The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP018896	Bordetella holmesii isolate H785 chromosome, complete genome	3687739	149309	195926	3687739	protease,transposase	uncultured_Mediterranean_phage(22.22%)	49	NA	NA
AUL38167.1|149309_149747_-|protease	ClpXP protease specificity-enhancing factor	protease	NA	NA	NA	NA
AUL38168.1|149755_150367_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUL38169.1|150519_151371_-	cytochrome c1	NA	NA	NA	NA	NA
AUL38170.1|151395_152784_-	cytochrome b	NA	NA	NA	NA	NA
AUL38171.1|152865_153507_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AUL38172.1|153655_154093_+	large-conductance mechanosensitive channel protein	NA	NA	NA	NA	NA
AUL38173.1|154150_154927_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AUL38174.1|154946_156077_+	2-alkenal reductase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	37.2	3.0e-11
AUL38175.1|156141_156927_-	twin arginine-targeting protein translocase TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	34.4	5.0e-29
AUL38176.1|156923_157421_-	twin arginine-targeting protein translocase TatB	NA	NA	NA	NA	NA
AUL38177.1|157469_157691_-	Sec-independent protein translocase TatA	NA	NA	NA	NA	NA
AUL38178.1|157706_158075_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
AUL38179.1|158082_158433_-	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
AUL38180.1|158429_158834_-	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
AUL38181.1|158835_159651_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
AUL38182.1|159647_160388_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
AUL38183.1|160454_161141_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
AUL38184.1|161159_161747_-	imidazoleglycerol-phosphate dehydratase	NA	NA	NA	NA	NA
AUL38185.1|161748_162843_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AUL38186.1|162839_164147_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
AUL38187.1|164172_164844_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
AUL38188.1|164840_166106_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUL38189.1|166105_166351_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
AUL38190.1|166354_167152_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AUL38191.1|167148_167958_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	2.8e-19
AUL38192.1|168094_168721_-	ABC transporter	NA	NA	NA	NA	NA
AUL38193.1|168746_169538_-	hypothetical protein	NA	NA	NA	NA	NA
AUL38194.1|169602_170091_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AUL38195.1|170103_170886_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL38196.1|170882_171719_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.7e-22
AUL38197.1|171900_172881_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL38198.1|172945_173581_-	hypothetical protein	NA	NA	NA	NA	NA
AUL38199.1|173781_175248_-	glutamate synthase	NA	NA	NA	NA	NA
AUL38200.1|175256_179996_-	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
AUL38201.1|180349_181570_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL38202.1|181685_182429_-	hypothetical protein	NA	NA	NA	NA	NA
AUL38203.1|182598_183705_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.1	1.4e-32
AUL38204.1|183715_184555_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AUL38205.1|184612_185302_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38206.1|185398_185851_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38207.1|185854_187075_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL38208.1|187298_188186_+	RNA polymerase factor sigma-32	NA	A0A248SJA5	Salicola_phage	38.5	2.1e-39
AUL41171.1|188500_189286_-	phosphodiesterase	NA	NA	NA	NA	NA
AUL38209.1|192128_192905_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AUL38210.1|193397_193658_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL38211.1|193750_194251_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL38212.1|194285_194555_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
AUL38213.1|194526_194877_+	bifunctional protein GlmU	NA	NA	NA	NA	NA
AUL38214.1|194975_195926_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP018896	Bordetella holmesii isolate H785 chromosome, complete genome	3687739	227716	264530	3687739	transposase	Leptospira_phage(40.0%)	32	NA	NA
AUL38238.1|227716_227977_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL38239.1|228069_228570_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL38240.1|228943_230164_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL38241.1|230818_232096_+	cytosine deaminase	NA	NA	NA	NA	NA
AUL38242.1|232150_232717_-	cysteine dioxygenase	NA	NA	NA	NA	NA
AUL38243.1|232802_233966_-	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUL38244.1|234134_234419_+	acylphosphatase	NA	NA	NA	NA	NA
AUL38245.1|234442_235081_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL38246.1|235202_236174_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL38247.1|237752_238523_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL38248.1|238734_239685_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL41179.1|239657_240161_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	49.7	3.4e-39
AUL38249.1|240237_241242_-	hypothetical protein	NA	NA	NA	NA	NA
AUL38250.1|241313_242882_-	acetolactate synthase large subunit	NA	G9E4W7	Ostreococcus_lucimarinus_virus	27.1	4.5e-05
AUL38251.1|243018_244068_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AUL38252.1|244070_245255_+	CoA transferase	NA	NA	NA	NA	NA
AUL38253.1|245283_246414_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL38254.1|246426_247569_+	carnitine dehydratase	NA	NA	NA	NA	NA
AUL38255.1|249378_249993_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL38256.1|250041_250944_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL38257.1|251070_251460_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUL38258.1|251461_252343_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
AUL38259.1|252371_253340_+	MFS transporter	NA	NA	NA	NA	NA
AUL38260.1|253548_254538_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL38261.1|256087_256867_+	oxidoreductase	NA	NA	NA	NA	NA
AUL41180.1|256897_258643_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AUL38262.1|258639_259542_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
AUL38263.1|259825_261034_+	ferredoxin reductase	NA	NA	NA	NA	NA
AUL38264.1|261215_261479_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38265.1|261484_261964_+	DUF188 domain-containing protein	NA	NA	NA	NA	NA
AUL38266.1|262024_263134_-	porin	NA	NA	NA	NA	NA
AUL38267.1|263309_264530_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 3
CP018896	Bordetella holmesii isolate H785 chromosome, complete genome	3687739	586707	655541	3687739	transposase,tRNA	Staphylococcus_phage(21.43%)	59	NA	NA
AUL38542.1|586707_587571_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL38543.1|587654_588782_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
AUL38544.1|588790_590206_-	metallopeptidase	NA	A8ATH6	Listeria_phage	42.7	6.7e-16
AUL38545.1|590485_591715_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
AUL38546.1|591753_592410_+	phospholipid-binding protein	NA	NA	NA	NA	NA
AUL38547.1|592613_593864_+	serine hydroxymethyltransferase	NA	A0A219YCZ0	Aeromonas_phage	52.2	2.8e-98
AUL38548.1|594024_594510_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AUL38549.1|594514_595477_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL38550.1|595476_596037_-	hydrolase	NA	NA	NA	NA	NA
AUL38551.1|596072_597347_+	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	31.9	1.5e-38
AUL38552.1|597368_598010_+	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	36.1	7.2e-26
AUL38553.1|600297_601560_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38554.1|601556_603077_+	SpoVR family protein	NA	NA	NA	NA	NA
AUL38555.1|603073_603910_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL38556.1|605147_606047_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL38557.1|606422_607079_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUL38558.1|607256_607664_-	alkylhydroperoxidase	NA	NA	NA	NA	NA
AUL38559.1|608978_610199_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL38560.1|610195_610666_+	MFS permease	NA	NA	NA	NA	NA
AUL38561.1|610675_611131_-	hypothetical protein	NA	NA	NA	NA	NA
AUL38562.1|612098_613667_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AUL38563.1|613889_614327_+	universal stress protein	NA	NA	NA	NA	NA
AUL38564.1|614338_614749_-	hypothetical protein	NA	NA	NA	NA	NA
AUL38565.1|614779_615553_-	NADH pyrophosphatase	NA	NA	NA	NA	NA
AUL38566.1|615780_617883_+	dehydrogenase	NA	NA	NA	NA	NA
AUL38567.1|618391_619240_+	two-component response regulator	NA	NA	NA	NA	NA
AUL38568.1|619259_619475_-	hypothetical protein	NA	NA	NA	NA	NA
AUL38569.1|619629_620526_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38570.1|620629_621520_+	nicotinate-nucleotide diphosphorylase (carboxylating)	NA	NA	NA	NA	NA
AUL38571.1|621596_622565_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL38572.1|622565_623276_-	hypothetical protein	NA	NA	NA	NA	NA
AUL38573.1|623351_625445_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL38574.1|625474_625783_-	hypothetical protein	NA	NA	NA	NA	NA
AUL38575.1|625969_626755_-	enoyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
AUL38576.1|626813_628226_-	lytic transglycosylase	NA	A0A223LD43	Bacillus_phage	29.3	2.1e-06
AUL38577.1|628233_629043_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AUL38578.1|629060_629825_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL38579.1|629893_630355_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	51.5	4.5e-38
AUL38580.1|630479_631562_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUL38581.1|631577_631775_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38582.1|631737_632958_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL38583.1|635967_636702_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	42.4	2.6e-40
AUL38584.1|636870_638091_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL38585.1|638465_639452_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AUL38586.1|639455_642179_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	6.6e-20
AUL38587.1|642179_643307_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38588.1|643319_644732_+	RND transporter	NA	NA	NA	NA	NA
AUL38589.1|644906_645563_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL38590.1|645583_646630_+	glycosyltransferase	NA	F1C5B0	Cronobacter_phage	39.5	1.4e-58
AUL38591.1|646626_648216_+	dolichyl-phosphate-mannose--protein mannosyltransferase	NA	NA	NA	NA	NA
AUL38592.1|648370_649480_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38593.1|649469_650366_-	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	33.1	6.5e-09
AUL38594.1|650412_651045_-	hypothetical protein	NA	NA	NA	NA	NA
AUL38595.1|651069_651954_-	EamA family transporter	NA	NA	NA	NA	NA
AUL38596.1|652081_653563_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL38597.1|653635_653980_+	TIGR01244 family protein	NA	NA	NA	NA	NA
AUL38598.1|654065_654530_+	universal stress protein	NA	NA	NA	NA	NA
AUL38599.1|654687_654948_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL38600.1|655040_655541_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	49.7	2.8e-41
>prophage 4
CP018896	Bordetella holmesii isolate H785 chromosome, complete genome	3687739	658849	723896	3687739	transposase,tRNA	Ralstonia_virus(42.86%)	58	NA	NA
AUL38603.1|658849_659800_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL38604.1|659832_660279_+|tRNA	cys-tRNA(pro)/cys-tRNA(cys) deacylase	tRNA	NA	NA	NA	NA
AUL38605.1|660327_661017_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
AUL38606.1|661104_661599_-	peptidoglycan-associated lipoprotein	NA	NA	NA	NA	NA
AUL38607.1|661630_662947_-	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
AUL38608.1|662963_663884_-	protein TolA	NA	NA	NA	NA	NA
AUL38609.1|663918_664380_-	protein TolR	NA	NA	NA	NA	NA
AUL38610.1|664379_665054_-	protein TolQ	NA	NA	NA	NA	NA
AUL38611.1|665056_665479_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUL38612.1|665532_667263_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	28.6	1.2e-11
AUL38613.1|667328_667898_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AUL38614.1|667878_668565_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL38615.1|668584_670090_+	sensor histidine kinase	NA	NA	NA	NA	NA
AUL38616.1|670318_670768_+	tripartite tricarboxylate transporter TctB	NA	NA	NA	NA	NA
AUL38617.1|670773_672294_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38618.1|672347_673568_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL38619.1|673664_674594_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL38620.1|674752_675658_-	oxidoreductase	NA	NA	NA	NA	NA
AUL38621.1|675857_677078_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL38622.1|677133_678639_-	hypothetical protein	NA	NA	NA	NA	NA
AUL38623.1|678660_679116_-	tricarboxylate transporter	NA	NA	NA	NA	NA
AUL38624.1|679472_680045_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38625.1|680044_680356_+	cell division protein ZapA	NA	NA	NA	NA	NA
AUL38626.1|680669_681431_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38627.1|681399_682194_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AUL38628.1|682372_682708_+	cytochrome C	NA	NA	NA	NA	NA
AUL38629.1|682724_683282_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AUL38630.1|683343_684456_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
AUL38631.1|684596_685073_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL38632.1|691414_691609_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38633.1|691736_691997_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL38634.1|692089_692590_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL38635.1|692827_693202_+	hypothetical protein	NA	NA	NA	NA	NA
AUL41200.1|693419_693698_-	DNA topoisomerase III	NA	NA	NA	NA	NA
AUL38636.1|693846_695040_+	peptidase M20	NA	NA	NA	NA	NA
AUL38637.1|695052_696111_+	dihydroorotase	NA	NA	NA	NA	NA
AUL38638.1|696148_697957_-	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	29.5	2.5e-44
AUL38639.1|698731_699160_+	cell division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
AUL38640.1|699168_700242_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	NA	NA	NA	NA
AUL38641.1|700241_700529_+	cell division protein FtsL	NA	NA	NA	NA	NA
AUL38642.1|700525_702259_+	cell division protein	NA	NA	NA	NA	NA
AUL38643.1|702255_705078_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
AUL38644.1|705067_706237_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AUL38645.1|706233_707766_+	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	NA	NA	NA	NA
AUL38646.1|707762_708956_+	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
AUL38647.1|708952_710026_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AUL38648.1|710022_711429_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
AUL38649.1|711425_712379_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AUL38650.1|712387_713212_+	cell division protein FtsQ	NA	NA	NA	NA	NA
AUL38651.1|713216_714443_+	cell division protein FtsA	NA	NA	NA	NA	NA
AUL38652.1|714638_715823_+	cell division protein FtsZ	NA	NA	NA	NA	NA
AUL38653.1|716062_716986_+	UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
AUL38654.1|717076_717292_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38655.1|717328_717823_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
AUL38656.1|717865_718849_+	peptidase M23	NA	A0A292GJG6	Xanthomonas_phage	47.7	1.2e-27
AUL38657.1|719009_721745_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AUL38658.1|721746_722466_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38659.1|722675_723896_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 5
CP018896	Bordetella holmesii isolate H785 chromosome, complete genome	3687739	798504	903694	3687739	transposase,holin	Ralstonia_virus(18.52%)	100	NA	NA
AUL38721.1|798504_800604_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AUL38722.1|800745_801585_-	branched chain amino acid aminotransferase	NA	NA	NA	NA	NA
AUL38723.1|802714_803602_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL38724.1|803692_803827_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL38725.1|803902_804907_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL38726.1|805813_806074_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL38727.1|806348_806984_-	endonuclease III	NA	NA	NA	NA	NA
AUL38728.1|807004_807643_-	ferredoxin	NA	NA	NA	NA	NA
AUL38729.1|807693_808920_-	esterase	NA	NA	NA	NA	NA
AUL38730.1|809056_809854_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AUL38731.1|809884_810208_-	ferredoxin	NA	NA	NA	NA	NA
AUL38732.1|810372_811548_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	32.5	4.2e-48
AUL38733.1|811586_811940_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38734.1|811970_812390_-	hypothetical protein	NA	NA	NA	NA	NA
AUL38735.1|812482_813322_-	hypothetical protein	NA	NA	NA	NA	NA
AUL38736.1|813518_815765_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AUL38737.1|815784_817098_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	41.0	1.5e-83
AUL38738.1|817263_818415_+	acetylornithine deacetylase (ArgE)	NA	NA	NA	NA	NA
AUL38739.1|818555_819755_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AUL38740.1|819751_820615_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AUL38741.1|820644_821523_+	acetyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
AUL38742.1|821731_822277_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38743.1|822447_822708_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL38744.1|823656_826788_-	ribonuclease E/G	NA	NA	NA	NA	NA
AUL38745.1|827367_828273_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AUL38746.1|828274_828931_+	HAD family hydrolase	NA	NA	NA	NA	NA
AUL38747.1|829048_830008_+	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AUL38748.1|830020_830647_+	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AUL38749.1|830627_831410_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	32.4	5.0e-13
AUL41205.1|831413_832124_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL38750.1|832120_832714_-	septum formation protein Maf	NA	NA	NA	NA	NA
AUL38751.1|832931_833579_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38752.1|833631_833814_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
AUL38753.1|833872_834937_+	phosphate acyltransferase	NA	NA	NA	NA	NA
AUL38754.1|834936_835923_+	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
AUL38755.1|835982_836918_+	[acyl-carrier-protein] S-malonyltransferase	NA	NA	NA	NA	NA
AUL38756.1|836920_837670_+	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.0	2.7e-16
AUL38757.1|837887_838127_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	48.5	1.6e-10
AUL38758.1|838298_839528_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AUL38759.1|839530_839962_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38760.1|839958_840558_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	26.9	2.6e-06
AUL38761.1|840570_841056_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38762.1|841055_842090_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AUL38763.1|842130_843633_+	serine peptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.2	1.1e-21
AUL38764.1|843717_844707_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.8	7.4e-147
AUL38765.1|844764_845025_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL38766.1|845117_845618_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL38767.1|846058_847009_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL38768.1|847076_848870_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.5	1.4e-23
AUL38769.1|848893_849778_+	S26 family signal peptidase	NA	NA	NA	NA	NA
AUL38770.1|849783_850539_+	ribonuclease III	NA	M4QNJ2	Ostreococcus_lucimarinus_virus	33.5	1.5e-19
AUL38771.1|850535_851426_+	GTPase Era	NA	NA	NA	NA	NA
AUL38772.1|851418_852006_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AUL38773.1|852028_853120_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.9	2.1e-17
AUL38774.1|853129_854350_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL38775.1|854758_855469_-	hypothetical protein	NA	NA	NA	NA	NA
AUL38776.1|855561_855810_-	hypothetical protein	NA	NA	NA	NA	NA
AUL38777.1|855828_856266_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AUL38778.1|856283_857798_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.9	7.3e-53
AUL38779.1|857852_858962_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AUL38780.1|860051_861269_+	ABC transporter permease	NA	NA	NA	NA	NA
AUL38781.1|861332_862817_+	methylmalonate-semialdehyde dehydrogenase (acylating)	NA	NA	NA	NA	NA
AUL38782.1|862973_863918_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL38783.1|864044_865265_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL38784.1|865432_865768_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38785.1|865963_866629_-	hypothetical protein	NA	A0A0A8WF62	Clostridium_phage	34.5	1.6e-15
AUL38786.1|866874_868764_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	30.7	2.4e-61
AUL38787.1|868760_869168_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38788.1|869251_870478_+	MFS transporter	NA	NA	NA	NA	NA
AUL38789.1|870627_872607_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	43.6	6.1e-84
AUL38790.1|872672_873893_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL38791.1|874920_875934_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AUL38792.1|875955_876789_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL38793.1|876838_878485_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
AUL38794.1|878617_879064_+	thioesterase	NA	NA	NA	NA	NA
AUL38795.1|879178_879877_+	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUL38796.1|879889_880543_+	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUL38797.1|880743_881628_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL38798.1|881624_882605_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
AUL38799.1|882642_884523_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.8	2.0e-20
AUL38800.1|884597_886151_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
AUL38801.1|886224_887145_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
AUL38802.1|887152_888046_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
AUL38803.1|888135_889203_+	aminopeptidase	NA	NA	NA	NA	NA
AUL38804.1|889213_890032_+	aminopeptidase	NA	NA	NA	NA	NA
AUL38805.1|890046_891843_+	Xaa-Pro aminopeptidase	NA	A0A0P0I8D7	Acinetobacter_phage	49.7	1.3e-165
AUL38806.1|892086_893739_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.5	1.7e-156
AUL38807.1|893910_894114_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38808.1|894088_894193_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38809.1|894196_895483_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	63.4	5.5e-150
AUL38810.1|895556_895928_+	cell division protein FtsB	NA	NA	NA	NA	NA
AUL38811.1|895946_896576_-	hypothetical protein	NA	NA	NA	NA	NA
AUL38812.1|896655_897576_-	Hsp33 family molecular chaperone	NA	NA	NA	NA	NA
AUL38813.1|897614_898136_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AUL38814.1|898158_899826_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	33.4	9.8e-67
AUL38815.1|900021_900861_-	UDP-2,3-diacylglucosamine hydrolase	NA	A0A218MKA7	uncultured_virus	48.1	1.9e-66
AUL38816.1|900942_901467_-	RDD family protein	NA	NA	NA	NA	NA
AUL38817.1|901789_902290_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL38818.1|902382_902643_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL38819.1|902686_903694_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.4e-147
>prophage 6
CP018896	Bordetella holmesii isolate H785 chromosome, complete genome	3687739	917602	992214	3687739	transposase,tRNA	Ralstonia_virus(36.36%)	58	NA	NA
AUL38833.1|917602_918607_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
AUL38834.1|918634_919504_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL38835.1|919670_920747_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	1.9e-26
AUL38836.1|920724_922485_+	phosphonate ABC transporter permease	NA	NA	NA	NA	NA
AUL38837.1|922516_922981_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
AUL38838.1|922946_923264_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38839.1|924381_925509_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL38840.1|925550_926045_-	hypothetical protein	NA	NA	NA	NA	NA
AUL38841.1|926089_926773_-	Fe2+-dependent dioxygenase	NA	A0A1D8KSK5	Synechococcus_phage	39.5	3.9e-14
AUL38842.1|926782_928966_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL38843.1|929105_930326_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
AUL38844.1|930456_932739_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
AUL38845.1|932912_935570_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AUL38846.1|935805_937851_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
AUL38847.1|938188_941059_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
AUL38848.1|941105_942329_+	dihydrolipoamide succinyltransferase	NA	NA	NA	NA	NA
AUL38849.1|942399_943827_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	1.6e-41
AUL38850.1|943904_944996_+	cell division protein ZapE	NA	NA	NA	NA	NA
AUL38851.1|945134_945656_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL38852.1|945652_946564_+	transmembrane sensor protein	NA	NA	NA	NA	NA
AUL38853.1|946657_949117_+	ligand-gated channel	NA	NA	NA	NA	NA
AUL38854.1|949349_949514_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38855.1|951124_951463_+	iron uptake protein	NA	NA	NA	NA	NA
AUL38856.1|951506_952829_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUL38857.1|952882_955270_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
AUL38858.1|955435_957484_+	helicase	NA	A0A127AW80	Bacillus_phage	28.0	3.2e-75
AUL38859.1|957549_958374_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AUL38860.1|958450_959410_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AUL38861.1|959397_960162_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38862.1|960287_961913_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
AUL38863.1|961962_962700_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL38864.1|962791_963352_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
AUL38865.1|963525_964065_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38866.1|964067_964400_+	periplasmic lipoprotein involved in iron transport	NA	NA	NA	NA	NA
AUL38867.1|964410_965256_+	FTR1 family iron permease	NA	NA	NA	NA	NA
AUL38868.1|965277_966657_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38869.1|966705_967617_+	phenazine biosynthesis protein PhzC/PhzF	NA	NA	NA	NA	NA
AUL38870.1|967783_968119_-	phospholipid-binding protein	NA	NA	NA	NA	NA
AUL38871.1|968168_969389_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL38872.1|969510_969675_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
AUL38873.1|969732_969933_-	general stress protein CsbD	NA	NA	NA	NA	NA
AUL38874.1|970237_970771_-	cytochrome B	NA	A0A0U2QLA7	Escherichia_phage	43.3	8.3e-12
AUL38875.1|976393_978670_+	ABC transporter	NA	W8CYL7	Bacillus_phage	31.3	6.6e-58
AUL38876.1|978666_979146_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38877.1|979142_980276_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL38878.1|980328_981132_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38879.1|981165_982374_+	lytic transglycosylase	NA	NA	NA	NA	NA
AUL38880.1|982455_982884_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38881.1|983216_984773_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
AUL38882.1|984809_985130_-	hypothetical protein	NA	NA	NA	NA	NA
AUL41207.1|985265_985997_+	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL38883.1|986055_986580_+	DedA family protein	NA	NA	NA	NA	NA
AUL38884.1|986631_988071_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL38885.1|989037_989367_+	regulator	NA	NA	NA	NA	NA
AUL38886.1|989363_989870_+	toxin	NA	NA	NA	NA	NA
AUL41208.1|990091_991024_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	76.8	1.9e-136
AUL38887.1|991093_991354_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL38888.1|991392_992214_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
>prophage 7
CP018896	Bordetella holmesii isolate H785 chromosome, complete genome	3687739	1095290	1192837	3687739	protease,transposase,tRNA	Leptospira_phage(20.0%)	92	NA	NA
AUL38972.1|1095290_1096511_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL38973.1|1096598_1097189_+	EamA family transporter	NA	NA	NA	NA	NA
AUL41216.1|1097176_1097488_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38974.1|1097539_1098529_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AUL38975.1|1098649_1099531_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
AUL38976.1|1099704_1100559_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38977.1|1100590_1101439_+	sulfurtransferase	NA	NA	NA	NA	NA
AUL38978.1|1101566_1102787_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
AUL38979.1|1102805_1103372_-	phosphohydrolase	NA	NA	NA	NA	NA
AUL38980.1|1103569_1104721_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUL38981.1|1104859_1105864_-	hypothetical protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
AUL38982.1|1106020_1106992_-	MFS transporter	NA	NA	NA	NA	NA
AUL38983.1|1107070_1107859_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL38984.1|1107930_1108167_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AUL38985.1|1108175_1109087_+	geranyl transferase	NA	NA	NA	NA	NA
AUL38986.1|1109130_1111002_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUL38987.1|1111162_1111960_+	GTP cyclohydrolase	NA	NA	NA	NA	NA
AUL38988.1|1112191_1112566_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
AUL38989.1|1112642_1112966_+	primosomal replication protein N	NA	NA	NA	NA	NA
AUL38990.1|1113049_1113322_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
AUL38991.1|1113336_1113792_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AUL38992.1|1113913_1114750_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38993.1|1114746_1116120_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
AUL38994.1|1116196_1117153_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
AUL38995.1|1117240_1118218_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
AUL38996.1|1118342_1119998_-	phosphate starvation-inducible protein PhoH	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
AUL38997.1|1120046_1120511_-	peroxiredoxin	NA	NA	NA	NA	NA
AUL38998.1|1120507_1120969_-	hypothetical protein	NA	NA	NA	NA	NA
AUL38999.1|1121194_1122382_+	alanine transaminase	NA	NA	NA	NA	NA
AUL39000.1|1122378_1123683_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
AUL39001.1|1123679_1125089_+	threonine synthase	NA	NA	NA	NA	NA
AUL39002.1|1125282_1125543_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL39003.1|1125581_1126403_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL39004.1|1126537_1127557_-	fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
AUL39005.1|1127565_1130271_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
AUL39006.1|1130410_1131064_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39007.1|1131126_1131489_-	DNA-binding protein	NA	NA	NA	NA	NA
AUL39008.1|1132055_1133516_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AUL39009.1|1133778_1134852_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
AUL39010.1|1134936_1136157_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
AUL39011.1|1137914_1138736_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL39012.1|1138774_1139035_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL41217.1|1139062_1140508_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AUL39013.1|1140521_1141625_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
AUL39014.1|1141629_1142880_+	glycolate oxidase iron-sulfur subunit	NA	NA	NA	NA	NA
AUL39015.1|1142876_1144322_-	NAD synthetase	NA	NA	NA	NA	NA
AUL39016.1|1144318_1144633_-	NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AUL39017.1|1144634_1145753_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AUL39018.1|1145935_1147156_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
AUL39019.1|1147255_1148122_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
AUL39020.1|1148182_1149163_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL39021.1|1149309_1150230_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
AUL39022.1|1150238_1151351_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUL39023.1|1151432_1152254_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39024.1|1152329_1152938_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUL41218.1|1153075_1154452_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
AUL39025.1|1154513_1154957_+	cytochrome C	NA	NA	NA	NA	NA
AUL41219.1|1155023_1155695_-	cytochrome B	NA	NA	NA	NA	NA
AUL39026.1|1155722_1155983_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL39027.1|1156021_1156843_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL39028.1|1157011_1157293_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39029.1|1158003_1158792_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39030.1|1158788_1159895_+	AI-2E family transporter	NA	NA	NA	NA	NA
AUL39031.1|1160569_1161928_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
AUL39032.1|1162042_1162240_-	gas vesicle protein	NA	NA	NA	NA	NA
AUL39033.1|1162257_1163079_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL39034.1|1163117_1163378_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL39035.1|1163471_1164026_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
AUL41220.1|1164613_1165930_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39036.1|1165942_1166956_-	dimethylhistidine N-methyltransferase	NA	NA	NA	NA	NA
AUL39037.1|1167502_1168453_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL39038.1|1168532_1168832_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39039.1|1170192_1171851_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
AUL39040.1|1171999_1173220_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39041.1|1173337_1174621_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
AUL39042.1|1174624_1175566_-	transporter	NA	NA	NA	NA	NA
AUL39043.1|1175675_1176134_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL41221.1|1176514_1177135_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AUL39044.1|1177542_1179963_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
AUL39045.1|1180070_1180808_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AUL39046.1|1180854_1182099_+	hypothetical protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
AUL39047.1|1182421_1182694_+	DNA-binding protein HU	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
AUL39048.1|1183277_1184006_+	energy transducer TonB	NA	NA	NA	NA	NA
AUL39049.1|1184027_1184945_+	flagellar motor protein MotA	NA	NA	NA	NA	NA
AUL39050.1|1184944_1185454_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUL39051.1|1185570_1186242_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL39052.1|1186351_1187419_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
AUL39053.1|1187402_1189283_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	3.5e-65
AUL39054.1|1189419_1190607_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39055.1|1190907_1191693_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39056.1|1191716_1191977_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL39057.1|1192015_1192837_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
>prophage 8
CP018896	Bordetella holmesii isolate H785 chromosome, complete genome	3687739	1200858	1263272	3687739	protease,transposase,tRNA	Ralstonia_virus(28.57%)	55	NA	NA
AUL39065.1|1200858_1202079_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL39066.1|1202154_1202436_+	malate dehydrogenase	NA	NA	NA	NA	NA
AUL39067.1|1204267_1205263_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL39068.1|1205305_1206076_+	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
AUL39069.1|1206201_1206465_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUL39070.1|1206666_1206813_-	transmembrane sensor protein	NA	NA	NA	NA	NA
AUL39071.1|1206866_1207817_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL39072.1|1207898_1208378_-	transmembrane sensor protein	NA	NA	NA	NA	NA
AUL39073.1|1209271_1209532_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL39074.1|1209589_1210789_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
AUL39075.1|1210934_1211312_-	cytochrome c family protein	NA	NA	NA	NA	NA
AUL39076.1|1211335_1213117_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
AUL39077.1|1213125_1213863_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39078.1|1214147_1215707_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
AUL39079.1|1215766_1216525_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL39080.1|1216621_1217278_-	adenylate kinase	NA	NA	NA	NA	NA
AUL39081.1|1217431_1218196_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AUL39082.1|1218210_1218390_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39083.1|1218415_1219450_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AUL39084.1|1219446_1219860_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUL39085.1|1219856_1220441_-	flagellar motor protein MotA	NA	NA	NA	NA	NA
AUL39086.1|1220793_1222152_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
AUL39087.1|1222245_1222824_+	superoxide dismutase	NA	NA	NA	NA	NA
AUL39088.1|1222948_1223770_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL39089.1|1223808_1224069_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL41223.1|1224096_1225398_+	chloride channel protein-related protein	NA	NA	NA	NA	NA
AUL39090.1|1225501_1226707_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AUL39091.1|1226770_1227220_-	hypothetical protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
AUL39092.1|1227352_1227598_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
AUL39093.1|1227822_1228137_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
AUL39094.1|1228228_1228513_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39095.1|1228780_1233343_+	alpha-2-macroglobulin	NA	NA	NA	NA	NA
AUL39096.1|1233390_1235496_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
AUL39097.1|1235549_1237859_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
AUL39098.1|1239212_1240880_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AUL39099.1|1240882_1241548_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39100.1|1241680_1245487_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL39101.1|1245712_1246858_+	branched chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL39102.1|1246976_1247906_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL39103.1|1247902_1248979_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL39104.1|1248975_1249782_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
AUL39105.1|1249778_1250510_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
AUL39106.1|1250713_1250896_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39107.1|1250886_1252125_-	ammonia channel protein	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
AUL39108.1|1252172_1252511_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL39109.1|1252758_1253709_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL39110.1|1254027_1254210_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39111.1|1254275_1255496_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL39112.1|1255589_1256810_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL39113.1|1256869_1257133_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39114.1|1257254_1258754_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AUL39115.1|1259174_1259372_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AUL39116.1|1259387_1259747_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AUL39117.1|1259819_1260842_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
AUL39118.1|1260854_1263272_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 9
CP018896	Bordetella holmesii isolate H785 chromosome, complete genome	3687739	1272619	1318993	3687739	transposase,holin,tRNA	Ralstonia_virus(20.0%)	46	NA	NA
AUL39131.1|1272619_1274581_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	29.9	2.3e-27
AUL39132.1|1274709_1274958_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39133.1|1275087_1275366_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39134.1|1275459_1275912_+	hypothetical protein	NA	G1JW61	Mycobacterium_phage	36.3	8.9e-07
AUL39135.1|1275908_1276379_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUL39136.1|1276670_1277264_+	twin-arginine translocation pathway signal	NA	NA	NA	NA	NA
AUL39137.1|1277311_1277596_+	CsbD family protein	NA	NA	NA	NA	NA
AUL39138.1|1277652_1277835_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39139.1|1277986_1278190_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39140.1|1278284_1278527_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39141.1|1278674_1278887_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39142.1|1279014_1280097_+	N-acylglucosamine 2-epimerase	NA	NA	NA	NA	NA
AUL39143.1|1280187_1280403_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39144.1|1280409_1280775_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUL39145.1|1280828_1282628_-	metal ABC transporter permease	NA	W8CYL7	Bacillus_phage	28.4	8.7e-45
AUL39146.1|1282777_1283152_+	2,5-diketo-D-gluconic acid reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.5e-20
AUL39147.1|1283175_1283436_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL39148.1|1283474_1284296_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL39149.1|1284779_1285766_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUL39150.1|1285812_1286019_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39151.1|1286015_1287191_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39152.1|1287368_1288022_+	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	47.7	6.3e-54
AUL39153.1|1288016_1290539_-	penicillin-binding protein	NA	NA	NA	NA	NA
AUL39154.1|1290710_1292627_-	S9 family peptidase	NA	NA	NA	NA	NA
AUL39155.1|1292759_1293206_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39156.1|1293234_1293663_-	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
AUL39157.1|1294290_1295511_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL39158.1|1296245_1296707_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	43.4	2.0e-17
AUL39159.1|1296845_1298072_+	nitric oxide dioxygenase	NA	NA	NA	NA	NA
AUL39160.1|1298093_1298531_+	BadM/Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AUL39161.1|1298653_1299901_+	D-amino acid dehydrogenase small subunit	NA	NA	NA	NA	NA
AUL39162.1|1299908_1300742_-	class III aminotransferase	NA	NA	NA	NA	NA
AUL39163.1|1300738_1301266_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL39164.1|1301355_1302576_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL39165.1|1302583_1304248_-	long-chain-fatty-acid--CoA ligase	NA	Q75ZG1	Hepacivirus	27.3	2.0e-40
AUL39166.1|1304255_1304765_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39167.1|1304761_1305376_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
AUL39168.1|1305376_1306570_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUL39169.1|1306579_1308964_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL39170.1|1309023_1310316_-	fatty acid transporter	NA	NA	NA	NA	NA
AUL39171.1|1310337_1312296_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUL39172.1|1312292_1313585_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUL39173.1|1313595_1315926_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL39174.1|1315951_1316620_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL39175.1|1316999_1317944_+	serine acetyltransferase	NA	NA	NA	NA	NA
AUL39176.1|1318042_1318993_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 10
CP018896	Bordetella holmesii isolate H785 chromosome, complete genome	3687739	1553842	1659443	3687739	transposase,tRNA	Leptospira_phage(13.33%)	96	NA	NA
AUL39385.1|1553842_1554331_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AUL39386.1|1554445_1555561_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
AUL41239.1|1556193_1557357_+	MFS transporter	NA	NA	NA	NA	NA
AUL39387.1|1557539_1560197_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39388.1|1560200_1563590_+	nuclease	NA	NA	NA	NA	NA
AUL39389.1|1563980_1566050_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.7	8.2e-47
AUL39390.1|1566088_1566415_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AUL39391.1|1566429_1567038_+	recombination protein RecR	NA	NA	NA	NA	NA
AUL39392.1|1568478_1569519_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL39393.1|1569511_1570321_+	mannosyltransferase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.5	1.1e-12
AUL39394.1|1570326_1571121_+	ABC transporter permease	NA	NA	NA	NA	NA
AUL41240.1|1571184_1572141_-	transaldolase	NA	M4SPL0	Cyanophage	30.7	3.6e-13
AUL39395.1|1572364_1573519_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.1	2.6e-50
AUL39396.1|1573529_1576769_+	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
AUL39397.1|1576833_1577730_+	aspartyl beta-hydroxylase	NA	H8ZJK8	Ostreococcus_tauri_virus	38.3	2.2e-36
AUL39398.1|1577797_1578559_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL39399.1|1578564_1579203_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AUL39400.1|1579195_1580104_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL39401.1|1581209_1582901_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL39402.1|1582968_1584291_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL39403.1|1584388_1584664_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39404.1|1584799_1586116_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	68.0	2.9e-154
AUL39405.1|1586316_1586745_+	transcriptional regulator	NA	A0A1X9I5R1	Streptococcus_phage	30.3	4.2e-06
AUL39406.1|1586810_1588031_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL39407.1|1588385_1588862_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AUL39408.1|1589120_1589729_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39409.1|1589747_1590419_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AUL39410.1|1590592_1592479_+	cell division protein FtsH	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
AUL39411.1|1592506_1593349_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
AUL39412.1|1593345_1594689_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
AUL39413.1|1594873_1595689_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL39414.1|1595754_1597236_-	exopolyphosphatase	NA	NA	NA	NA	NA
AUL39415.1|1597434_1599507_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
AUL39416.1|1599726_1600764_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
AUL39417.1|1600885_1602808_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39418.1|1602835_1603612_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
AUL39419.1|1604439_1604949_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39420.1|1605190_1605895_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	36.5	1.9e-27
AUL39421.1|1606026_1606797_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL41241.1|1606793_1607804_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL41242.1|1607862_1608123_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL41243.1|1608155_1608944_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.5	1.4e-44
AUL39422.1|1609111_1609372_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL39423.1|1609410_1610232_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AUL39424.1|1610286_1610976_+	hypothetical protein	NA	A0A1B0VBP7	Salmonella_phage	47.1	1.3e-49
AUL39425.1|1610980_1611352_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39426.1|1611412_1611658_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39427.1|1611764_1613264_-	2-aminoadipate aminotransferase	NA	NA	NA	NA	NA
AUL39428.1|1613391_1613661_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39429.1|1613885_1614221_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39430.1|1614479_1614611_+	entericidin	NA	NA	NA	NA	NA
AUL39431.1|1614640_1615138_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39432.1|1615147_1615522_+	hypothetical protein	NA	NA	NA	NA	NA
AUL41244.1|1615612_1616905_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
AUL39433.1|1617021_1617921_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
AUL39434.1|1618072_1618291_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39435.1|1618764_1620441_-	MFS transporter	NA	NA	NA	NA	NA
AUL39436.1|1620625_1622149_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
AUL39437.1|1622120_1622816_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL39438.1|1623157_1624219_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
AUL39439.1|1624264_1624816_+	recombination regulator RecX	NA	NA	NA	NA	NA
AUL39440.1|1624822_1625743_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL39441.1|1625882_1628180_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AUL39442.1|1628235_1629456_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL39443.1|1629714_1630320_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39444.1|1630330_1631491_+	succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
AUL39445.1|1631512_1632394_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
AUL39446.1|1632690_1633389_+	hypothetical protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
AUL39447.1|1633530_1634253_+	hypothetical protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
AUL39448.1|1634371_1635310_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AUL39449.1|1635340_1636120_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AUL39450.1|1636106_1637330_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
AUL39451.1|1637334_1638882_+	protoheme IX synthesis protein	NA	NA	NA	NA	NA
AUL39452.1|1638917_1639451_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
AUL41245.1|1639694_1640390_+	5-carboxymethyl-2-hydroxymuconate isomerase	NA	NA	NA	NA	NA
AUL39453.1|1640404_1640536_+	entericidin	NA	NA	NA	NA	NA
AUL39454.1|1640583_1641708_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL39455.1|1641713_1644053_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
AUL39456.1|1644049_1644457_-	heat-shock protein Hsp20	NA	NA	NA	NA	NA
AUL39457.1|1644718_1644979_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39458.1|1645201_1646152_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL39459.1|1646250_1647201_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL39460.1|1647250_1648459_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL39461.1|1648680_1649220_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL39462.1|1649444_1649849_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL39463.1|1649913_1650669_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
AUL39464.1|1650668_1652030_+	secretion protein	NA	NA	NA	NA	NA
AUL39465.1|1652026_1652650_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL39466.1|1652693_1652954_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL39467.1|1652992_1653814_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL39468.1|1653764_1654469_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL39469.1|1654465_1655221_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL41246.1|1655397_1656192_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL39470.1|1656188_1656626_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39471.1|1657310_1658279_-	homoserine kinase	NA	NA	NA	NA	NA
AUL41247.1|1658435_1659443_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 11
CP018896	Bordetella holmesii isolate H785 chromosome, complete genome	3687739	1671667	1719147	3687739	transposase,tRNA	Shigella_phage(22.22%)	50	NA	NA
AUL39481.1|1671667_1671928_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL39482.1|1671985_1672285_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AUL39483.1|1672854_1674258_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AUL39484.1|1674270_1674921_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AUL39485.1|1675062_1676283_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL39486.1|1676313_1677390_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AUL39487.1|1677536_1678667_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL39488.1|1678853_1680479_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39489.1|1680485_1681301_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AUL41249.1|1681348_1682386_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL39490.1|1682437_1683097_+	N-(5'-phosphoribosyl)anthranilate isomerase	NA	NA	NA	NA	NA
AUL39491.1|1683736_1684612_-|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL41250.1|1684608_1684899_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL39492.1|1685663_1685924_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL39493.1|1686322_1687012_+	permease	NA	NA	NA	NA	NA
AUL39494.1|1687111_1687273_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39495.1|1687714_1687951_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39496.1|1688140_1688389_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39497.1|1688502_1689873_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AUL39498.1|1689873_1690614_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL39499.1|1691114_1693067_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
AUL39500.1|1693087_1693636_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.3	3.8e-12
AUL39501.1|1693801_1694758_+	glutathione synthase	NA	NA	NA	NA	NA
AUL41251.1|1694771_1695170_+	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
AUL41252.1|1695232_1695502_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AUL39502.1|1695530_1697306_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AUL39503.1|1697353_1697563_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39504.1|1697609_1698032_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AUL39505.1|1698151_1699129_+	ornithine cyclodeaminase	NA	NA	NA	NA	NA
AUL39506.1|1699197_1700361_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL39507.1|1700529_1701417_+	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
AUL39508.1|1701427_1702069_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
AUL39509.1|1702065_1702737_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
AUL39510.1|1703609_1704059_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	Q2NP83	Xanthomonas_phage	62.8	2.3e-47
AUL39511.1|1704100_1704559_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39512.1|1704579_1705212_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39513.1|1705321_1705789_+	hydrolase	NA	NA	NA	NA	NA
AUL39514.1|1705810_1706353_+	hydrolase	NA	NA	NA	NA	NA
AUL39515.1|1706365_1707070_+	dipeptidase E	NA	NA	NA	NA	NA
AUL39516.1|1707088_1707559_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL39517.1|1707651_1708392_+	permease	NA	NA	NA	NA	NA
AUL39518.1|1708435_1708696_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL39519.1|1709571_1710783_-	phosphopantothenate synthase	NA	Q9HH70	Methanothermobacter_phage	30.4	2.2e-36
AUL39520.1|1710843_1711359_-	signal peptidase II	NA	NA	NA	NA	NA
AUL39521.1|1711361_1714223_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
AUL41253.1|1714212_1715178_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
AUL39522.1|1715934_1717410_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AUL41254.1|1717414_1717690_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39523.1|1718026_1718287_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL39524.1|1718325_1719147_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
>prophage 12
CP018896	Bordetella holmesii isolate H785 chromosome, complete genome	3687739	1731880	1781515	3687739	transposase,integrase,holin	Leptospira_phage(30.0%)	48	1719081:1719140	1768140:1768218
1719081:1719140	attL	GCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCC	NA	NA	NA	NA
AUL39533.1|1731880_1732162_+|integrase	integrase	integrase	NA	NA	NA	NA
AUL39534.1|1732327_1732648_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39535.1|1732687_1732954_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL41255.1|1732986_1733775_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.5	1.4e-44
AUL39536.1|1733970_1734231_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39537.1|1734309_1734570_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL39538.1|1734723_1735494_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL41256.1|1735490_1736501_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL41257.1|1736559_1737378_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.2e-54
AUL39539.1|1737840_1738626_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
AUL39540.1|1739485_1739746_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL39541.1|1739784_1740606_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL39542.1|1741671_1742676_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
AUL39543.1|1742751_1743564_+	nucleotide pyrophosphatase	NA	NA	NA	NA	NA
AUL39544.1|1743791_1745963_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AUL39545.1|1746016_1747336_-	MFS transporter	NA	NA	NA	NA	NA
AUL39546.1|1747424_1748645_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL39547.1|1748863_1749724_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL39548.1|1749720_1750944_-	MFS transporter	NA	NA	NA	NA	NA
AUL39549.1|1751242_1751740_+	osmotically inducible protein Y	NA	NA	NA	NA	NA
AUL39550.1|1751778_1752561_-	hydrolase	NA	NA	NA	NA	NA
AUL39551.1|1752586_1752805_-	SlyX protein	NA	NA	NA	NA	NA
AUL39552.1|1752879_1753149_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39553.1|1753368_1753833_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL39554.1|1753906_1754188_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUL41258.1|1754304_1755288_-|integrase	integrase	integrase	NA	NA	NA	NA
AUL39555.1|1755531_1756530_+	cointegrate resolution protein	NA	NA	NA	NA	NA
AUL39556.1|1756632_1757064_+	energy transducer TonB	NA	NA	NA	NA	NA
AUL39557.1|1757128_1758040_+	3-phosphoglycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	30.7	3.7e-20
AUL39558.1|1758172_1760254_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AUL39559.1|1760292_1760997_-	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AUL39560.1|1761089_1761974_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL39561.1|1762049_1762451_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39562.1|1762541_1762688_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
AUL39563.1|1762949_1763885_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL39564.1|1763966_1764620_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL39565.1|1765236_1765713_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL39566.1|1765737_1766532_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL39567.1|1766548_1767529_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL39568.1|1767701_1767914_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39569.1|1768327_1770103_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	3.5e-38
1768140:1768218	attR	GCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAG	NA	NA	NA	NA
AUL39570.1|1770118_1771783_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
AUL39571.1|1771795_1774507_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AUL41259.1|1775052_1776807_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
AUL39572.1|1776803_1777430_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL39573.1|1777426_1778281_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.8	1.4e-29
AUL39574.1|1778400_1780455_+	oligopeptidase A	NA	NA	NA	NA	NA
AUL39575.1|1780564_1781515_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 13
CP018896	Bordetella holmesii isolate H785 chromosome, complete genome	3687739	1794280	1843292	3687739	transposase	Ralstonia_virus(33.33%)	45	NA	NA
AUL39588.1|1794280_1795501_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL39589.1|1795576_1796698_-	transporter	NA	NA	NA	NA	NA
AUL39590.1|1796735_1797449_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
AUL39591.1|1797459_1798680_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
AUL39592.1|1799462_1800413_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL41260.1|1800372_1800534_-	branched-chain amino acid ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL39593.1|1800574_1801501_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL39594.1|1801514_1802387_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL39595.1|1802549_1803497_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL41261.1|1803835_1804417_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AUL41262.1|1804410_1804920_-	threonine dehydratase	NA	NA	NA	NA	NA
AUL39596.1|1804994_1805945_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL39597.1|1805924_1806677_-	serine/threonine dehydratase	NA	NA	NA	NA	NA
AUL39598.1|1806689_1807421_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39599.1|1807577_1809743_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
AUL39600.1|1809832_1810102_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
AUL41263.1|1810190_1810397_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39601.1|1810395_1810914_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39602.1|1810932_1811712_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AUL39603.1|1811879_1812896_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AUL39604.1|1812968_1813460_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
AUL39605.1|1813470_1815186_-	acetolactate synthase, large subunit, biosynthetic type	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
AUL39606.1|1815656_1816268_+	hypothetical protein	NA	NA	NA	NA	NA
AUL41264.1|1816349_1817300_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL39607.1|1818951_1820193_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39608.1|1820204_1820978_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
AUL39609.1|1821004_1821955_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL39610.1|1822053_1822836_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
AUL39611.1|1824877_1826263_+	alcaligin biosynthesis protein	NA	NA	NA	NA	NA
AUL39612.1|1826281_1826887_+	siderophore biosynthesis protein	NA	NA	NA	NA	NA
AUL39613.1|1826883_1828740_+	IucA/IucC family protein	NA	NA	NA	NA	NA
AUL39614.1|1828736_1829537_+	siderophore ferric iron reductase	NA	NA	NA	NA	NA
AUL39615.1|1829551_1830745_+	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUL39616.1|1830812_1831787_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL39617.1|1831909_1833133_+	multidrug transporter	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
AUL39618.1|1833243_1835448_+	porin	NA	NA	NA	NA	NA
AUL39619.1|1835742_1836372_+	antibiotic resistance protein	NA	NA	NA	NA	NA
AUL39620.1|1836379_1836586_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39621.1|1837523_1837784_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL41265.1|1837826_1838567_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL39622.1|1838550_1839531_+	hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	29.2	5.6e-14
AUL39623.1|1839673_1840168_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AUL39624.1|1840169_1841087_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL39625.1|1841166_1842351_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL39626.1|1842341_1843292_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 14
CP018896	Bordetella holmesii isolate H785 chromosome, complete genome	3687739	1963610	2020220	3687739	integrase,transposase	Leptospira_phage(22.22%)	46	1958294:1958309	1988455:1988470
1958294:1958309	attL	GGCTGTTGCCGGCAAG	NA	NA	NA	NA
AUL39739.1|1963610_1963871_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL39740.1|1963894_1964089_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39741.1|1964088_1966296_-	outer membrane receptor protein	NA	NA	NA	NA	NA
AUL39742.1|1966568_1967366_+	enterobactin-dependent positive regulator	NA	NA	NA	NA	NA
AUL39743.1|1967411_1968467_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUL39744.1|1968501_1968696_-|integrase	integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	52.8	1.1e-06
AUL39745.1|1968692_1969634_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AUL39746.1|1970136_1971021_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39747.1|1971445_1973674_+	isocitrate dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AUL39748.1|1973958_1974423_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39749.1|1974429_1975947_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39750.1|1975995_1976748_-	polar amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	4.3e-30
AUL39751.1|1976755_1977409_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL39752.1|1977445_1978234_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL39753.1|1978351_1978933_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AUL39754.1|1979215_1979599_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39755.1|1980183_1980513_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39756.1|1981692_1982421_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.1	1.8e-09
AUL39757.1|1982417_1983182_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.3e-18
AUL39758.1|1983181_1985065_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL41270.1|1985077_1986283_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL39759.1|1987999_1988734_-	hypothetical protein	NA	NA	NA	NA	NA
1988455:1988470	attR	GGCTGTTGCCGGCAAG	NA	NA	NA	NA
AUL39760.1|1988910_1989702_+	hydratase	NA	NA	NA	NA	NA
AUL39761.1|1989724_1991269_-	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	42.9	8.8e-38
AUL39762.1|1992013_1993213_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AUL39763.1|1993649_1994273_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL41271.1|1994278_1997935_+	virulence sensor protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.0	6.5e-39
AUL39764.1|2000123_2001821_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39765.1|2002205_2002466_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL39766.1|2002504_2003326_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL39767.1|2003358_2003673_+	glutamate decarboxylase	NA	NA	NA	NA	NA
AUL39768.1|2003762_2005463_+	transporter	NA	NA	NA	NA	NA
AUL39769.1|2005542_2005920_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39770.1|2006056_2006782_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL39771.1|2006914_2007901_+	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL39772.1|2007903_2008377_+	TRAP transporter small permease protein	NA	NA	NA	NA	NA
AUL39773.1|2008381_2009665_+	C4-dicarboxylate ABC transporter permease	NA	NA	NA	NA	NA
AUL39774.1|2009661_2010552_+	CoA ester lyase	NA	NA	NA	NA	NA
AUL39775.1|2010548_2012246_+	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.7	4.0e-31
AUL39776.1|2013570_2015070_+	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
AUL39777.1|2015142_2015661_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39778.1|2015734_2016625_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AUL39779.1|2016682_2017936_+	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUL39780.1|2017970_2018735_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL39781.1|2019099_2019921_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AUL39782.1|2019959_2020220_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 15
CP018896	Bordetella holmesii isolate H785 chromosome, complete genome	3687739	2128145	2183814	3687739	protease,transposase,tRNA	uncultured_Mediterranean_phage(14.29%)	60	NA	NA
AUL39862.1|2128145_2128406_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL39863.1|2128444_2129266_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL39864.1|2129309_2130062_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39865.1|2130353_2130776_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39866.1|2131045_2131825_-	3'-5' exonuclease	NA	NA	NA	NA	NA
AUL39867.1|2131821_2132685_-	peptidase	NA	A0A292GJG6	Xanthomonas_phage	40.5	8.5e-14
AUL39868.1|2132702_2133500_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.5	9.8e-33
AUL39869.1|2133484_2134243_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.3	1.9e-70
AUL39870.1|2134407_2135046_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUL39871.1|2135042_2135621_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39872.1|2135632_2136166_-	carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUL39873.1|2136170_2137130_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL39874.1|2137160_2137943_-	amidohydrolase	NA	NA	NA	NA	NA
AUL39875.1|2138052_2139045_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL39876.1|2139046_2140084_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.7	5.6e-97
AUL39877.1|2140168_2141461_+	guanine permease	NA	A0A0R6PHV4	Moraxella_phage	36.7	2.9e-66
AUL39878.1|2141643_2142660_+	luciferase	NA	NA	NA	NA	NA
AUL39879.1|2142768_2143152_+	thioredoxin	NA	V9SJ74	Achromobacter_phage	26.8	1.2e-09
AUL41278.1|2143155_2143512_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39880.1|2143532_2143763_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39881.1|2143786_2144584_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL39882.1|2144588_2145356_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL39883.1|2145352_2146348_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL39884.1|2146397_2147162_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	6.3e-29
AUL39885.1|2147334_2148939_-	ABC-F family ATPase	NA	A0A1V0SKJ1	Klosneuvirus	28.9	7.7e-53
AUL39886.1|2149192_2150173_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AUL39887.1|2150169_2150658_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
AUL39888.1|2150650_2151499_-	hydrolase	NA	NA	NA	NA	NA
AUL39889.1|2151590_2152088_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39890.1|2152225_2152585_-	cation:proton antiporter	NA	NA	NA	NA	NA
AUL39891.1|2152581_2152863_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
AUL39892.1|2152862_2153345_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
AUL39893.1|2153346_2154975_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
AUL39894.1|2154971_2155316_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
AUL39895.1|2155317_2158260_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
AUL39896.1|2158705_2159677_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL41279.1|2159666_2161049_-	GTP-binding protein	NA	NA	NA	NA	NA
AUL39897.1|2161191_2162142_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL39898.1|2162101_2163343_-	GTP-binding protein	NA	NA	NA	NA	NA
AUL39899.1|2163339_2164461_-	DNA repair exonuclease	NA	NA	NA	NA	NA
AUL39900.1|2165952_2166420_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL39901.1|2166490_2167141_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39902.1|2167227_2168367_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39903.1|2168535_2169540_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
AUL39904.1|2169536_2170784_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUL39905.1|2171136_2172003_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
AUL39906.1|2171962_2173567_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL39907.1|2173578_2174265_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
AUL39908.1|2174261_2175302_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL39909.1|2175417_2176089_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL41280.1|2176109_2177078_+	secretion protein HlyD	NA	NA	NA	NA	NA
AUL39910.1|2177074_2178013_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
AUL39911.1|2178009_2179164_+	mannose-1-phosphate guanyltransferase	NA	NA	NA	NA	NA
AUL39912.1|2179172_2180624_+	ABC transporter permease	NA	NA	NA	NA	NA
AUL39913.1|2180654_2181137_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39914.1|2181138_2182032_+	hypothetical protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
AUL39915.1|2182028_2182472_+	hypothetical protein	NA	NA	NA	NA	NA
AUL39916.1|2182484_2182862_-	hypothetical protein	NA	NA	NA	NA	NA
AUL39917.1|2183001_2183400_+|protease	membrane-associated protease	protease	NA	NA	NA	NA
AUL39918.1|2183526_2183814_+|protease	CAAX protease family protein	protease	NA	NA	NA	NA
>prophage 16
CP018896	Bordetella holmesii isolate H785 chromosome, complete genome	3687739	2281619	2340031	3687739	transposase,tRNA	Shigella_phage(22.22%)	50	NA	NA
AUL40009.1|2281619_2281880_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL40010.1|2282090_2283389_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUL40011.1|2283431_2284460_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUL40012.1|2284574_2285141_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
AUL40013.1|2285199_2286045_-	phosphatase	NA	NA	NA	NA	NA
AUL41287.1|2286102_2286978_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUL40014.1|2287229_2287844_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40015.1|2287853_2289074_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL40016.1|2289122_2289788_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40017.1|2289835_2290831_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40018.1|2294008_2294923_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL40019.1|2295072_2296038_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL40020.1|2296045_2296462_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUL40021.1|2296458_2297376_+	oxidoreductase	NA	NA	NA	NA	NA
AUL40022.1|2297387_2297807_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40023.1|2297715_2299104_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL41288.1|2299100_2299352_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40024.1|2299522_2300479_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL40025.1|2300461_2300674_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40026.1|2300723_2301497_+	MBL fold hydrolase	NA	NA	NA	NA	NA
AUL40027.1|2301493_2302627_+	malate dehydrogenase	NA	NA	NA	NA	NA
AUL40028.1|2302636_2303587_+	D-3-phosphoglycerate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	28.4	4.8e-18
AUL40029.1|2303618_2304419_+	aldolase	NA	NA	NA	NA	NA
AUL40030.1|2304433_2305588_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40031.1|2305415_2306291_-|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL41289.1|2306287_2306578_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL40032.1|2306690_2307659_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40033.1|2307655_2308576_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40034.1|2308672_2313151_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40035.1|2313529_2317864_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40036.1|2318502_2319066_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40037.1|2319077_2319323_-	RNA-binding protein	NA	NA	NA	NA	NA
AUL40038.1|2319478_2319988_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL40039.1|2320033_2321014_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL40040.1|2321225_2323577_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL41290.1|2323623_2324430_-	DNAase	NA	NA	NA	NA	NA
AUL40041.1|2324450_2325140_-	lipoprotein ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
AUL40042.1|2325132_2326413_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL40043.1|2326510_2327449_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40044.1|2327430_2329137_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
AUL40045.1|2330370_2331120_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL40046.1|2331126_2332641_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
AUL40047.1|2332653_2332941_+	hypothetical protein	NA	NA	NA	NA	NA
AUL41291.1|2332961_2333849_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AUL40048.1|2333999_2334506_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL40049.1|2334502_2335459_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL40050.1|2335646_2336993_+	protein FpvAIII	NA	NA	NA	NA	NA
AUL40051.1|2337938_2338709_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
AUL41292.1|2338705_2339716_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL40052.1|2339785_2340031_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
CP018896	Bordetella holmesii isolate H785 chromosome, complete genome	3687739	2355941	2382335	3687739	protease,transposase	Leptospira_phage(21.43%)	21	NA	NA
AUL40070.1|2355941_2356985_+	alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
AUL41293.1|2356981_2357083_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40071.1|2357174_2357435_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL40072.1|2357473_2358295_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL40073.1|2358544_2359198_+	repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
AUL40074.1|2359313_2360534_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
AUL40075.1|2360584_2363014_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
AUL40076.1|2363179_2364478_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
AUL40077.1|2364582_2365236_-	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
AUL40078.1|2365238_2366549_-	trigger factor	NA	NA	NA	NA	NA
AUL40079.1|2366776_2367316_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
AUL40080.1|2367756_2368578_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL40081.1|2368616_2368877_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL40082.1|2369004_2369199_-	hypothetical protein	NA	NA	NA	NA	NA
AUL41294.1|2375281_2375572_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL40083.1|2375568_2376444_+|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL40084.1|2376828_2378292_+	ribonuclease E/G	NA	NA	NA	NA	NA
AUL40085.1|2378424_2379975_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
AUL40086.1|2380286_2381108_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL40087.1|2381146_2381407_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL40088.1|2381483_2382335_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	77.7	2.8e-126
>prophage 18
CP018896	Bordetella holmesii isolate H785 chromosome, complete genome	3687739	2411579	2476708	3687739	protease,transposase,tRNA	Ralstonia_virus(16.67%)	60	NA	NA
AUL40113.1|2411579_2412800_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL40114.1|2413207_2414110_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL40115.1|2414106_2414976_+	manganese/iron transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
AUL40116.1|2414972_2415824_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40117.1|2415820_2416645_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40118.1|2416919_2418140_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL40119.1|2418285_2420646_+	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
AUL40120.1|2420662_2421325_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL40121.1|2421324_2423418_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	55.8	2.4e-107
AUL40122.1|2424898_2425369_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40123.1|2425620_2426880_-	aspartate kinase	NA	NA	NA	NA	NA
AUL40124.1|2426964_2428014_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AUL40125.1|2428031_2428997_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
AUL40126.1|2429030_2429675_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AUL40127.1|2429685_2431143_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	30.0	2.6e-39
AUL40128.1|2431343_2432024_+	hypothetical protein	NA	NA	NA	NA	NA
AUL41296.1|2432155_2432662_+	cyclophilin	NA	NA	NA	NA	NA
AUL40129.1|2432654_2433425_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AUL40130.1|2433535_2434399_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AUL40131.1|2434419_2436006_-	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	42.5	2.9e-36
AUL40132.1|2436210_2436990_-	inositol monophosphatase	NA	NA	NA	NA	NA
AUL41297.1|2437167_2437944_+	RNA methyltransferase	NA	NA	NA	NA	NA
AUL40133.1|2438046_2439042_-	MFS transporter	NA	NA	NA	NA	NA
AUL40134.1|2439990_2440833_-	mechanosensitive ion channel protein MscS	NA	NA	NA	NA	NA
AUL40135.1|2440891_2441992_-	Tat pathway signal protein	NA	NA	NA	NA	NA
AUL40136.1|2441981_2443052_-	aminopeptidase	NA	NA	NA	NA	NA
AUL40137.1|2443048_2444545_-	thiol oxidoreductase	NA	NA	NA	NA	NA
AUL40138.1|2444541_2445840_-	peptidase	NA	NA	NA	NA	NA
AUL40139.1|2446143_2447145_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL40140.1|2447148_2447925_+	taurine ABC transporter permease	NA	NA	NA	NA	NA
AUL40141.1|2447928_2448750_+	nitrate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	8.0e-30
AUL40142.1|2448771_2448954_+	DUF4089 domain-containing protein	NA	NA	NA	NA	NA
AUL40143.1|2448950_2450330_+	amidase	NA	NA	NA	NA	NA
AUL40144.1|2450326_2451010_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL40145.1|2451006_2451537_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AUL40146.1|2451727_2452099_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AUL40147.1|2452169_2452718_+	NADPH-dependent FMN reductase	NA	A0A2P0ZL82	Lactobacillus_phage	32.3	1.5e-11
AUL40148.1|2453438_2453657_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40149.1|2454726_2455746_+	NADPH:quinone reductase	NA	NA	NA	NA	NA
AUL40150.1|2455742_2456009_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40151.1|2456623_2459218_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	21.1	5.5e-24
AUL40152.1|2459214_2460402_+	cupin	NA	NA	NA	NA	NA
AUL40153.1|2460550_2460949_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40154.1|2460963_2462082_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40155.1|2462099_2463005_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AUL40156.1|2463090_2463738_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AUL40157.1|2463822_2464449_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AUL40158.1|2464513_2465359_+	hypothetical protein	NA	A0A1I9SA48	Rhodococcus_phage	35.1	2.4e-37
AUL40159.1|2465688_2466240_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40160.1|2467003_2467297_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40161.1|2467511_2467841_-	alkylhydroperoxidase	NA	NA	NA	NA	NA
AUL40162.1|2468424_2469885_+	cardiolipin synthase	NA	NA	NA	NA	NA
AUL40163.1|2469843_2470068_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40164.1|2470444_2471764_-	MFS transporter	NA	NA	NA	NA	NA
AUL40165.1|2471806_2472280_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40166.1|2472276_2473287_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40167.1|2473351_2474317_-	pyridoxal-5'-phosphate-dependent protein	NA	NA	NA	NA	NA
AUL40168.1|2474441_2474702_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL40169.1|2475545_2476421_-|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL41298.1|2476417_2476708_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
>prophage 19
CP018896	Bordetella holmesii isolate H785 chromosome, complete genome	3687739	2545778	2646403	3687739	transposase,tRNA	Ralstonia_virus(15.79%)	96	NA	NA
AUL40223.1|2545778_2546039_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL40224.1|2547048_2547564_+	hypothetical protein	NA	T1SAR8	Salmonella_phage	44.6	3.9e-06
AUL40225.1|2547836_2548055_+	virulence protein	NA	NA	NA	NA	NA
AUL40226.1|2548242_2548479_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40227.1|2548769_2550125_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.5	2.1e-83
AUL41302.1|2550171_2551512_-	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	38.9	5.4e-76
AUL40228.1|2551613_2552246_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUL40229.1|2552245_2554615_-	cell division protein FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	2.2e-80
AUL40230.1|2554647_2555607_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	40.2	2.4e-57
AUL40231.1|2555593_2556286_+	DNA mismatch repair protein MutS	NA	NA	NA	NA	NA
AUL40232.1|2556282_2556615_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AUL40233.1|2556730_2557681_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL40234.1|2557677_2559744_-	cation acetate symporter	NA	NA	NA	NA	NA
AUL40235.1|2559743_2560016_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40236.1|2560710_2560800_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUL40237.1|2560799_2562584_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AUL40238.1|2562607_2564773_+	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.9	7.8e-24
AUL40239.1|2564783_2565383_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AUL40240.1|2568146_2568842_+	two-component system response regulator KdpE	NA	NA	NA	NA	NA
AUL40241.1|2568850_2570092_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40242.1|2570241_2571222_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40243.1|2571420_2572677_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	1.2e-11
AUL40244.1|2572879_2573305_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40245.1|2573355_2573718_-	cytochrome	NA	NA	NA	NA	NA
AUL41303.1|2574246_2575134_+	ATP-binding protein	NA	NA	NA	NA	NA
AUL40246.1|2576330_2576573_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUL40247.1|2576569_2576944_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40248.1|2577276_2580027_+	peptidase M16	NA	A0A2K9LA15	Tupanvirus	28.1	1.5e-19
AUL40249.1|2580195_2581341_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	60.8	4.0e-19
AUL40250.1|2581441_2583367_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.7	2.7e-145
AUL40251.1|2583455_2583830_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUL40252.1|2583851_2584382_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUL40253.1|2584495_2584729_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40254.1|2584815_2585907_-	ferrochelatase	NA	NA	NA	NA	NA
AUL40255.1|2585939_2586944_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AUL40256.1|2587053_2587953_+	NAD kinase	NA	NA	NA	NA	NA
AUL40257.1|2587974_2589630_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AUL41304.1|2589734_2590478_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	73.7	2.1e-101
AUL40258.1|2591307_2591568_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL40259.1|2592282_2592699_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
AUL41305.1|2592969_2593467_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40260.1|2593482_2594274_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AUL41306.1|2594331_2595318_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AUL41307.1|2595664_2596210_-|transposase	transposase	transposase	U5P429	Shigella_phage	66.3	2.2e-68
AUL40261.1|2596252_2596513_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL40262.1|2596605_2597106_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	49.7	2.8e-41
AUL40263.1|2597622_2598276_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
AUL40264.1|2598457_2599165_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL40265.1|2599161_2601777_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
AUL40266.1|2601833_2603018_+	putative methylaconitate Delta-isomerase PrpF	NA	NA	NA	NA	NA
AUL40267.1|2603078_2603687_+	lysine transporter LysE	NA	NA	NA	NA	NA
AUL40268.1|2603809_2604835_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUL40269.1|2604898_2605429_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL40270.1|2605308_2605650_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40271.1|2605646_2606354_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL40272.1|2606363_2607257_-	carboxyvinyl-carboxyphosphonate phosphorylmutase	NA	NA	NA	NA	NA
AUL40273.1|2607240_2607999_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL40274.1|2608290_2610966_+	aconitate hydratase 1	NA	NA	NA	NA	NA
AUL40275.1|2610982_2612344_+	dihydroorotase	NA	NA	NA	NA	NA
AUL40276.1|2612363_2613086_+	hydrolase	NA	NA	NA	NA	NA
AUL40277.1|2613090_2614089_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
AUL40278.1|2614509_2614818_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40279.1|2614865_2615438_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40280.1|2615415_2615820_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40281.1|2615938_2616856_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL40282.1|2616865_2617447_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AUL40283.1|2617443_2618196_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUL40284.1|2618238_2618958_+	arginyltransferase	NA	NA	NA	NA	NA
AUL40285.1|2619000_2620056_+	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AUL40286.1|2620165_2621008_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	77.8	4.5e-129
AUL40287.1|2621065_2621326_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL40288.1|2621364_2622186_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL40289.1|2622745_2623324_-	Phasin (PHA-granule associated protein)	NA	NA	NA	NA	NA
AUL40290.1|2623466_2624687_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL40291.1|2624991_2625969_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL40292.1|2626117_2626948_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL40293.1|2627061_2627877_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
AUL40294.1|2627899_2628754_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40295.1|2628752_2629136_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUL40296.1|2629242_2630616_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	1.8e-50
AUL40297.1|2630687_2631179_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40298.1|2631178_2631931_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40299.1|2632278_2632482_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40300.1|2632511_2632934_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AUL40301.1|2632945_2634043_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUL40302.1|2634055_2635573_-	peptidase	NA	NA	NA	NA	NA
AUL40303.1|2635646_2636486_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
AUL40304.1|2636507_2637365_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40305.1|2637437_2638556_-	porin	NA	NA	NA	NA	NA
AUL40306.1|2639186_2640008_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL40307.1|2640046_2640307_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL40308.1|2640350_2640980_-	calcium:sodium antiporter	NA	NA	NA	NA	NA
AUL40309.1|2641137_2642481_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AUL40310.1|2642489_2642873_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40311.1|2643032_2644184_+	monooxygenase	NA	NA	NA	NA	NA
AUL40312.1|2645377_2646403_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
>prophage 20
CP018896	Bordetella holmesii isolate H785 chromosome, complete genome	3687739	2927557	3027327	3687739	transposase,tRNA	Ralstonia_virus(20.0%)	82	NA	NA
AUL40547.1|2927557_2928337_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AUL40548.1|2928359_2929307_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
AUL40549.1|2929308_2929509_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AUL40550.1|2929843_2930104_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL40551.1|2930142_2930964_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL40552.1|2931284_2932001_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
AUL40553.1|2931997_2932891_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL40554.1|2933054_2934275_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL40555.1|2934427_2935510_+	iron ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
AUL40556.1|2937189_2938173_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL40557.1|2938235_2939648_-	signal recognition particle protein	NA	NA	NA	NA	NA
AUL40558.1|2939765_2940608_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40559.1|2940886_2941495_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
AUL40560.1|2941510_2942131_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUL40561.1|2942196_2942907_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.6e-13
AUL40562.1|2942908_2943631_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
AUL40563.1|2943617_2943908_-	inner-membrane translocator	NA	NA	NA	NA	NA
AUL40564.1|2943983_2945204_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
AUL41317.1|2945928_2946780_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL40565.1|2946831_2948085_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL40566.1|2948261_2949050_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40567.1|2949169_2950084_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL40568.1|2950216_2952109_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
AUL40569.1|2952294_2953674_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
AUL40570.1|2954118_2954415_+	site-specific recombinase	NA	NA	NA	NA	NA
AUL40571.1|2954458_2954719_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL40572.1|2954811_2955312_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL40573.1|2955325_2955550_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL40574.1|2958215_2958818_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AUL40575.1|2958951_2959410_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AUL40576.1|2959411_2960011_-	iron transport sensor protein	NA	NA	NA	NA	NA
AUL40577.1|2960019_2960829_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL40578.1|2960863_2961718_+	permease	NA	NA	NA	NA	NA
AUL40579.1|2961837_2962425_+	histidine utilization protein HutD	NA	NA	NA	NA	NA
AUL40580.1|2962421_2963801_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
AUL40581.1|2972123_2973464_+	8-amino-7-oxononanoate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
AUL40582.1|2973477_2974329_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
AUL40583.1|2974340_2975606_-	capsule biosynthesis protein CapA	NA	NA	NA	NA	NA
AUL40584.1|2975667_2977749_-	beta-3-deoxy-D-manno-oct-2-ulosonic acid transferase	NA	NA	NA	NA	NA
AUL40585.1|2978697_2978958_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL40586.1|2979050_2979551_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL40587.1|2979547_2980402_-	sulfatase	NA	NA	NA	NA	NA
AUL40588.1|2980394_2981189_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL40589.1|2981404_2982355_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL40590.1|2982957_2983755_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL40591.1|2983794_2984448_-	DL-methionine transporter permease subunit	NA	NA	NA	NA	NA
AUL40592.1|2984428_2985493_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
AUL40593.1|2985656_2987882_-	glycosyl hydrolase	NA	NA	NA	NA	NA
AUL40594.1|2988127_2989972_-	FAD-dependent cmnm(5)s(2)U34 oxidoreductase	NA	NA	NA	NA	NA
AUL40595.1|2990088_2990961_+	inositol monophosphatase	NA	NA	NA	NA	NA
AUL40596.1|2991007_2992708_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
AUL40597.1|2992770_2993970_+	amidohydrolase	NA	NA	NA	NA	NA
AUL40598.1|2993980_2994859_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL40599.1|2994965_2996003_+	hypothetical protein	NA	NA	NA	NA	NA
AUL41318.1|2996083_2996488_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUL40600.1|2996499_2997957_+	magnesium transporter	NA	NA	NA	NA	NA
AUL40601.1|2998599_2999196_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AUL40602.1|2999356_2999815_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL40603.1|3000592_3001564_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40604.1|3001685_3002105_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40605.1|3002980_3003241_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL40606.1|3003396_3004617_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL40607.1|3004678_3005566_-	HflC protein	NA	NA	NA	NA	NA
AUL40608.1|3005583_3006888_-	HflK protein	NA	NA	NA	NA	NA
AUL40609.1|3006853_3007960_-	GTPase HflX	NA	NA	NA	NA	NA
AUL40610.1|3008047_3008284_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
AUL40611.1|3008467_3009541_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AUL40612.1|3009537_3010893_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AUL40613.1|3010917_3012075_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AUL40614.1|3012080_3012719_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40615.1|3012722_3014018_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AUL40616.1|3014050_3015337_-	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase	NA	NA	NA	NA	NA
AUL40617.1|3015349_3015838_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL40618.1|3015834_3016983_-	23S rRNA (adenine(2503)-C(2))-methyltransferase	NA	NA	NA	NA	NA
AUL40619.1|3017012_3017438_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.9	2.4e-22
AUL40620.1|3017757_3020637_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	1.1e-137
AUL40621.1|3020690_3021911_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL40622.1|3021959_3022823_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AUL40623.1|3022822_3023416_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUL40624.1|3023707_3023968_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUL40625.1|3024467_3024719_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40626.1|3024705_3027327_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.5	2.8e-84
>prophage 21
CP018896	Bordetella holmesii isolate H785 chromosome, complete genome	3687739	3086184	3141484	3687739	protease,transposase,tRNA	Ralstonia_virus(25.0%)	39	NA	NA
AUL40676.1|3086184_3087405_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL41320.1|3087446_3088703_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL40677.1|3088943_3090089_+	Bcr/CflA family drug resistance efflux transporter	NA	NA	NA	NA	NA
AUL40678.1|3090395_3090632_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AUL40679.1|3090712_3090880_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AUL40680.1|3091036_3092125_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40681.1|3092150_3093371_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL40682.1|3095589_3096021_+	DNA-binding protein	NA	NA	NA	NA	NA
AUL40683.1|3096147_3096660_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUL41321.1|3096692_3097853_+	MFS transporter	NA	NA	NA	NA	NA
AUL40684.1|3097924_3100582_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	38.7	7.5e-170
AUL40685.1|3100593_3101271_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40686.1|3101270_3102320_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AUL40687.1|3102343_3103603_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.2	1.9e-94
AUL40688.1|3103609_3103999_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40689.1|3104150_3104435_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL40690.1|3104431_3104821_+	hypothetical protein	NA	NA	NA	NA	NA
AUL41322.1|3104833_3105997_-	secretion protein	NA	NA	NA	NA	NA
AUL40691.1|3106023_3107784_-|protease	protease/lipase ABC transporter ATP-binding protein	protease	F2Y2R6	Organic_Lake_phycodnavirus	28.5	3.5e-14
AUL40692.1|3107780_3109082_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40693.1|3109319_3109580_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL40694.1|3109618_3110440_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL40695.1|3116840_3118358_-	propionyl-CoA--succinate CoA transferase	NA	NA	NA	NA	NA
AUL40696.1|3119592_3121983_+	mechanosensitive ion channel protein	NA	NA	NA	NA	NA
AUL40697.1|3121984_3122755_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40698.1|3122751_3123630_-	EamA family transporter	NA	NA	NA	NA	NA
AUL40699.1|3123813_3124104_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AUL40700.1|3124119_3124662_-	DNA polymerase III subunit epsilon	NA	A0A0A7RWA3	Clostridium_phage	29.7	7.2e-11
AUL40701.1|3124885_3127477_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
AUL40702.1|3130141_3130744_+	hypothetical protein	NA	NA	NA	NA	NA
AUL41323.1|3130992_3133698_+	aconitate hydratase 1	NA	NA	NA	NA	NA
AUL40703.1|3133763_3134546_-	dioxygenase	NA	NA	NA	NA	NA
AUL40704.1|3134707_3135913_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40705.1|3135919_3137008_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40706.1|3137165_3137723_+	elongation factor P	NA	NA	NA	NA	NA
AUL40707.1|3137804_3138239_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40708.1|3139120_3140503_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUL40709.1|3140512_3140965_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40710.1|3140983_3141484_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
>prophage 22
CP018896	Bordetella holmesii isolate H785 chromosome, complete genome	3687739	3341570	3408240	3687739	transposase,tRNA	Leptospira_phage(22.22%)	60	NA	NA
AUL40880.1|3341570_3343706_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUL40881.1|3343702_3344242_+	D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AUL40882.1|3344245_3344974_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUL40883.1|3344960_3345794_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40884.1|3345798_3346725_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL41333.1|3346803_3348219_+	FAD-binding dehydrogenase	NA	NA	NA	NA	NA
AUL40885.1|3348205_3349288_+	tricarballylate utilization protein B	NA	NA	NA	NA	NA
AUL40886.1|3349401_3349797_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
AUL40887.1|3349802_3350336_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.6	7.5e-13
AUL40888.1|3352726_3353956_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40889.1|3353956_3355399_-	pyruvate kinase	NA	NA	NA	NA	NA
AUL40890.1|3355494_3356637_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.0	3.2e-37
AUL40891.1|3356655_3357135_+	thioesterase	NA	NA	NA	NA	NA
AUL40892.1|3357163_3357952_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase	NA	NA	NA	NA	NA
AUL40893.1|3357965_3359504_-	molecular chaperone SurA	NA	NA	NA	NA	NA
AUL41334.1|3359500_3361909_-	LPS biosynthesis protein	NA	NA	NA	NA	NA
AUL40894.1|3362062_3363130_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AUL40895.1|3363129_3363810_+	mannose-1-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AUL40896.1|3363951_3364677_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40897.1|3364685_3365009_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
AUL40898.1|3365062_3365710_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40899.1|3365845_3366259_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40900.1|3366344_3367394_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AUL40901.1|3367539_3368490_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL40902.1|3368528_3369236_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL40903.1|3369203_3370025_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AUL40904.1|3370063_3370324_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL40905.1|3370381_3371890_-	sulfite reductase	NA	NA	NA	NA	NA
AUL40906.1|3372046_3373570_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40907.1|3373624_3374272_-	carbonate dehydratase	NA	NA	NA	NA	NA
AUL40908.1|3374414_3374756_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40909.1|3374913_3375246_+	PsiF repeat family protein	NA	NA	NA	NA	NA
AUL40910.1|3375294_3376335_-	cyclase	NA	NA	NA	NA	NA
AUL40911.1|3376338_3377118_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AUL40912.1|3377153_3377450_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40913.1|3377464_3377740_-	muconolactone delta-isomerase	NA	NA	NA	NA	NA
AUL40914.1|3377807_3378452_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUL40915.1|3378454_3378544_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUL40916.1|3378734_3379520_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL40917.1|3379557_3380283_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL40918.1|3380296_3381637_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
AUL40919.1|3381731_3382664_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL40920.1|3382892_3385664_-	peptidase S8	NA	NA	NA	NA	NA
AUL40921.1|3386103_3388950_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AUL40922.1|3389096_3389810_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	41.4	1.6e-47
AUL40923.1|3389822_3390365_-	GNAT family N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	45.8	1.1e-27
AUL40924.1|3390470_3391379_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.7	4.4e-05
AUL40925.1|3391470_3393327_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AUL40926.1|3393510_3394551_-	GntR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.2	4.3e-20
AUL40927.1|3394693_3395599_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AUL40928.1|3398294_3399062_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
AUL40929.1|3399179_3399824_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40930.1|3400087_3400384_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AUL40931.1|3400530_3401601_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AUL40932.1|3401833_3402028_-	hypothetical protein	NA	NA	NA	NA	NA
AUL40933.1|3402297_3403152_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40934.1|3403177_3404398_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL41335.1|3404715_3406647_+	hypothetical protein	NA	NA	NA	NA	NA
AUL40935.1|3407119_3407380_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL40936.1|3407418_3408240_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
>prophage 23
CP018896	Bordetella holmesii isolate H785 chromosome, complete genome	3687739	3601124	3649825	3687739	transposase,holin,tRNA	Catovirus(20.0%)	39	NA	NA
AUL41104.1|3601124_3602915_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.5	5.5e-07
AUL41105.1|3602956_3603592_-	hypothetical protein	NA	A0A2I7S9X1	Vibrio_phage	29.0	1.2e-12
AUL41106.1|3603594_3603909_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
AUL41107.1|3605459_3607082_-|holin	choline dehydrogenase	holin	A0A1V0S9J5	Catovirus	29.6	5.4e-46
AUL41108.1|3607252_3607357_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
AUL41109.1|3607349_3608060_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
AUL41110.1|3608334_3608823_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUL41111.1|3608964_3610164_+	2-aminoadipate aminotransferase	NA	NA	NA	NA	NA
AUL41112.1|3610239_3611163_+	4-hydroxybenzoate polyprenyltransferase	NA	NA	NA	NA	NA
AUL41113.1|3611497_3611878_+	hypothetical protein	NA	NA	NA	NA	NA
AUL41344.1|3612021_3612780_-	transcriptional regulator GlcC	NA	NA	NA	NA	NA
AUL41345.1|3612991_3615163_+	malate synthase G	NA	NA	NA	NA	NA
AUL41114.1|3615220_3616294_-	lipase	NA	G9BWD6	Planktothrix_phage	37.1	2.6e-28
AUL41115.1|3616286_3618056_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AUL41116.1|3618070_3619180_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL41117.1|3619295_3621785_-	signal protein	NA	NA	NA	NA	NA
AUL41118.1|3621771_3622443_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL41119.1|3622966_3624013_+	oxidoreductase	NA	NA	NA	NA	NA
AUL41120.1|3624021_3624591_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUL41121.1|3625688_3626771_+	UDP-N-acetylglucosamine 2-epimerase	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	33.2	1.1e-45
AUL41122.1|3626795_3628049_+	glycosyltransferase WbuB	NA	NA	NA	NA	NA
AUL41123.1|3628053_3629241_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	NA	NA	NA	NA
AUL41124.1|3629237_3629831_+	sugar transferase	NA	NA	NA	NA	NA
AUL41125.1|3630217_3632155_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	27.9	2.2e-25
AUL41126.1|3632288_3633239_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL41127.1|3633320_3634028_-	hypothetical protein	NA	NA	NA	NA	NA
AUL41128.1|3634091_3636728_+	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	26.3	8.0e-23
AUL41129.1|3636857_3638078_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.1e-181
AUL41130.1|3638156_3639212_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL41131.1|3639211_3639982_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL41132.1|3640549_3641350_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
AUL41133.1|3641438_3642866_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUL41134.1|3642960_3643461_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL41135.1|3643553_3643814_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL41346.1|3643879_3644578_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL41136.1|3646541_3647021_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL41137.1|3647008_3647935_-	bestrophin	NA	NA	NA	NA	NA
AUL41138.1|3648051_3648579_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
AUL41139.1|3648604_3649825_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
