1|99494_101414_-	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	96.2	0.0e+00
AUL71870.1|101415_102018_-	odaE	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
AUL71871.1|102004_102448_-|lysis	lysis protein	lysis	A0A077SK09	Escherichia_phage	99.3	2.2e-82
AUL71872.1|102444_102774_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
AUL71873.1|102841_103123_-	hypothetical protein	NA	Q71TD9	Escherichia_phage	98.9	1.8e-45
AUL71874.1|103250_103811_+	DNA-invertase	NA	Q71TD8	Escherichia_phage	100.0	2.1e-98
AUL71875.1|103858_105094_+|tail	phage tail protein	tail	A0A077SK37	Escherichia_phage	65.3	3.4e-181
AUL71876.1|105096_105630_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	99.4	3.2e-96
AUL71877.1|105658_106186_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	97.7	7.3e-93
AUL71878.1|106189_109030_-|tail	phage tail protein	tail	Q71TP5	Escherichia_phage	83.3	0.0e+00
AUL71879.1|109041_109476_-|tail	phage tail protein	tail	A0A077SLL3	Escherichia_phage	99.3	9.6e-75
AUL71880.1|109554_110391_-|tail	phage tail protein	tail	A0A077SLH5	Escherichia_phage	99.3	5.8e-153
AUL71881.1|110390_111824_-	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	100.0	3.7e-272
AUL71882.1|111820_112177_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
AUL71883.1|112176_115197_-	transglycosylase	NA	A0A077SK38	Escherichia_phage	99.2	0.0e+00
AUL71884.1|115235_115598_-	hypothetical protein	NA	Q1MVL3	Enterobacteria_phage	95.5	3.4e-49
>prophage 1
CP019055	Escherichia coli strain CRE1540 plasmid p1540-4, complete sequence	184166	9695	43867	184166	bacteriocin,tRNA,transposase	Shigella_phage(20.0%)	33	NA	NA
AUL71900.1|9695_9806_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL72084.1|9768_9855_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL71901.1|9929_10433_+|transposase	transposase	transposase	U5P0U6	Shigella_phage	99.4	1.7e-94
AUL71902.1|10829_11495_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71903.1|11552_11843_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71904.1|13615_13981_-|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
AUL71905.1|13991_14216_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71906.1|14232_14622_-	cytochrome B562	NA	NA	NA	NA	NA
AUL71907.1|15055_15946_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL71908.1|16023_17247_-	cytosine permease	NA	NA	NA	NA	NA
AUL71909.1|17269_17659_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	NA	NA	NA	NA
AUL71910.1|17675_18632_-	carbamate kinase	NA	NA	NA	NA	NA
AUL71911.1|18624_20049_-	hypothetical protein	NA	NA	NA	NA	NA
AUL71912.1|20045_21605_-	hypothetical protein	NA	NA	NA	NA	NA
AUL71913.1|21699_22560_-	hypothetical protein	NA	NA	NA	NA	NA
AUL71914.1|22565_23234_-	cysteine hydrolase	NA	NA	NA	NA	NA
AUL71915.1|24261_24507_-	hypothetical protein	NA	Q7Y2I5	Escherichia_phage	76.8	2.0e-21
AUL71916.1|25651_25867_+	plasmid stabilization system family protein	NA	NA	NA	NA	NA
AUL71917.1|25912_26101_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71918.1|26619_26853_+	HNH endonuclease	NA	NA	NA	NA	NA
AUL71919.1|26853_27111_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AUL71920.1|27188_28421_-	MFS transporter	NA	NA	NA	NA	NA
AUL71921.1|28432_29194_-	sugar ABC transporter substrate-binding protein	NA	A0A1V0SE00	Indivirus	30.2	1.2e-14
AUL71922.1|29193_30231_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL71923.1|30230_31229_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL71924.1|31583_32174_-	resolvase	NA	A0A0A7NPV4	Enterobacteria_phage	38.3	6.2e-24
AUL72085.1|32065_32290_-	hypothetical protein	NA	NA	NA	NA	NA
AUL71925.1|32751_33762_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.5	2.1e-19
AUL71926.1|34228_34594_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL71927.1|34715_35867_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	3.4e-42
AUL71928.1|36832_40966_+	outer membrane autotransporter barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	41.6	4.3e-297
AUL71929.1|43142_43490_-|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AUL72086.1|43486_43867_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
>prophage 2
CP019055	Escherichia coli strain CRE1540 plasmid p1540-4, complete sequence	184166	64836	107953	184166	protease,integrase,transposase	Shigella_phage(31.25%)	47	53212:53227	80543:80558
53212:53227	attL	AACAATTATTATCAAC	NA	NA	NA	NA
AUL72088.1|64836_65397_-|integrase	integrase	integrase	NA	NA	NA	NA
AUL71949.1|66048_66231_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71950.1|66499_66688_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	61.5	1.1e-06
AUL71951.1|66745_67039_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
AUL71952.1|67204_67393_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71953.1|67696_67789_-	hypothetical protein	NA	NA	NA	NA	NA
AUL71954.1|67745_68111_+|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
AUL71955.1|68068_68974_+|transposase	transposase	transposase	Q9ZXG3	Shigella_phage	99.0	6.9e-176
AUL71956.1|69428_70622_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
AUL71957.1|70591_70744_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71958.1|72686_72875_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71959.1|72884_73826_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71960.1|73921_74200_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AUL71961.1|74341_74566_+|transposase	transposase	transposase	A0A2L1IV22	Escherichia_phage	98.6	7.0e-37
AUL71962.1|74484_74988_+|transposase	transposase	transposase	U5P0U6	Shigella_phage	91.9	1.0e-83
AUL71963.1|75399_76770_-	RND transporter	NA	NA	NA	NA	NA
AUL71964.1|76773_78714_-	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	39.0	1.8e-35
AUL71965.1|78710_79898_-	efflux transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	54.7	7.8e-10
AUL71966.1|81743_82007_+	hypothetical protein	NA	NA	NA	NA	NA
80543:80558	attR	GTTGATAATAATTGTT	NA	NA	NA	NA
AUL71967.1|82373_82763_-|protease	outer membrane protease	protease	NA	NA	NA	NA
AUL71968.1|82866_83820_+|protease	outer membrane protease	protease	NA	NA	NA	NA
AUL71969.1|83909_84194_-	hypothetical protein	NA	NA	NA	NA	NA
AUL71970.1|84252_85362_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
AUL71971.1|85424_86333_+	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
AUL71972.1|86706_86895_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AUL71973.1|87015_87756_+	site-specific recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
AUL71974.1|88040_89018_-	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
AUL71975.1|89010_89181_-	hypothetical protein	NA	NA	NA	NA	NA
AUL71976.1|89689_89911_-	hypothetical protein	NA	NA	NA	NA	NA
AUL71977.1|90944_91448_-|transposase	transposase	transposase	U5P0U6	Shigella_phage	98.2	1.2e-92
AUL71978.1|91366_91642_-|transposase	transposase	transposase	Q71TE9	Escherichia_phage	96.7	2.9e-45
AUL71979.1|91683_91875_+	prephenate dehydratase	NA	NA	NA	NA	NA
AUL71980.1|91997_92912_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL71981.1|92911_93739_+	manganese/iron transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
AUL71982.1|93735_94593_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71983.1|94589_95447_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AUL71984.1|95914_96349_+	enolase	NA	W6LP63	Streptococcus_phage	55.2	9.4e-38
AUL71985.1|96345_96618_+	hypothetical protein	NA	NA	NA	NA	NA
AUL71986.1|96689_97070_+	fluoride ion transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
AUL71987.1|97449_98643_-	MFS transporter	NA	NA	NA	NA	NA
AUL71988.1|98721_100503_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
AUL71989.1|100503_101451_+	acetyltransferase	NA	NA	NA	NA	NA
AUL71990.1|101450_103193_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
AUL71991.1|103189_104467_+	L-lysine N6-monooxygenase	NA	NA	NA	NA	NA
AUL71992.1|104548_106750_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUL72089.1|107288_107375_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL71993.1|107449_107953_+|transposase	transposase	transposase	U5P0U6	Shigella_phage	99.4	1.7e-94
>prophage 3
CP019055	Escherichia coli strain CRE1540 plasmid p1540-4, complete sequence	184166	119344	149473	184166	integrase,transposase	Shigella_phage(20.0%)	38	117729:117742	126695:126708
117729:117742	attL	GAATATAAATGTCA	NA	NA	NA	NA
AUL72006.1|119344_120250_-|integrase	integrase	integrase	Q9ZXG3	Shigella_phage	99.7	3.3e-178
AUL72007.1|120207_120573_-|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
AUL72092.1|120529_120679_+	nitrite extrusion protein 2	NA	NA	NA	NA	NA
AUL72008.1|120737_121184_+	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	55.3	1.8e-28
AUL72009.1|121279_121537_-	hypothetical protein	NA	NA	NA	NA	NA
AUL72010.1|122265_122478_+	hypothetical protein	NA	NA	NA	NA	NA
AUL72011.1|123604_123781_-	microcin J25	NA	NA	NA	NA	NA
AUL72012.1|124120_124747_+	microcin J25-processing protein McjB	NA	NA	NA	NA	NA
AUL72013.1|124749_126291_+	microcin J25-processing protein McjC	NA	NA	NA	NA	NA
AUL72014.1|126293_128036_+	microcin ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.4	2.7e-19
126695:126708	attR	TGACATTTATATTC	NA	NA	NA	NA
AUL72015.1|128360_128819_-	resolvase	NA	NA	NA	NA	NA
AUL72016.1|128906_129182_+|transposase	transposase	transposase	Q71TE9	Escherichia_phage	97.8	1.3e-45
AUL72017.1|129100_129604_+|transposase	transposase	transposase	U5P0U6	Shigella_phage	99.4	1.7e-94
AUL72018.1|129903_131070_+	protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
AUL72019.1|131069_132041_+	plasmid-partitioning protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
AUL72020.1|132881_133340_+	hypothetical protein	NA	NA	NA	NA	NA
AUL72021.1|133517_134093_+	hypothetical protein	NA	NA	NA	NA	NA
AUL72022.1|134238_135105_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
AUL72023.1|135101_135401_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL72024.1|135839_136811_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	31.7	1.9e-25
AUL72025.1|137212_137638_+	antirestriction protein	NA	NA	NA	NA	NA
AUL72026.1|137684_138104_+	hypothetical protein	NA	NA	NA	NA	NA
AUL72027.1|138103_138286_+	hypothetical protein	NA	NA	NA	NA	NA
AUL72028.1|138407_138602_-	pilus assembly protein	NA	NA	NA	NA	NA
AUL72093.1|138600_138792_+	hypothetical protein	NA	NA	NA	NA	NA
AUL72029.1|138759_139017_-	hypothetical protein	NA	NA	NA	NA	NA
AUL72030.1|139277_139508_+	hypothetical protein	NA	NA	NA	NA	NA
AUL72031.1|139559_140921_+	hydrolase	NA	NA	NA	NA	NA
AUL72032.1|140967_141531_+	SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.0	3.6e-21
AUL72033.1|142008_142980_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUL72034.1|143300_143507_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AUL72035.1|143532_144072_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.9	1.2e-45
AUL72036.1|144129_144363_+	hypothetical protein	NA	NA	NA	NA	NA
AUL72037.1|144421_146386_+	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	27.7	9.2e-24
AUL72038.1|146454_146889_+	protein PsiB	NA	NA	NA	NA	NA
AUL72039.1|146885_147113_+	psiA family protein	NA	NA	NA	NA	NA
AUL72040.1|147170_147917_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
AUL72041.1|147931_149473_-|transposase	transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
>prophage 4
CP019055	Escherichia coli strain CRE1540 plasmid p1540-4, complete sequence	184166	178269	182638	184166	integrase,transposase	Escherichia_phage(50.0%)	10	NA	NA
AUL72074.1|178269_178557_+	addiction module toxin RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	1.3e-19
AUL72075.1|178660_179062_+	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	100.0	7.9e-07
AUL72076.1|178996_179374_-|transposase	transposase	transposase	U5P0U6	Shigella_phage	93.6	6.9e-61
AUL72099.1|179311_179419_+|integrase	integrase	integrase	NA	NA	NA	NA
AUL72077.1|179432_180455_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AUL72078.1|180451_181234_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.2	2.2e-138
AUL72079.1|181533_181620_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL72080.1|181582_181693_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL72081.1|181911_182151_+	hypothetical protein	NA	NA	NA	NA	NA
AUL72082.1|182317_182638_+|transposase	transposase	transposase	Q716C2	Shigella_phage	41.0	3.5e-13
