The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	149310	195927	3695370	protease,transposase	uncultured_Mediterranean_phage(22.22%)	49	NA	NA
AUL34830.1|149310_149748_-|protease	ClpXP protease specificity-enhancing factor	protease	NA	NA	NA	NA
AUL34831.1|149756_150368_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUL34832.1|150520_151372_-	cytochrome c1	NA	NA	NA	NA	NA
AUL34833.1|151396_152785_-	cytochrome b	NA	NA	NA	NA	NA
AUL34834.1|152866_153508_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AUL34835.1|153656_154094_+	large-conductance mechanosensitive channel protein	NA	NA	NA	NA	NA
AUL34836.1|154151_154928_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AUL37864.1|154947_156078_+	2-alkenal reductase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	37.2	3.0e-11
AUL34837.1|156142_156928_-	twin arginine-targeting protein translocase TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	34.4	5.0e-29
AUL34838.1|156924_157422_-	twin arginine-targeting protein translocase TatB	NA	NA	NA	NA	NA
AUL34839.1|157470_157692_-	Sec-independent protein translocase TatA	NA	NA	NA	NA	NA
AUL34840.1|157707_158076_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
AUL34841.1|158083_158434_-	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
AUL34842.1|158430_158835_-	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
AUL34843.1|158836_159652_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
AUL34844.1|159648_160389_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
AUL34845.1|160455_161142_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
AUL34846.1|161160_161748_-	imidazoleglycerol-phosphate dehydratase	NA	NA	NA	NA	NA
AUL34847.1|161749_162844_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AUL34848.1|162840_164148_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
AUL34849.1|164173_164845_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
AUL34850.1|164841_166107_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUL34851.1|166106_166352_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
AUL34852.1|166355_167153_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AUL34853.1|167149_167959_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	2.8e-19
AUL34854.1|168095_168722_-	ABC transporter	NA	NA	NA	NA	NA
AUL34855.1|168747_169539_-	hypothetical protein	NA	NA	NA	NA	NA
AUL34856.1|169603_170092_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AUL34857.1|170104_170887_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL34858.1|170883_171720_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.7e-22
AUL34859.1|171901_172882_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL34860.1|172946_173582_-	hypothetical protein	NA	NA	NA	NA	NA
AUL34861.1|173782_175249_-	glutamate synthase	NA	NA	NA	NA	NA
AUL34862.1|175257_179997_-	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
AUL34863.1|180350_181571_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL34864.1|181686_182430_-	hypothetical protein	NA	NA	NA	NA	NA
AUL34865.1|182599_183706_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.1	1.4e-32
AUL34866.1|183716_184556_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AUL34867.1|184613_185303_+	hypothetical protein	NA	NA	NA	NA	NA
AUL34868.1|185399_185852_+	hypothetical protein	NA	NA	NA	NA	NA
AUL34869.1|185855_187076_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL34870.1|187299_188187_+	RNA polymerase factor sigma-32	NA	A0A248SJA5	Salicola_phage	38.5	2.1e-39
AUL34871.1|188501_189287_-	phosphodiesterase	NA	NA	NA	NA	NA
AUL34872.1|192129_192906_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AUL34873.1|193398_193659_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL34874.1|193751_194252_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL34875.1|194286_194556_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
AUL34876.1|194527_194878_+	bifunctional protein GlmU	NA	NA	NA	NA	NA
AUL34877.1|194976_195927_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	227717	264531	3695370	transposase	Leptospira_phage(40.0%)	32	NA	NA
AUL34901.1|227717_227978_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL34902.1|228070_228571_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL34903.1|228944_230165_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL34904.1|230819_232097_+	cytosine deaminase	NA	NA	NA	NA	NA
AUL34905.1|232151_232718_-	cysteine dioxygenase	NA	NA	NA	NA	NA
AUL34906.1|232803_233967_-	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUL34907.1|234135_234420_+	acylphosphatase	NA	NA	NA	NA	NA
AUL34908.1|234443_235082_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL34909.1|235203_236175_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL34910.1|237753_238524_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL34911.1|238735_239686_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL37872.1|239658_240162_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	49.7	3.4e-39
AUL34912.1|240238_241243_-	hypothetical protein	NA	NA	NA	NA	NA
AUL34913.1|241314_242883_-	acetolactate synthase large subunit	NA	G9E4W7	Ostreococcus_lucimarinus_virus	27.1	4.5e-05
AUL34914.1|243019_244069_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AUL34915.1|244071_245256_+	CoA transferase	NA	NA	NA	NA	NA
AUL34916.1|245284_246415_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL34917.1|246427_247570_+	carnitine dehydratase	NA	NA	NA	NA	NA
AUL34918.1|249379_249994_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL34919.1|250042_250945_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL34920.1|251071_251461_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUL34921.1|251462_252344_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
AUL34922.1|252372_253341_+	MFS transporter	NA	NA	NA	NA	NA
AUL34923.1|253549_254539_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL34924.1|256088_256868_+	oxidoreductase	NA	NA	NA	NA	NA
AUL37873.1|256898_258644_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AUL34925.1|258640_259543_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
AUL34926.1|259826_261035_+	ferredoxin reductase	NA	NA	NA	NA	NA
AUL34927.1|261216_261480_+	hypothetical protein	NA	NA	NA	NA	NA
AUL34928.1|261485_261965_+	DUF188 domain-containing protein	NA	NA	NA	NA	NA
AUL34929.1|262025_263135_-	porin	NA	NA	NA	NA	NA
AUL34930.1|263310_264531_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 3
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	586685	655519	3695370	tRNA,transposase	Staphylococcus_phage(21.43%)	59	NA	NA
AUL35207.1|586685_587549_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL35208.1|587632_588760_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
AUL35209.1|588768_590184_-	metallopeptidase	NA	A8ATH6	Listeria_phage	42.7	6.7e-16
AUL35210.1|590463_591693_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
AUL35211.1|591731_592388_+	phospholipid-binding protein	NA	NA	NA	NA	NA
AUL35212.1|592591_593842_+	serine hydroxymethyltransferase	NA	A0A219YCZ0	Aeromonas_phage	52.2	2.8e-98
AUL35213.1|594002_594488_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AUL35214.1|594492_595455_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL35215.1|595454_596015_-	hydrolase	NA	NA	NA	NA	NA
AUL35216.1|596050_597325_+	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	31.9	1.5e-38
AUL35217.1|597346_597988_+	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	36.1	7.2e-26
AUL35218.1|600275_601538_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35219.1|601534_603055_+	SpoVR family protein	NA	NA	NA	NA	NA
AUL35220.1|603051_603888_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL35221.1|605125_606025_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL35222.1|606400_607057_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUL35223.1|607234_607642_-	alkylhydroperoxidase	NA	NA	NA	NA	NA
AUL35224.1|608956_610177_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL35225.1|610173_610644_+	MFS permease	NA	NA	NA	NA	NA
AUL35226.1|610653_611109_-	hypothetical protein	NA	NA	NA	NA	NA
AUL35227.1|612076_613645_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AUL35228.1|613867_614305_+	universal stress protein	NA	NA	NA	NA	NA
AUL35229.1|614316_614727_-	hypothetical protein	NA	NA	NA	NA	NA
AUL35230.1|614757_615531_-	NADH pyrophosphatase	NA	NA	NA	NA	NA
AUL35231.1|615758_617861_+	dehydrogenase	NA	NA	NA	NA	NA
AUL35232.1|618369_619218_+	two-component response regulator	NA	NA	NA	NA	NA
AUL35233.1|619237_619453_-	hypothetical protein	NA	NA	NA	NA	NA
AUL35234.1|619607_620504_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35235.1|620607_621498_+	nicotinate-nucleotide diphosphorylase (carboxylating)	NA	NA	NA	NA	NA
AUL35236.1|621574_622543_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL35237.1|622543_623254_-	hypothetical protein	NA	NA	NA	NA	NA
AUL35238.1|623329_625423_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL35239.1|625452_625761_-	hypothetical protein	NA	NA	NA	NA	NA
AUL35240.1|625947_626733_-	enoyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
AUL35241.1|626791_628204_-	lytic transglycosylase	NA	A0A223LD43	Bacillus_phage	29.3	2.1e-06
AUL35242.1|628211_629021_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AUL35243.1|629038_629803_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL35244.1|629871_630333_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	51.5	4.5e-38
AUL35245.1|630457_631540_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUL35246.1|631555_631753_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35247.1|631715_632936_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL35248.1|635945_636680_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	42.4	2.6e-40
AUL35249.1|636848_638069_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL35250.1|638443_639430_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AUL35251.1|639433_642157_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	6.6e-20
AUL35252.1|642157_643285_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35253.1|643297_644710_+	RND transporter	NA	NA	NA	NA	NA
AUL35254.1|644884_645541_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL35255.1|645561_646608_+	glycosyltransferase	NA	F1C5B0	Cronobacter_phage	39.5	1.4e-58
AUL35256.1|646604_648194_+	dolichyl-phosphate-mannose--protein mannosyltransferase	NA	NA	NA	NA	NA
AUL35257.1|648348_649458_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35258.1|649447_650344_-	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	33.1	6.5e-09
AUL35259.1|650390_651023_-	hypothetical protein	NA	NA	NA	NA	NA
AUL35260.1|651047_651932_-	EamA family transporter	NA	NA	NA	NA	NA
AUL35261.1|652059_653541_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL35262.1|653613_653958_+	TIGR01244 family protein	NA	NA	NA	NA	NA
AUL35263.1|654043_654508_+	universal stress protein	NA	NA	NA	NA	NA
AUL35264.1|654665_654926_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL35265.1|655018_655519_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	49.7	2.8e-41
>prophage 4
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	658827	723874	3695370	tRNA,transposase	Ralstonia_virus(42.86%)	58	NA	NA
AUL35268.1|658827_659778_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL35269.1|659810_660257_+|tRNA	cys-tRNA(pro)/cys-tRNA(cys) deacylase	tRNA	NA	NA	NA	NA
AUL35270.1|660305_660995_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
AUL35271.1|661082_661577_-	peptidoglycan-associated lipoprotein	NA	NA	NA	NA	NA
AUL35272.1|661608_662925_-	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
AUL35273.1|662941_663862_-	protein TolA	NA	NA	NA	NA	NA
AUL35274.1|663896_664358_-	protein TolR	NA	NA	NA	NA	NA
AUL35275.1|664357_665032_-	protein TolQ	NA	NA	NA	NA	NA
AUL35276.1|665034_665457_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUL35277.1|665510_667241_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	28.6	1.2e-11
AUL35278.1|667306_667876_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AUL35279.1|667856_668543_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL35280.1|668562_670068_+	sensor histidine kinase	NA	NA	NA	NA	NA
AUL35281.1|670296_670746_+	tripartite tricarboxylate transporter TctB	NA	NA	NA	NA	NA
AUL35282.1|670751_672272_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35283.1|672325_673546_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL35284.1|673642_674572_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL35285.1|674730_675636_-	oxidoreductase	NA	NA	NA	NA	NA
AUL35286.1|675835_677056_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL35287.1|677111_678617_-	hypothetical protein	NA	NA	NA	NA	NA
AUL35288.1|678638_679094_-	tricarboxylate transporter	NA	NA	NA	NA	NA
AUL35289.1|679450_680023_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35290.1|680022_680334_+	cell division protein ZapA	NA	NA	NA	NA	NA
AUL35291.1|680647_681409_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35292.1|681377_682172_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AUL35293.1|682350_682686_+	cytochrome C	NA	NA	NA	NA	NA
AUL35294.1|682702_683260_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AUL35295.1|683321_684434_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
AUL35296.1|684574_685051_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL35297.1|691392_691587_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35298.1|691714_691975_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL35299.1|692067_692568_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL35300.1|692805_693180_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35301.1|693397_693676_-	DNA topoisomerase III	NA	NA	NA	NA	NA
AUL35302.1|693824_695018_+	peptidase M20	NA	NA	NA	NA	NA
AUL35303.1|695030_696089_+	dihydroorotase	NA	NA	NA	NA	NA
AUL35304.1|696126_697935_-	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	29.5	2.5e-44
AUL35305.1|698709_699138_+	cell division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
AUL35306.1|699146_700220_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	NA	NA	NA	NA
AUL35307.1|700219_700507_+	cell division protein FtsL	NA	NA	NA	NA	NA
AUL35308.1|700503_702237_+	cell division protein	NA	NA	NA	NA	NA
AUL35309.1|702233_705056_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
AUL35310.1|705045_706215_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AUL35311.1|706211_707744_+	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	NA	NA	NA	NA
AUL35312.1|707740_708934_+	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
AUL35313.1|708930_710004_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AUL35314.1|710000_711407_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
AUL35315.1|711403_712357_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AUL35316.1|712365_713190_+	cell division protein FtsQ	NA	NA	NA	NA	NA
AUL35317.1|713194_714421_+	cell division protein FtsA	NA	NA	NA	NA	NA
AUL35318.1|714616_715801_+	cell division protein FtsZ	NA	NA	NA	NA	NA
AUL35319.1|716040_716964_+	UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
AUL35320.1|717054_717270_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35321.1|717306_717801_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
AUL35322.1|717843_718827_+	peptidase M23	NA	A0A292GJG6	Xanthomonas_phage	47.7	1.2e-27
AUL35323.1|718987_721723_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AUL35324.1|721724_722444_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35325.1|722653_723874_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 5
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	798482	903672	3695370	holin,transposase	Ralstonia_virus(18.52%)	100	NA	NA
AUL35387.1|798482_800582_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AUL35388.1|800723_801563_-	branched chain amino acid aminotransferase	NA	NA	NA	NA	NA
AUL35389.1|802692_803580_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL35390.1|803670_803817_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL35391.1|803880_804885_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL35392.1|805791_806052_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL35393.1|806326_806962_-	endonuclease III	NA	NA	NA	NA	NA
AUL35394.1|806982_807621_-	ferredoxin	NA	NA	NA	NA	NA
AUL35395.1|807671_808898_-	esterase	NA	NA	NA	NA	NA
AUL35396.1|809034_809832_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AUL35397.1|809862_810186_-	ferredoxin	NA	NA	NA	NA	NA
AUL35398.1|810350_811526_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	32.5	4.2e-48
AUL35399.1|811564_811918_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35400.1|811948_812368_-	hypothetical protein	NA	NA	NA	NA	NA
AUL35401.1|812460_813300_-	hypothetical protein	NA	NA	NA	NA	NA
AUL35402.1|813496_815743_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AUL35403.1|815762_817076_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	41.0	1.5e-83
AUL35404.1|817241_818393_+	acetylornithine deacetylase (ArgE)	NA	NA	NA	NA	NA
AUL35405.1|818533_819733_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AUL35406.1|819729_820593_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AUL35407.1|820622_821501_+	acetyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
AUL35408.1|821709_822255_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35409.1|822425_822686_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL35410.1|823634_826766_-	ribonuclease E/G	NA	NA	NA	NA	NA
AUL35411.1|827345_828251_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AUL35412.1|828252_828909_+	HAD family hydrolase	NA	NA	NA	NA	NA
AUL35413.1|829026_829986_+	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AUL35414.1|829998_830625_+	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AUL35415.1|830605_831388_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	32.4	5.0e-13
AUL37895.1|831391_832102_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL35416.1|832098_832692_-	septum formation protein Maf	NA	NA	NA	NA	NA
AUL35417.1|832909_833557_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35418.1|833609_833792_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
AUL35419.1|833850_834915_+	phosphate acyltransferase	NA	NA	NA	NA	NA
AUL35420.1|834914_835901_+	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
AUL35421.1|835960_836896_+	[acyl-carrier-protein] S-malonyltransferase	NA	NA	NA	NA	NA
AUL35422.1|836898_837648_+	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.0	2.7e-16
AUL35423.1|837865_838105_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	48.5	1.6e-10
AUL35424.1|838276_839506_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AUL35425.1|839508_839940_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35426.1|839936_840536_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	26.9	2.6e-06
AUL35427.1|840548_841034_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35428.1|841033_842068_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AUL35429.1|842108_843611_+	serine peptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.2	1.1e-21
AUL35430.1|843695_844685_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.8	7.4e-147
AUL35431.1|844742_845003_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL35432.1|845095_845596_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL35433.1|846036_846987_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL35434.1|847054_848848_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.5	1.4e-23
AUL35435.1|848871_849756_+	S26 family signal peptidase	NA	NA	NA	NA	NA
AUL35436.1|849761_850517_+	ribonuclease III	NA	M4QNJ2	Ostreococcus_lucimarinus_virus	33.5	1.5e-19
AUL35437.1|850513_851404_+	GTPase Era	NA	NA	NA	NA	NA
AUL35438.1|851396_851984_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AUL35439.1|852006_853098_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.9	2.1e-17
AUL35440.1|853107_854328_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL35441.1|854736_855447_-	hypothetical protein	NA	NA	NA	NA	NA
AUL35442.1|855539_855788_-	hypothetical protein	NA	NA	NA	NA	NA
AUL35443.1|855806_856244_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AUL35444.1|856261_857776_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.9	7.3e-53
AUL35445.1|857830_858940_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AUL35446.1|860029_861247_+	ABC transporter permease	NA	NA	NA	NA	NA
AUL35447.1|861310_862795_+	methylmalonate-semialdehyde dehydrogenase (acylating)	NA	NA	NA	NA	NA
AUL35448.1|862951_863896_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL35449.1|864022_865243_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL35450.1|865410_865746_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35451.1|865941_866607_-	hypothetical protein	NA	A0A0A8WF62	Clostridium_phage	34.5	1.6e-15
AUL35452.1|866852_868742_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	30.7	2.4e-61
AUL35453.1|868738_869146_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35454.1|869229_870456_+	MFS transporter	NA	NA	NA	NA	NA
AUL35455.1|870605_872585_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	43.6	6.1e-84
AUL35456.1|872650_873871_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL35457.1|874898_875912_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AUL35458.1|875933_876767_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL35459.1|876816_878463_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
AUL35460.1|878595_879042_+	thioesterase	NA	NA	NA	NA	NA
AUL35461.1|879156_879855_+	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUL35462.1|879867_880521_+	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUL35463.1|880721_881606_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL35464.1|881602_882583_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
AUL35465.1|882620_884501_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.8	2.0e-20
AUL35466.1|884575_886129_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
AUL35467.1|886202_887123_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
AUL35468.1|887130_888024_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
AUL35469.1|888113_889181_+	aminopeptidase	NA	NA	NA	NA	NA
AUL35470.1|889191_890010_+	aminopeptidase	NA	NA	NA	NA	NA
AUL35471.1|890024_891821_+	Xaa-Pro aminopeptidase	NA	A0A0P0I8D7	Acinetobacter_phage	49.7	1.7e-165
AUL35472.1|892064_893717_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.5	1.7e-156
AUL35473.1|893888_894092_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35474.1|894066_894171_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35475.1|894174_895461_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	63.4	5.5e-150
AUL35476.1|895534_895906_+	cell division protein FtsB	NA	NA	NA	NA	NA
AUL35477.1|895924_896554_-	hypothetical protein	NA	NA	NA	NA	NA
AUL35478.1|896633_897554_-	Hsp33 family molecular chaperone	NA	NA	NA	NA	NA
AUL35479.1|897592_898114_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AUL35480.1|898136_899804_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	33.4	9.8e-67
AUL35481.1|899999_900839_-	UDP-2,3-diacylglucosamine hydrolase	NA	A0A218MKA7	uncultured_virus	48.1	1.9e-66
AUL35482.1|900920_901445_-	RDD family protein	NA	NA	NA	NA	NA
AUL35483.1|901767_902268_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL35484.1|902360_902621_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL35485.1|902664_903672_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.4e-147
>prophage 6
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	917580	992193	3695370	tRNA,transposase	Ralstonia_virus(36.36%)	58	NA	NA
AUL35499.1|917580_918585_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
AUL35500.1|918612_919482_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL35501.1|919648_920725_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	1.9e-26
AUL35502.1|920702_922463_+	phosphonate ABC transporter permease	NA	NA	NA	NA	NA
AUL35503.1|922494_922959_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
AUL35504.1|922924_923242_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35505.1|924359_925487_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL35506.1|925528_926023_-	hypothetical protein	NA	NA	NA	NA	NA
AUL35507.1|926067_926751_-	Fe2+-dependent dioxygenase	NA	A0A1D8KSK5	Synechococcus_phage	39.5	3.9e-14
AUL35508.1|926760_928944_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL35509.1|929083_930304_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
AUL35510.1|930434_932717_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
AUL35511.1|932890_935548_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AUL35512.1|935783_937829_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
AUL35513.1|938166_941037_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
AUL35514.1|941083_942307_+	dihydrolipoamide succinyltransferase	NA	NA	NA	NA	NA
AUL35515.1|942377_943805_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	1.6e-41
AUL35516.1|943882_944974_+	cell division protein ZapE	NA	NA	NA	NA	NA
AUL35517.1|945112_945634_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL35518.1|945630_946542_+	transmembrane sensor protein	NA	NA	NA	NA	NA
AUL35519.1|946635_949095_+	ligand-gated channel	NA	NA	NA	NA	NA
AUL35520.1|949327_949492_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35521.1|951102_951441_+	iron uptake protein	NA	NA	NA	NA	NA
AUL35522.1|951484_952807_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUL35523.1|952860_955248_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
AUL35524.1|955413_957462_+	helicase	NA	A0A127AW80	Bacillus_phage	28.0	3.2e-75
AUL35525.1|957527_958352_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AUL35526.1|958428_959388_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AUL35527.1|959375_960140_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35528.1|960265_961891_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
AUL35529.1|961940_962678_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL35530.1|962769_963330_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
AUL35531.1|963504_964044_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35532.1|964046_964379_+	periplasmic lipoprotein involved in iron transport	NA	NA	NA	NA	NA
AUL35533.1|964389_965235_+	FTR1 family iron permease	NA	NA	NA	NA	NA
AUL35534.1|965256_966636_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35535.1|966684_967596_+	phenazine biosynthesis protein PhzC/PhzF	NA	NA	NA	NA	NA
AUL35536.1|967762_968098_-	phospholipid-binding protein	NA	NA	NA	NA	NA
AUL35537.1|968147_969368_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL35538.1|969489_969654_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
AUL35539.1|969711_969912_-	general stress protein CsbD	NA	NA	NA	NA	NA
AUL35540.1|970216_970750_-	cytochrome B	NA	A0A0U2QLA7	Escherichia_phage	43.3	8.3e-12
AUL35541.1|976372_978649_+	ABC transporter	NA	W8CYL7	Bacillus_phage	31.3	6.6e-58
AUL35542.1|978645_979125_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35543.1|979121_980255_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL35544.1|980307_981111_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35545.1|981144_982353_+	lytic transglycosylase	NA	NA	NA	NA	NA
AUL35546.1|982434_982863_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35547.1|983195_984752_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
AUL35548.1|984788_985109_-	hypothetical protein	NA	NA	NA	NA	NA
AUL35549.1|985244_985976_+	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL35550.1|986034_986559_+	DedA family protein	NA	NA	NA	NA	NA
AUL35551.1|986610_988050_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL35552.1|989016_989346_+	regulator	NA	NA	NA	NA	NA
AUL35553.1|989342_989849_+	toxin	NA	NA	NA	NA	NA
AUL37897.1|990070_991003_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	76.8	1.9e-136
AUL35554.1|991072_991333_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL35555.1|991371_992193_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
>prophage 7
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	1095269	1206679	3695370	transposase,protease	Ralstonia_virus(23.08%)	91	NA	NA
AUL35641.1|1095269_1096490_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL35642.1|1096577_1097168_+	EamA family transporter	NA	NA	NA	NA	NA
AUL35643.1|1097155_1097467_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35644.1|1097518_1098508_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AUL35645.1|1098628_1099510_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
AUL35646.1|1099683_1100538_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35647.1|1100569_1101418_+	sulfurtransferase	NA	NA	NA	NA	NA
AUL35648.1|1101545_1102766_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
AUL35649.1|1102784_1103351_-	phosphohydrolase	NA	NA	NA	NA	NA
AUL35650.1|1103548_1104700_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUL35651.1|1104838_1105843_-	hypothetical protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
AUL35652.1|1105999_1106971_-	MFS transporter	NA	NA	NA	NA	NA
AUL35653.1|1107049_1107838_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL35654.1|1107909_1108146_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AUL35655.1|1108154_1109066_+	geranyl transferase	NA	NA	NA	NA	NA
AUL35656.1|1109109_1110981_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUL35657.1|1111141_1111939_+	GTP cyclohydrolase	NA	NA	NA	NA	NA
AUL35658.1|1112170_1112545_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
AUL35659.1|1112621_1112945_+	primosomal replication protein N	NA	NA	NA	NA	NA
AUL35660.1|1113028_1113301_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
AUL35661.1|1113315_1113771_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AUL35662.1|1113892_1114729_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35663.1|1114725_1116099_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
AUL35664.1|1116175_1117132_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
AUL35665.1|1117219_1118197_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
AUL35666.1|1118321_1119977_-	phosphate starvation-inducible protein PhoH	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
AUL35667.1|1120025_1120490_-	peroxiredoxin	NA	NA	NA	NA	NA
AUL35668.1|1120486_1120948_-	hypothetical protein	NA	NA	NA	NA	NA
AUL35669.1|1121173_1122361_+	alanine transaminase	NA	NA	NA	NA	NA
AUL35670.1|1122357_1123662_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
AUL35671.1|1123658_1125068_+	threonine synthase	NA	NA	NA	NA	NA
AUL35672.1|1125261_1125522_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL35673.1|1125560_1126382_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL35674.1|1126516_1127536_-	fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
AUL35675.1|1127544_1130250_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
AUL35676.1|1130389_1131043_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35677.1|1131105_1131468_-	DNA-binding protein	NA	NA	NA	NA	NA
AUL35678.1|1132034_1133495_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AUL35679.1|1133757_1134831_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
AUL35680.1|1134915_1136136_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
AUL35681.1|1137893_1138715_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL35682.1|1138753_1139014_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL35683.1|1139085_1140612_+	23S rRNA (uracil(1939)-C(5))-methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	25.4	1.7e-28
AUL35684.1|1140608_1141004_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUL35685.1|1141000_1143274_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.2	4.1e-92
AUL35686.1|1143425_1143626_+	heavy metal transporter	NA	NA	NA	NA	NA
AUL35687.1|1143762_1144491_+	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	56.0	7.3e-43
AUL35688.1|1144600_1146013_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
AUL35689.1|1146023_1146896_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
AUL35690.1|1146907_1147657_-	glycerophosphodiester phosphodiesterase	NA	A0A1J0F961	Only_Syngen_Nebraska_virus	27.5	6.2e-13
AUL35691.1|1147928_1149884_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUL35692.1|1149865_1150489_-	arylesterase	NA	NA	NA	NA	NA
AUL35693.1|1150523_1151204_+	ABC transporter	NA	G9BWD6	Planktothrix_phage	40.3	5.8e-34
AUL35694.1|1151200_1152151_-	EamA family transporter	NA	NA	NA	NA	NA
AUL35695.1|1161426_1162599_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.3	1.6e-148
AUL37903.1|1162558_1163002_+	fimbrial protein	NA	NA	NA	NA	NA
AUL35696.1|1163110_1163905_+	molecular chaperone	NA	NA	NA	NA	NA
AUL35697.1|1163919_1166448_+	outer membrane fimbrial usher protein	NA	NA	NA	NA	NA
AUL35698.1|1166515_1167556_+	adhesin	NA	NA	NA	NA	NA
AUL35699.1|1167632_1169312_+	filamentous hemagglutinin	NA	NA	NA	NA	NA
AUL35700.1|1169308_1170121_-	peptidase C45	NA	NA	NA	NA	NA
AUL35701.1|1170535_1171288_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
AUL35702.1|1171370_1172030_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AUL35703.1|1172026_1172755_+	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	9.6e-35
AUL35704.1|1172857_1175155_-	guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	32.8	2.0e-06
AUL35705.1|1175178_1175382_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AUL35706.1|1175425_1176058_-	guanylate kinase	NA	A0A223FN12	Murmansk_poxvirus	34.0	7.8e-17
AUL35707.1|1176231_1177002_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL35708.1|1177038_1177623_-	NlpC/P60 family protein 2	NA	A0A0A8WF62	Clostridium_phage	42.3	2.0e-22
AUL35709.1|1177874_1179365_+	AMP nucleosidase	NA	NA	NA	NA	NA
AUL35710.1|1180866_1181799_-	YicC family protein	NA	NA	NA	NA	NA
AUL35711.1|1181916_1182669_+	ribonuclease PH	NA	NA	NA	NA	NA
AUL35712.1|1182756_1183161_+	preprotein translocase subunit TatC	NA	NA	NA	NA	NA
AUL35713.1|1183174_1184533_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AUL35714.1|1184538_1185699_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL35715.1|1185826_1186741_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL35716.1|1186756_1187977_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	2.7e-183
AUL35717.1|1188052_1189792_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.7	2.2e-13
AUL35718.1|1189711_1191502_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUL35719.1|1191691_1192315_+	non-canonical purine NTP pyrophosphatase, RdgB/HAM1 family	NA	NA	NA	NA	NA
AUL35720.1|1192320_1193544_+	YggW family oxidoreductase	NA	NA	NA	NA	NA
AUL35721.1|1193725_1195138_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
AUL35722.1|1195231_1196296_+	PAS domain-containing sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.6	2.5e-07
AUL35723.1|1196295_1197798_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
AUL35724.1|1197926_1198751_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL35725.1|1199812_1200718_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35726.1|1200731_1201508_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	36.0	1.9e-25
AUL35727.1|1201512_1203174_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AUL35728.1|1203275_1204322_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL35729.1|1204624_1205401_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AUL35730.1|1205458_1206679_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	1228512	1264953	3695370	transposase	Ralstonia_virus(22.22%)	36	NA	NA
AUL35745.1|1228512_1229733_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	2.7e-183
AUL35746.1|1229836_1230925_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.2	1.3e-22
AUL35747.1|1230970_1231822_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
AUL35748.1|1231846_1232728_-	glycerol-3-phosphate transporter permease	NA	NA	NA	NA	NA
AUL35749.1|1233012_1234323_-	sn-glycerol-3-phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL35750.1|1234514_1235348_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
AUL35751.1|1235344_1235893_+	hypothetical protein	NA	A0A2I7SAW6	Vibrio_phage	34.6	1.7e-15
AUL35752.1|1236242_1237358_+	leucine ABC transporter subunit substrate-binding protein LivK	NA	NA	NA	NA	NA
AUL35753.1|1237461_1238388_+	branched-chain amino acid ABC transporter permease LivH	NA	NA	NA	NA	NA
AUL35754.1|1238387_1239626_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
AUL35755.1|1239622_1240390_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-15
AUL35756.1|1240390_1241092_+	branched-chain amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.0	2.1e-15
AUL35757.1|1241182_1241953_-	glutamate racemase	NA	NA	NA	NA	NA
AUL35758.1|1242257_1243478_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL35759.1|1243816_1244431_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUL35760.1|1244538_1245678_+	oxidoreductase	NA	NA	NA	NA	NA
AUL35761.1|1245682_1246582_-	EamA family transporter	NA	NA	NA	NA	NA
AUL35762.1|1246617_1246965_-	hypothetical protein	NA	NA	NA	NA	NA
AUL35763.1|1246938_1247199_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL35764.1|1247237_1248059_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AUL35765.1|1248423_1249188_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL35766.1|1249222_1250476_-	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUL35767.1|1250533_1251424_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AUL35768.1|1251497_1252016_-	hypothetical protein	NA	NA	NA	NA	NA
AUL35769.1|1252088_1253588_-	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
AUL35770.1|1254912_1256610_-	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.7	4.0e-31
AUL35771.1|1256606_1257497_-	CoA ester lyase	NA	NA	NA	NA	NA
AUL35772.1|1257493_1258777_-	C4-dicarboxylate ABC transporter permease	NA	NA	NA	NA	NA
AUL35773.1|1258781_1259255_-	TRAP transporter small permease protein	NA	NA	NA	NA	NA
AUL35774.1|1259257_1260244_-	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL35775.1|1260376_1261102_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL35776.1|1261238_1261616_-	hypothetical protein	NA	NA	NA	NA	NA
AUL35777.1|1261695_1263396_-	transporter	NA	NA	NA	NA	NA
AUL35778.1|1263485_1263800_-	glutamate decarboxylase	NA	NA	NA	NA	NA
AUL35779.1|1263832_1264654_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL35780.1|1264692_1264953_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	1423866	1592095	3695370	integrase,transposase,tRNA,holin	Ralstonia_virus(18.52%)	159	1498941:1499000	1592118:1592880
AUL35923.1|1423866_1424817_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL35924.1|1424807_1425992_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL35925.1|1426071_1426989_-	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL35926.1|1426990_1427485_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AUL35927.1|1427627_1428608_-	hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	29.2	5.6e-14
AUL37911.1|1428591_1429332_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL35928.1|1429374_1429635_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL35929.1|1430572_1430779_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35930.1|1430786_1431416_-	antibiotic resistance protein	NA	NA	NA	NA	NA
AUL35931.1|1431710_1433915_-	porin	NA	NA	NA	NA	NA
AUL35932.1|1434025_1435249_-	multidrug transporter	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
AUL35933.1|1435371_1436346_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL35934.1|1436413_1437607_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUL35935.1|1437621_1438422_-	siderophore ferric iron reductase	NA	NA	NA	NA	NA
AUL35936.1|1438418_1440275_-	IucA/IucC family protein	NA	NA	NA	NA	NA
AUL35937.1|1440271_1440877_-	siderophore biosynthesis protein	NA	NA	NA	NA	NA
AUL35938.1|1440895_1442281_-	alcaligin biosynthesis protein	NA	NA	NA	NA	NA
AUL35939.1|1444322_1445105_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
AUL35940.1|1445203_1446154_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL35941.1|1446180_1446954_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
AUL35942.1|1446965_1448207_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35943.1|1449858_1450809_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL35944.1|1450890_1451502_-	hypothetical protein	NA	NA	NA	NA	NA
AUL35945.1|1451972_1453688_+	acetolactate synthase, large subunit, biosynthetic type	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
AUL35946.1|1453698_1454190_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
AUL35947.1|1454262_1455279_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AUL35948.1|1455446_1456226_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AUL35949.1|1456244_1456763_-	hypothetical protein	NA	NA	NA	NA	NA
AUL35950.1|1456761_1456968_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35951.1|1457056_1457326_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
AUL35952.1|1457415_1459581_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
AUL35953.1|1459737_1460469_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35954.1|1460481_1461234_+	serine/threonine dehydratase	NA	NA	NA	NA	NA
AUL35955.1|1461213_1462164_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL37913.1|1462238_1462748_+	threonine dehydratase	NA	NA	NA	NA	NA
AUL37912.1|1462741_1463323_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AUL35956.1|1463661_1464609_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL35957.1|1464771_1465644_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL35958.1|1465657_1466584_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL37914.1|1466624_1466786_+	branched-chain amino acid ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL35959.1|1466745_1467696_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL35960.1|1468478_1469699_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
AUL35961.1|1469709_1470423_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
AUL35962.1|1470460_1471582_+	transporter	NA	NA	NA	NA	NA
AUL35963.1|1471657_1472878_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL35964.1|1472925_1473285_-	lysine transporter LysE	NA	NA	NA	NA	NA
AUL35965.1|1473365_1473914_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35966.1|1474074_1475253_+	arabinose transporter	NA	NA	NA	NA	NA
AUL35967.1|1475238_1475874_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AUL35968.1|1475939_1476671_+	pseudouridylate synthase	NA	NA	NA	NA	NA
AUL35969.1|1476739_1477672_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL35970.1|1477860_1479057_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUL35971.1|1479069_1482240_+	multidrug efflux RND transporter permease	NA	NA	NA	NA	NA
AUL35972.1|1482236_1483715_+	multidrug transporter	NA	NA	NA	NA	NA
AUL35973.1|1483802_1484054_-	hypothetical protein	NA	NA	NA	NA	NA
AUL35974.1|1484153_1484774_-	SCO family protein	NA	NA	NA	NA	NA
AUL35975.1|1485131_1485647_+	methyltransferase	NA	NA	NA	NA	NA
AUL35976.1|1485643_1486594_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL35977.1|1486703_1488758_-	oligopeptidase A	NA	NA	NA	NA	NA
AUL35978.1|1488877_1489732_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.8	1.4e-29
AUL35979.1|1489728_1490355_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL37915.1|1490351_1492106_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
AUL35980.1|1492651_1495363_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AUL35981.1|1495375_1497040_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
AUL35982.1|1497055_1498831_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	3.5e-38
1498941:1499000	attL	CTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTTTCTG	NA	NA	NA	NA
AUL35983.1|1499244_1499457_+	hypothetical protein	NA	NA	NA	NA	NA
1498941:1499000	attL	CTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTTTCTG	NA	NA	NA	NA
AUL35984.1|1499629_1500610_+	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL35985.1|1500626_1501421_+	ABC transporter permease	NA	NA	NA	NA	NA
AUL35986.1|1501445_1501922_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL35987.1|1502538_1503192_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL35988.1|1503273_1504209_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL35989.1|1504470_1504617_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
AUL35990.1|1504707_1505109_+	hypothetical protein	NA	NA	NA	NA	NA
AUL35991.1|1505183_1506068_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL35992.1|1506160_1506865_+	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AUL35993.1|1506903_1508985_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AUL35994.1|1509117_1510029_-	3-phosphoglycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	30.7	3.7e-20
AUL35995.1|1510093_1510525_-	energy transducer TonB	NA	NA	NA	NA	NA
AUL35996.1|1510627_1511626_-	cointegrate resolution protein	NA	NA	NA	NA	NA
AUL37916.1|1511869_1512853_+|integrase	integrase	integrase	NA	NA	NA	NA
AUL35997.1|1512969_1513251_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUL35998.1|1513324_1513789_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL35999.1|1514008_1514278_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36000.1|1514352_1514571_+	SlyX protein	NA	NA	NA	NA	NA
AUL36001.1|1514596_1515379_+	hydrolase	NA	NA	NA	NA	NA
AUL36002.1|1515417_1515915_-	osmotically inducible protein Y	NA	NA	NA	NA	NA
AUL36003.1|1516213_1517437_+	MFS transporter	NA	NA	NA	NA	NA
AUL36004.1|1517433_1518294_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL36005.1|1518512_1519733_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL36006.1|1519821_1521141_+	MFS transporter	NA	NA	NA	NA	NA
AUL36007.1|1521194_1523366_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AUL36008.1|1523593_1524406_-	nucleotide pyrophosphatase	NA	NA	NA	NA	NA
AUL36009.1|1524481_1525486_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
AUL36010.1|1526551_1527373_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
1526540:1526618	attR	CTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTTTCTGATGAGCCTGCACGAATTGC	NA	NA	NA	NA
AUL36011.1|1527411_1527672_-|transposase	transposase	transposase	NA	NA	NA	NA
1526540:1526618	attR	CTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTTTCTGATGAGCCTGCACGAATTGC	NA	NA	NA	NA
AUL36012.1|1528531_1529317_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
AUL37917.1|1529779_1530598_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.2e-54
AUL37918.1|1530656_1531667_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL36013.1|1531663_1532434_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL36014.1|1532587_1532848_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL36015.1|1532926_1533187_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36016.1|1533382_1534171_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.5	1.4e-44
AUL36017.1|1534203_1534470_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL36018.1|1534509_1534830_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36019.1|1534995_1535277_-|integrase	integrase	integrase	NA	NA	NA	NA
AUL36020.1|1535578_1536769_+	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
AUL36021.1|1536793_1537615_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AUL36022.1|1537614_1538748_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AUL36023.1|1538754_1539645_+	ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUL36024.1|1539659_1541567_+	ABC transporter	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
AUL36025.1|1541830_1544212_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL36026.1|1544222_1546505_-	DNA helicase II	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
AUL36027.1|1546501_1547710_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
AUL36028.1|1548010_1548832_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL36029.1|1548870_1549131_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL36030.1|1549467_1549743_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36031.1|1549747_1551223_-	rRNA methyltransferase	NA	NA	NA	NA	NA
AUL37919.1|1551979_1552945_+	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
AUL36032.1|1552934_1555796_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
AUL36033.1|1555798_1556314_+	signal peptidase II	NA	NA	NA	NA	NA
AUL36034.1|1556374_1557586_+	phosphopantothenate synthase	NA	Q9HH70	Methanothermobacter_phage	30.4	2.2e-36
AUL36035.1|1558461_1558722_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL36036.1|1558765_1559506_-	permease	NA	NA	NA	NA	NA
AUL36037.1|1559598_1560069_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL36038.1|1560087_1560792_-	dipeptidase E	NA	NA	NA	NA	NA
AUL36039.1|1560804_1561347_-	hydrolase	NA	NA	NA	NA	NA
AUL36040.1|1561368_1561836_-	hydrolase	NA	NA	NA	NA	NA
AUL36041.1|1561945_1562578_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36042.1|1562598_1563057_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36043.1|1563098_1563548_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	Q2NP83	Xanthomonas_phage	62.8	2.3e-47
AUL36044.1|1564420_1565092_-	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
AUL36045.1|1565088_1565730_-	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
AUL36046.1|1565740_1566628_-	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
AUL36047.1|1566796_1567960_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL36048.1|1568028_1569006_-	ornithine cyclodeaminase	NA	NA	NA	NA	NA
AUL36049.1|1569125_1569548_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AUL36050.1|1569594_1569804_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36051.1|1569851_1571627_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AUL37920.1|1571655_1571925_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AUL37921.1|1571987_1572386_-	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
AUL36052.1|1572399_1573356_-	glutathione synthase	NA	NA	NA	NA	NA
AUL36053.1|1573521_1574070_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.3	3.8e-12
AUL36054.1|1574090_1576043_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
AUL36055.1|1576543_1577284_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL36056.1|1577284_1578655_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AUL36057.1|1578768_1579017_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36058.1|1579206_1579443_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36059.1|1579884_1580046_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36060.1|1580145_1580835_-	permease	NA	NA	NA	NA	NA
AUL36061.1|1581233_1581494_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL36062.1|1582258_1582549_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL36063.1|1582545_1583421_+|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL36064.1|1584060_1584720_-	N-(5'-phosphoribosyl)anthranilate isomerase	NA	NA	NA	NA	NA
AUL37922.1|1584771_1585809_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL36065.1|1585856_1586672_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AUL36066.1|1586678_1588304_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36067.1|1588490_1589621_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL36068.1|1589767_1590844_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AUL36069.1|1590874_1592095_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
1592118:1592880	attR	AAATCAAGGATCAAGCGTAACGGCAATCAAGCACGGCTCCACGCTATTCCGCGATGAACCAAAAAAATGCCGGGCATCCACCGAGATGCCCGGTTTGCGTAGTTCAGGCGGATTGAAGGTCAGGCGACAGGCCGACTCTCCAGCCAGGGGTGACGTGCCAGGCGCTCGGCCTCAAACGCACGGATCTTGTCCGACTGGCGCAGCGTCAGACCAATATCGTCGAAGCCATTGAGCAGGCAGTATTTGCGGAAGGCATCGATCTCAAAAGCCATTTCACGGCCGTCGGCGCCGATGACGACCTGACGCTCCAGATCGATCTTCAACTTGTAGCCGGGAAACGCCCTGACCTCATCAAAAAGACGAGCGACTTCCAGCTCGGTGAGAACGATTGGCAACAACCCGTTCTTGAAGCTGTTGTTGAAGAAAATATCCGCATAGGACGGCGCAATGATGGCGCGAAAACCAAATTGCTGCAGAGCCCAAGGCGCATGCTCACGGCTGGAGCCGCAGCCGAAATTCTTGCGGCCCAGCAATACCGATGCCCCCTGATAACGCGGCTGGTTCAGCACGAAGTCCGGATTGAGAGGACGCTTGCTATTGTCCATGCCCGGTTCGCCGTGATCCAGATAACGCAATTCGTCAAACAGGTTGGGCCCGAACCCTGTCCGTTTGATGGACTTCAGAAACTGCTTAGGAATGATGAGGTCGGTATCAACGTTTTCGCGATCCAGAGGCGCGACCAAACCTTCGTGAAAAGTAAATG	NA	NA	NA	NA
>prophage 10
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	1607714	1663272	3695370	tRNA,transposase	Leptospira_phage(22.22%)	60	NA	NA
AUL36083.1|1607714_1608722_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AUL36084.1|1608878_1609847_+	homoserine kinase	NA	NA	NA	NA	NA
AUL36085.1|1610531_1610969_-	hypothetical protein	NA	NA	NA	NA	NA
AUL37924.1|1610965_1611760_-	pilus assembly protein	NA	NA	NA	NA	NA
AUL36086.1|1611936_1612692_-	pilus assembly protein	NA	NA	NA	NA	NA
AUL36087.1|1612688_1613393_-	pilus assembly protein	NA	NA	NA	NA	NA
AUL36088.1|1613343_1614165_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL36089.1|1614203_1614464_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL36090.1|1614507_1615131_-	pilus assembly protein	NA	NA	NA	NA	NA
AUL36091.1|1615127_1616489_-	secretion protein	NA	NA	NA	NA	NA
AUL36092.1|1616488_1617244_-	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
AUL36093.1|1617308_1617713_-	pilus assembly protein	NA	NA	NA	NA	NA
AUL36094.1|1617937_1618477_-	pilus assembly protein	NA	NA	NA	NA	NA
AUL36095.1|1618698_1619907_-	pilus assembly protein	NA	NA	NA	NA	NA
AUL36096.1|1619956_1620907_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL36097.1|1621129_1621390_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36098.1|1621651_1622059_+	heat-shock protein Hsp20	NA	NA	NA	NA	NA
AUL36099.1|1622055_1624395_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
AUL36100.1|1624400_1625525_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL36101.1|1625572_1625704_-	entericidin	NA	NA	NA	NA	NA
AUL37925.1|1625718_1626414_-	5-carboxymethyl-2-hydroxymuconate isomerase	NA	NA	NA	NA	NA
AUL36102.1|1626657_1627191_-	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
AUL36103.1|1627226_1628774_-	protoheme IX synthesis protein	NA	NA	NA	NA	NA
AUL36104.1|1628778_1630002_-	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
AUL36105.1|1629988_1630768_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AUL36106.1|1630798_1631737_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AUL36107.1|1631855_1632578_-	hypothetical protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
AUL36108.1|1632719_1633418_-	hypothetical protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
AUL36109.1|1633714_1634596_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
AUL36110.1|1634617_1635778_-	succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
AUL37926.1|1635788_1636394_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36111.1|1636652_1637873_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL36112.1|1637928_1640226_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AUL36113.1|1640365_1641286_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL36114.1|1641292_1641844_-	recombination regulator RecX	NA	NA	NA	NA	NA
AUL36115.1|1641889_1642951_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
AUL36116.1|1643291_1643987_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL36117.1|1643958_1645482_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
AUL36118.1|1645666_1647343_+	MFS transporter	NA	NA	NA	NA	NA
AUL36119.1|1647816_1648035_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36120.1|1648186_1649086_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
AUL37927.1|1649202_1650495_-	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
AUL36121.1|1650585_1650960_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36122.1|1650969_1651467_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36123.1|1651496_1651628_-	entericidin	NA	NA	NA	NA	NA
AUL36124.1|1651886_1652222_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36125.1|1652446_1652716_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36126.1|1652843_1654343_+	2-aminoadipate aminotransferase	NA	NA	NA	NA	NA
AUL36127.1|1654449_1654695_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36128.1|1654755_1655127_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36129.1|1655131_1655821_-	hypothetical protein	NA	A0A1B0VBP7	Salmonella_phage	47.1	1.3e-49
AUL36130.1|1655875_1656697_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AUL36131.1|1656735_1656996_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL36132.1|1657163_1657952_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.5	1.4e-44
AUL37928.1|1657984_1658245_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL37929.1|1658303_1659314_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL36133.1|1659310_1660081_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL36134.1|1660212_1660917_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	36.5	1.9e-27
AUL36135.1|1661158_1661668_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36136.1|1662495_1663272_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
>prophage 11
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	1915653	1982808	3695370	tRNA,transposase	Ralstonia_virus(25.0%)	58	NA	NA
AUL36352.1|1915653_1915914_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL36353.1|1915971_1916220_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36354.1|1916410_1916755_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
AUL36355.1|1916754_1917369_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AUL36356.1|1917375_1919352_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AUL36357.1|1919355_1920264_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AUL36358.1|1920529_1921087_-	two-component system response regulator	NA	NA	NA	NA	NA
AUL36359.1|1921083_1922118_-	histidine kinase	NA	NA	NA	NA	NA
AUL36360.1|1922321_1922915_+	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
AUL36361.1|1923049_1923265_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36362.1|1923496_1924048_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
AUL36363.1|1924187_1924949_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL36364.1|1924945_1925401_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36365.1|1925484_1926378_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36366.1|1927482_1928853_+	gluconate transporter	NA	NA	NA	NA	NA
AUL36367.1|1928953_1929388_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL36368.1|1929384_1931070_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	1.3e-13
AUL37947.1|1931066_1932476_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUL36369.1|1932526_1933504_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUL36370.1|1933500_1935747_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL36371.1|1935842_1936472_-	nuclease	NA	NA	NA	NA	NA
AUL36372.1|1936496_1937549_-	magnesium transporter	NA	NA	NA	NA	NA
AUL36373.1|1937555_1939649_-	ATP-dependent DNA helicase	NA	A7KV33	Bacillus_phage	29.2	1.2e-61
AUL36374.1|1939694_1940585_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36375.1|1942290_1943556_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
AUL36376.1|1943626_1945090_+	succinate-semialdehyde dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AUL36377.1|1945265_1946141_+	inositol monophosphatase	NA	NA	NA	NA	NA
AUL36378.1|1946124_1946958_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
AUL36379.1|1946990_1947941_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL36380.1|1948039_1948984_-	serine acetyltransferase	NA	NA	NA	NA	NA
AUL36381.1|1949363_1950032_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL36382.1|1950057_1952388_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL36383.1|1952398_1953691_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUL36384.1|1953687_1955646_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUL36385.1|1955667_1956960_+	fatty acid transporter	NA	NA	NA	NA	NA
AUL36386.1|1957019_1959404_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL36387.1|1959413_1960607_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUL36388.1|1960607_1961222_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
AUL36389.1|1961218_1961728_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36390.1|1961735_1963400_+	long-chain-fatty-acid--CoA ligase	NA	Q75ZG1	Hepacivirus	27.3	2.0e-40
AUL36391.1|1963407_1964628_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL36392.1|1964717_1965245_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL36393.1|1965241_1966075_+	class III aminotransferase	NA	NA	NA	NA	NA
AUL36394.1|1966082_1967330_-	D-amino acid dehydrogenase small subunit	NA	NA	NA	NA	NA
AUL36395.1|1967452_1967890_-	BadM/Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AUL36396.1|1967911_1969138_-	nitric oxide dioxygenase	NA	NA	NA	NA	NA
AUL36397.1|1969276_1969738_+|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	43.4	2.0e-17
AUL36398.1|1970472_1971693_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL36399.1|1972320_1972749_+	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
AUL36400.1|1972777_1973224_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36401.1|1973356_1975273_+	S9 family peptidase	NA	NA	NA	NA	NA
AUL36402.1|1975444_1977967_+	penicillin-binding protein	NA	NA	NA	NA	NA
AUL36403.1|1977961_1978615_-	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	47.7	6.3e-54
AUL36404.1|1978792_1979968_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36405.1|1979964_1980171_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36406.1|1980217_1981204_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUL36407.1|1981687_1982509_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL36408.1|1982547_1982808_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	1991402	2043035	3695370	holin,protease,tRNA,transposase	Lake_Baikal_phage(13.33%)	45	NA	NA
AUL36424.1|1991402_1993364_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	29.9	2.3e-27
AUL36425.1|1993398_1994145_-	endonuclease	NA	H6X497	Enterobacteria_phage	31.2	7.3e-22
AUL36426.1|1994540_1994750_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	57.1	8.6e-13
AUL36427.1|1996068_1996266_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36428.1|1996262_1996598_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36429.1|1996630_1997635_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL36430.1|1997665_1998655_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUL36431.1|1998682_1999426_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL36432.1|1999712_1999967_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36433.1|2000348_2001077_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36434.1|2001107_2001674_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36435.1|2001896_2002295_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL37948.1|2002352_2002694_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	43.3	1.3e-13
AUL36436.1|2002711_2005129_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUL36437.1|2005141_2006164_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
AUL36438.1|2006236_2006596_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AUL36439.1|2006611_2006809_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AUL36440.1|2007229_2008729_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AUL36441.1|2008850_2009114_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36442.1|2009173_2010394_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL36443.1|2010487_2011708_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL36444.1|2011773_2011956_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36445.1|2012274_2013225_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL36446.1|2013472_2013811_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL36447.1|2013858_2015097_+	ammonia channel protein	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
AUL36448.1|2015087_2015270_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36449.1|2015473_2016205_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
AUL36450.1|2016201_2017008_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
AUL36451.1|2017004_2018081_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL36452.1|2018077_2019007_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL36453.1|2019125_2020271_-	branched chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL36454.1|2020496_2024303_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL36455.1|2024435_2025101_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36456.1|2025103_2026771_-	paraquat-inducible protein B	NA	NA	NA	NA	NA
AUL36457.1|2028124_2030434_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
AUL36458.1|2030487_2032593_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
AUL36459.1|2032640_2037203_-	alpha-2-macroglobulin	NA	NA	NA	NA	NA
AUL36460.1|2037470_2037755_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36461.1|2037846_2038161_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
AUL36462.1|2038385_2038631_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
AUL36463.1|2038763_2039213_+	hypothetical protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
AUL36464.1|2039276_2040482_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AUL37949.1|2040585_2041887_-	chloride channel protein-related protein	NA	NA	NA	NA	NA
AUL36465.1|2041914_2042175_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL36466.1|2042213_2043035_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
>prophage 13
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	2055194	2103726	3695370	transposase	Ralstonia_virus(13.33%)	45	NA	NA
AUL36480.1|2055194_2056394_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
AUL36481.1|2056451_2056712_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL36482.1|2057605_2058085_+	transmembrane sensor protein	NA	NA	NA	NA	NA
AUL36483.1|2058166_2059117_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL36484.1|2059170_2059317_+	transmembrane sensor protein	NA	NA	NA	NA	NA
AUL36485.1|2059518_2059782_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUL36486.1|2059907_2060678_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
AUL36487.1|2060720_2061716_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL36488.1|2063547_2063829_-	malate dehydrogenase	NA	NA	NA	NA	NA
AUL36489.1|2063904_2065125_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL36490.1|2066040_2066775_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL36491.1|2066807_2067593_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AUL37950.1|2067969_2068257_+	hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
AUL36492.1|2068253_2068922_+	reductase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
AUL36493.1|2068968_2069259_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36494.1|2069417_2070599_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
AUL36495.1|2070654_2071596_+	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
AUL36496.1|2071705_2073043_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
AUL36497.1|2073146_2073968_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL36498.1|2074006_2074267_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL36499.1|2074290_2075076_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36500.1|2075376_2076564_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36501.1|2076700_2078581_-	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	3.5e-65
AUL36502.1|2078564_2079632_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
AUL36503.1|2079741_2080413_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL36504.1|2080529_2081039_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUL36505.1|2081038_2081956_-	flagellar motor protein MotA	NA	NA	NA	NA	NA
AUL36506.1|2081977_2082706_-	energy transducer TonB	NA	NA	NA	NA	NA
AUL36507.1|2083289_2083562_-	DNA-binding protein HU	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
AUL36508.1|2083884_2085129_-	hypothetical protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
AUL36509.1|2085175_2085913_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AUL36510.1|2086020_2088441_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
AUL37951.1|2088848_2089469_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AUL36511.1|2089849_2090308_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL36512.1|2090417_2091359_+	transporter	NA	NA	NA	NA	NA
AUL36513.1|2091362_2092646_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
AUL36514.1|2092763_2093984_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36515.1|2094132_2095791_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
AUL37952.1|2097151_2097451_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36516.1|2097530_2098481_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL36517.1|2099027_2100041_+	dimethylhistidine N-methyltransferase	NA	NA	NA	NA	NA
AUL37953.1|2100053_2101370_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36518.1|2101957_2102512_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
AUL36519.1|2102605_2102866_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL36520.1|2102904_2103726_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
>prophage 14
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	2109140	2160945	3695370	tRNA,transposase	Leptospira_phage(14.29%)	56	NA	NA
AUL36526.1|2109140_2109962_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL36527.1|2110000_2110261_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL37954.1|2110288_2110960_+	cytochrome B	NA	NA	NA	NA	NA
AUL36528.1|2111026_2111470_-	cytochrome C	NA	NA	NA	NA	NA
AUL37955.1|2111531_2112908_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
AUL36529.1|2113045_2113654_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUL36530.1|2113729_2114551_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36531.1|2114632_2115745_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUL36532.1|2115753_2116674_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
AUL36533.1|2116820_2117801_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL36534.1|2117861_2118728_+	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
AUL36535.1|2118827_2120048_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
AUL36536.1|2120230_2121349_+	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AUL36537.1|2121350_2121665_+	NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AUL36538.1|2121661_2123107_+	NAD synthetase	NA	NA	NA	NA	NA
AUL36539.1|2123103_2124354_-	glycolate oxidase iron-sulfur subunit	NA	NA	NA	NA	NA
AUL36540.1|2124358_2125462_-	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
AUL37956.1|2125475_2126921_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AUL36541.1|2126948_2127209_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL36542.1|2127247_2128069_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL36543.1|2128112_2128865_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36544.1|2129156_2129579_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36545.1|2129848_2130628_-	3'-5' exonuclease	NA	NA	NA	NA	NA
AUL36546.1|2130624_2131488_-	peptidase	NA	A0A292GJG6	Xanthomonas_phage	40.5	8.5e-14
AUL36547.1|2131505_2132303_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.5	9.8e-33
AUL36548.1|2132287_2133046_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.3	1.9e-70
AUL36549.1|2133210_2133849_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUL36550.1|2133845_2134424_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36551.1|2134435_2134969_-	carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUL36552.1|2134973_2135933_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL36553.1|2135963_2136746_-	amidohydrolase	NA	NA	NA	NA	NA
AUL36554.1|2136855_2137848_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL36555.1|2137849_2138887_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.7	5.6e-97
AUL36556.1|2138971_2140264_+	guanine permease	NA	A0A0R6PHV4	Moraxella_phage	36.7	2.9e-66
AUL36557.1|2140446_2141463_+	luciferase	NA	NA	NA	NA	NA
AUL36558.1|2141571_2141955_+	thioredoxin	NA	V9SJ74	Achromobacter_phage	26.8	1.2e-09
AUL37957.1|2141958_2142315_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36559.1|2142335_2142566_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36560.1|2142589_2143387_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL36561.1|2143391_2144159_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL36562.1|2144155_2145151_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL36563.1|2145200_2145965_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	6.3e-29
AUL36564.1|2146137_2147742_-	ABC-F family ATPase	NA	A0A1V0SKJ1	Klosneuvirus	28.9	7.7e-53
AUL36565.1|2147995_2148976_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AUL36566.1|2148972_2149461_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
AUL36567.1|2149453_2150302_-	hydrolase	NA	NA	NA	NA	NA
AUL36568.1|2150393_2150891_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36569.1|2151028_2151388_-	cation:proton antiporter	NA	NA	NA	NA	NA
AUL36570.1|2151384_2151666_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
AUL36571.1|2151665_2152148_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
AUL36572.1|2152149_2153778_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
AUL36573.1|2153774_2154119_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
AUL36574.1|2154120_2157063_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
AUL36575.1|2157508_2158480_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL37958.1|2158469_2159852_-	GTP-binding protein	NA	NA	NA	NA	NA
AUL36576.1|2159994_2160945_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 15
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	2167338	2216903	3695370	tRNA,transposase,protease	Ralstonia_virus(25.0%)	54	NA	NA
AUL36582.1|2167338_2168343_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
AUL36583.1|2168339_2169587_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUL36584.1|2169939_2170806_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
AUL36585.1|2170765_2172370_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL36586.1|2172381_2173068_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
AUL36587.1|2173064_2174105_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL36588.1|2174220_2174892_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL37959.1|2174912_2175881_+	secretion protein HlyD	NA	NA	NA	NA	NA
AUL36589.1|2175877_2176816_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
AUL36590.1|2176812_2177967_+	mannose-1-phosphate guanyltransferase	NA	NA	NA	NA	NA
AUL36591.1|2177975_2179427_+	ABC transporter permease	NA	NA	NA	NA	NA
AUL36592.1|2179457_2179940_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36593.1|2179941_2180835_+	hypothetical protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
AUL36594.1|2180831_2181275_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36595.1|2181287_2181665_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36596.1|2181804_2182203_+|protease	membrane-associated protease	protease	NA	NA	NA	NA
AUL36597.1|2182329_2182617_+|protease	CAAX protease family protein	protease	NA	NA	NA	NA
AUL36598.1|2182613_2183030_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUL36599.1|2183205_2183838_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
AUL36600.1|2183866_2184313_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
AUL36601.1|2184599_2185751_+	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUL36602.1|2185864_2186869_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
AUL36603.1|2186814_2187624_-	chemotaxis protein	NA	NA	NA	NA	NA
AUL36604.1|2187852_2188560_+	cell division protein	NA	NA	NA	NA	NA
AUL36605.1|2188492_2189944_+	DNA polymerase	NA	NA	NA	NA	NA
AUL36606.1|2189949_2193108_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
AUL36607.1|2193120_2193642_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
AUL36608.1|2193631_2194456_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AUL36609.1|2194452_2195052_-	ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
AUL36610.1|2195160_2197017_-	phosphoenolpyruvate carboxykinase	NA	NA	NA	NA	NA
AUL36611.1|2197165_2198170_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
AUL36612.1|2198378_2199641_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
AUL36613.1|2199645_2199981_+	thioredoxin	NA	NA	NA	NA	NA
AUL36614.1|2199977_2200907_+	EamA family transporter	NA	NA	NA	NA	NA
AUL36615.1|2200911_2201625_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL36616.1|2201728_2203186_+	DNA-binding protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
AUL36617.1|2203182_2203479_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36618.1|2203603_2204962_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
AUL36619.1|2205062_2205863_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36620.1|2206042_2207161_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
AUL36621.1|2207233_2207605_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36622.1|2207611_2208463_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
AUL36623.1|2208483_2209095_-	peptidase S16	NA	NA	NA	NA	NA
AUL36624.1|2209388_2210399_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL36625.1|2210490_2210850_+	RNA signal recognition particle	NA	NA	NA	NA	NA
AUL36626.1|2210846_2211317_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL36627.1|2211449_2212610_+	MFS transporter	NA	NA	NA	NA	NA
AUL36628.1|2212718_2213342_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36629.1|2213349_2214273_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36630.1|2214391_2215264_-	phosphonopyruvate hydrolase	NA	NA	NA	NA	NA
AUL36631.1|2215443_2215623_+	DUF3008 domain-containing protein	NA	NA	NA	NA	NA
AUL36632.1|2215655_2216207_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUL36633.1|2216221_2216599_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL36634.1|2216642_2216903_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 16
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	2280422	2338834	3695370	tRNA,transposase	Shigella_phage(22.22%)	50	NA	NA
AUL36689.1|2280422_2280683_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL36690.1|2280893_2282192_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUL36691.1|2282234_2283263_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUL36692.1|2283377_2283944_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
AUL36693.1|2284002_2284848_-	phosphatase	NA	NA	NA	NA	NA
AUL37965.1|2284905_2285781_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUL36694.1|2286032_2286647_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36695.1|2286656_2287877_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL36696.1|2287925_2288591_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36697.1|2288638_2289634_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36698.1|2292811_2293726_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL36699.1|2293875_2294841_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL36700.1|2294848_2295265_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUL36701.1|2295261_2296179_+	oxidoreductase	NA	NA	NA	NA	NA
AUL36702.1|2296190_2296610_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36703.1|2296518_2297907_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL37966.1|2297903_2298155_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36704.1|2298325_2299282_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL36705.1|2299264_2299477_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36706.1|2299526_2300300_+	MBL fold hydrolase	NA	NA	NA	NA	NA
AUL36707.1|2300296_2301430_+	malate dehydrogenase	NA	NA	NA	NA	NA
AUL36708.1|2301439_2302390_+	D-3-phosphoglycerate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	28.4	4.8e-18
AUL36709.1|2302421_2303222_+	aldolase	NA	NA	NA	NA	NA
AUL36710.1|2303236_2304391_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36711.1|2304218_2305094_-|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL36712.1|2305090_2305381_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL36713.1|2305493_2306462_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36714.1|2306458_2307379_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36715.1|2307475_2311954_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36716.1|2312332_2316667_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36717.1|2317305_2317869_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36718.1|2317880_2318126_-	RNA-binding protein	NA	NA	NA	NA	NA
AUL36719.1|2318281_2318791_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL36720.1|2318836_2319817_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL36721.1|2320028_2322380_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL37967.1|2322426_2323233_-	DNAase	NA	NA	NA	NA	NA
AUL36722.1|2323253_2323943_-	lipoprotein ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
AUL36723.1|2323935_2325216_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL36724.1|2325313_2326252_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36725.1|2326233_2327940_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
AUL36726.1|2329173_2329923_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL36727.1|2329929_2331444_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
AUL36728.1|2331456_2331744_+	hypothetical protein	NA	NA	NA	NA	NA
AUL37968.1|2331764_2332652_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AUL37969.1|2332802_2333309_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL36729.1|2333305_2334262_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL36730.1|2334449_2335796_+	protein FpvAIII	NA	NA	NA	NA	NA
AUL36731.1|2336741_2337512_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
AUL37970.1|2337508_2338519_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL36732.1|2338588_2338834_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	2354744	2389924	3695370	transposase,protease	Leptospira_phage(20.0%)	34	NA	NA
AUL36750.1|2354744_2355788_+	alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
AUL37971.1|2355784_2355886_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36751.1|2355977_2356238_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL36752.1|2356276_2357098_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL36753.1|2357347_2358001_+	repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
AUL36754.1|2358116_2359337_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
AUL36755.1|2359387_2361817_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
AUL36756.1|2361982_2363281_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
AUL36757.1|2363385_2364039_-	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
AUL36758.1|2364041_2365352_-	trigger factor	NA	NA	NA	NA	NA
AUL36759.1|2365579_2366119_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
AUL36760.1|2366603_2366864_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL37972.1|2367149_2368160_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL36761.1|2368156_2368927_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL36762.1|2369006_2369672_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	46.1	2.1e-49
AUL36763.1|2369639_2370131_-	SpoVR like family protein	NA	NA	NA	NA	NA
AUL36764.1|2370240_2370444_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
AUL36765.1|2370761_2371082_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36766.1|2371065_2371401_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36767.1|2371455_2371668_-	autotransporter	NA	NA	NA	NA	NA
AUL36768.1|2371743_2372082_+|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	50.0	3.7e-05
AUL37973.1|2372078_2372414_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL36769.1|2372476_2374048_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
AUL36770.1|2374841_2375153_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36771.1|2375345_2376167_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL36772.1|2376205_2376466_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL36773.1|2376593_2376788_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36774.1|2382870_2383161_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL36775.1|2383157_2384033_+|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL36776.1|2384417_2385881_+	ribonuclease E/G	NA	NA	NA	NA	NA
AUL36777.1|2386013_2387564_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
AUL36778.1|2387875_2388697_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL36779.1|2388735_2388996_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL36780.1|2389072_2389924_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	77.7	2.8e-126
>prophage 18
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	2470722	2514589	3695370	tRNA,protease,transposase	Shigella_phage(40.0%)	35	NA	NA
AUL36849.1|2470722_2471370_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AUL36850.1|2471454_2472081_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AUL37977.1|2472145_2472991_+	hypothetical protein	NA	A0A1I9SA48	Rhodococcus_phage	35.1	2.4e-37
AUL36851.1|2473320_2473872_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36852.1|2474635_2474929_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36853.1|2475143_2475473_-	alkylhydroperoxidase	NA	NA	NA	NA	NA
AUL36854.1|2476056_2477517_+	cardiolipin synthase	NA	NA	NA	NA	NA
AUL36855.1|2477475_2477700_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36856.1|2478076_2479396_-	MFS transporter	NA	NA	NA	NA	NA
AUL36857.1|2479438_2479912_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36858.1|2479908_2480919_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36859.1|2480983_2481949_-	pyridoxal-5'-phosphate-dependent protein	NA	NA	NA	NA	NA
AUL36860.1|2482073_2482334_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL36861.1|2483177_2484053_-|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL36862.1|2484049_2484340_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL36863.1|2484609_2485527_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL36864.1|2486882_2488169_+	phospholipase	NA	NA	NA	NA	NA
AUL36865.1|2488262_2488862_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36866.1|2489086_2489608_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36867.1|2489873_2490428_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36868.1|2490447_2491809_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36869.1|2492161_2494741_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AUL36870.1|2494787_2495894_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AUL36871.1|2496040_2496550_+	dehydratase	NA	NA	NA	NA	NA
AUL36872.1|2496573_2497554_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUL37978.1|2497559_2498975_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AUL36873.1|2498971_2500144_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL36874.1|2500140_2501361_+	CoA transferase	NA	NA	NA	NA	NA
AUL36875.1|2501357_2502155_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL36876.1|2503003_2507683_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	28.4	1.1e-27
AUL36877.1|2510831_2511794_-	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL36878.1|2511790_2512309_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL36879.1|2512462_2512783_+	amidohydrolase	NA	NA	NA	NA	NA
AUL36880.1|2513468_2513729_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL36881.1|2513767_2514589_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.4	2.9e-56
>prophage 19
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	2531679	2599198	3695370	tRNA,transposase	Ralstonia_virus(12.5%)	59	NA	NA
AUL36898.1|2531679_2532900_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL36899.1|2532955_2533294_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL36900.1|2533329_2534964_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.4	6.0e-85
AUL36901.1|2535000_2536320_-	mechanosensitive ion channel protein MscS	NA	NA	NA	NA	NA
AUL36902.1|2536430_2537843_+	argininosuccinate lyase	NA	NA	NA	NA	NA
AUL36903.1|2537897_2538518_-	nitroreductase	NA	NA	NA	NA	NA
AUL36904.1|2538675_2539110_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUL36905.1|2539211_2541485_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	42.7	1.7e-125
AUL36906.1|2541640_2542414_+	peptidase	NA	NA	NA	NA	NA
AUL36907.1|2542426_2543332_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUL36908.1|2543328_2544201_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36909.1|2544215_2544965_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.1	6.2e-29
AUL36910.1|2544972_2545818_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL36911.1|2545836_2546814_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL37979.1|2546884_2547676_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUL36912.1|2547689_2548886_-	formyl-CoA transferase	NA	NA	NA	NA	NA
AUL36913.1|2548894_2550187_-	amidase	NA	NA	NA	NA	NA
AUL36914.1|2550406_2551069_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL36915.1|2551469_2551652_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AUL36916.1|2551670_2552546_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AUL36917.1|2553410_2553671_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL36918.1|2554680_2555196_+	hypothetical protein	NA	T1SAR8	Salmonella_phage	44.6	3.9e-06
AUL36919.1|2555468_2555687_+	virulence protein	NA	NA	NA	NA	NA
AUL36920.1|2555874_2556111_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36921.1|2556401_2557757_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.5	2.1e-83
AUL37980.1|2557803_2559144_-	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	38.9	5.4e-76
AUL36922.1|2559245_2559878_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUL36923.1|2559877_2562247_-	cell division protein FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	2.2e-80
AUL36924.1|2562279_2563239_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	40.2	2.4e-57
AUL36925.1|2563225_2563918_+	DNA mismatch repair protein MutS	NA	NA	NA	NA	NA
AUL36926.1|2563914_2564247_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AUL36927.1|2564362_2565313_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL36928.1|2565309_2567376_-	cation acetate symporter	NA	NA	NA	NA	NA
AUL36929.1|2567375_2567648_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36930.1|2568342_2568432_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUL36931.1|2568431_2570216_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AUL36932.1|2570239_2572405_+	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.9	7.8e-24
AUL36933.1|2572415_2573015_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AUL36934.1|2575778_2576474_+	two-component system response regulator KdpE	NA	NA	NA	NA	NA
AUL36935.1|2576482_2577724_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36936.1|2577873_2578854_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36937.1|2579052_2580309_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	1.2e-11
AUL36938.1|2580511_2580937_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36939.1|2580987_2581350_-	cytochrome	NA	NA	NA	NA	NA
AUL37981.1|2581878_2582766_+	ATP-binding protein	NA	NA	NA	NA	NA
AUL36940.1|2583962_2584205_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUL36941.1|2584201_2584576_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36942.1|2584908_2587659_+	peptidase M16	NA	A0A2K9LA15	Tupanvirus	28.1	1.5e-19
AUL36943.1|2587827_2588973_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	60.8	4.0e-19
AUL36944.1|2589073_2590999_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.7	2.7e-145
AUL36945.1|2591087_2591462_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUL36946.1|2591483_2592014_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUL36947.1|2592127_2592361_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36948.1|2592447_2593539_-	ferrochelatase	NA	NA	NA	NA	NA
AUL36949.1|2594685_2595585_+	NAD kinase	NA	NA	NA	NA	NA
AUL36950.1|2595606_2597262_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AUL37982.1|2597366_2598110_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	73.7	2.1e-101
AUL36951.1|2598077_2598899_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	4.2e-55
AUL36952.1|2598937_2599198_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	2603294	2654032	3695370	tRNA,transposase	Leptospira_phage(37.5%)	53	NA	NA
AUL37984.1|2603294_2603840_-|transposase	transposase	transposase	U5P429	Shigella_phage	66.3	2.2e-68
AUL36956.1|2603882_2604143_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL36957.1|2604235_2604736_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	49.7	2.8e-41
AUL36958.1|2605252_2605906_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
AUL37985.1|2606087_2606795_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL36959.1|2606791_2609407_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
AUL36960.1|2609463_2610648_+	putative methylaconitate Delta-isomerase PrpF	NA	NA	NA	NA	NA
AUL36961.1|2610708_2611317_+	lysine transporter LysE	NA	NA	NA	NA	NA
AUL36962.1|2611439_2612465_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUL36963.1|2612528_2613059_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL36964.1|2612938_2613280_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36965.1|2613276_2613984_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL36966.1|2613993_2614887_-	carboxyvinyl-carboxyphosphonate phosphorylmutase	NA	NA	NA	NA	NA
AUL36967.1|2614870_2615629_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL36968.1|2615920_2618596_+	aconitate hydratase 1	NA	NA	NA	NA	NA
AUL36969.1|2618612_2619974_+	dihydroorotase	NA	NA	NA	NA	NA
AUL36970.1|2619993_2620716_+	hydrolase	NA	NA	NA	NA	NA
AUL36971.1|2620720_2621719_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
AUL36972.1|2622139_2622448_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36973.1|2622495_2623068_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36974.1|2623045_2623450_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36975.1|2623568_2624486_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL36976.1|2624495_2625077_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AUL36977.1|2625073_2625826_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUL36978.1|2625868_2626588_+	arginyltransferase	NA	NA	NA	NA	NA
AUL36979.1|2626630_2627686_+	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AUL36980.1|2627795_2628638_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	77.8	4.5e-129
AUL36981.1|2628695_2628956_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL36982.1|2628994_2629816_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL36983.1|2630375_2630954_-	Phasin (PHA-granule associated protein)	NA	NA	NA	NA	NA
AUL36984.1|2631096_2632317_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL36985.1|2632620_2633598_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL36986.1|2633746_2634577_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL36987.1|2634690_2635506_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
AUL36988.1|2635528_2636383_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36989.1|2636381_2636765_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUL36990.1|2636871_2638245_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	1.8e-50
AUL36991.1|2638316_2638808_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36992.1|2638807_2639560_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36993.1|2639907_2640111_+	hypothetical protein	NA	NA	NA	NA	NA
AUL36994.1|2640140_2640563_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AUL36995.1|2640574_2641672_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUL36996.1|2641684_2643202_-	peptidase	NA	NA	NA	NA	NA
AUL36997.1|2643275_2644115_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
AUL36998.1|2644136_2644994_-	hypothetical protein	NA	NA	NA	NA	NA
AUL36999.1|2645066_2646185_-	porin	NA	NA	NA	NA	NA
AUL37000.1|2646815_2647637_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL37001.1|2647675_2647936_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL37002.1|2647979_2648609_-	calcium:sodium antiporter	NA	NA	NA	NA	NA
AUL37003.1|2648766_2650110_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AUL37004.1|2650118_2650502_-	hypothetical protein	NA	NA	NA	NA	NA
AUL37005.1|2650661_2651813_+	monooxygenase	NA	NA	NA	NA	NA
AUL37006.1|2653006_2654032_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
>prophage 21
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	2935185	3034954	3695370	tRNA,transposase	Ralstonia_virus(20.0%)	82	NA	NA
AUL37243.1|2935185_2935965_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AUL37244.1|2935987_2936935_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
AUL37245.1|2936936_2937137_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AUL37246.1|2937471_2937732_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL37247.1|2937770_2938592_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL37248.1|2938912_2939629_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
AUL37249.1|2939625_2940519_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL37250.1|2940682_2941903_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL37251.1|2942055_2943138_+	iron ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
AUL37252.1|2944817_2945801_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL37253.1|2945863_2947276_-	signal recognition particle protein	NA	NA	NA	NA	NA
AUL37254.1|2947393_2948236_+	hypothetical protein	NA	NA	NA	NA	NA
AUL37255.1|2948514_2949123_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
AUL37256.1|2949138_2949759_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUL37257.1|2949824_2950535_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.6e-13
AUL37258.1|2950536_2951259_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
AUL37259.1|2951245_2951536_-	inner-membrane translocator	NA	NA	NA	NA	NA
AUL37260.1|2951611_2952832_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
AUL37993.1|2953556_2954408_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL37261.1|2954459_2955713_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL37262.1|2955889_2956678_-	hypothetical protein	NA	NA	NA	NA	NA
AUL37263.1|2956797_2957712_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL37264.1|2957844_2959737_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
AUL37265.1|2959922_2961302_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
AUL37266.1|2961746_2962043_+	site-specific recombinase	NA	NA	NA	NA	NA
AUL37267.1|2962086_2962347_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL37268.1|2962439_2962940_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL37269.1|2962953_2963178_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL37270.1|2965843_2966446_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AUL37271.1|2966579_2967038_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AUL37272.1|2967039_2967639_-	iron transport sensor protein	NA	NA	NA	NA	NA
AUL37273.1|2967647_2968457_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL37274.1|2968491_2969346_+	permease	NA	NA	NA	NA	NA
AUL37275.1|2969465_2970053_+	histidine utilization protein HutD	NA	NA	NA	NA	NA
AUL37276.1|2970049_2971429_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
AUL37277.1|2979750_2981091_+	8-amino-7-oxononanoate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
AUL37278.1|2981104_2981956_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
AUL37279.1|2981967_2983233_-	capsule biosynthesis protein CapA	NA	NA	NA	NA	NA
AUL37280.1|2983294_2985376_-	beta-3-deoxy-D-manno-oct-2-ulosonic acid transferase	NA	NA	NA	NA	NA
AUL37281.1|2986324_2986585_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL37282.1|2986677_2987178_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL37283.1|2987174_2988029_-	sulfatase	NA	NA	NA	NA	NA
AUL37284.1|2988021_2988816_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL37285.1|2989031_2989982_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL37286.1|2990584_2991382_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL37287.1|2991421_2992075_-	DL-methionine transporter permease subunit	NA	NA	NA	NA	NA
AUL37288.1|2992055_2993120_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
AUL37289.1|2993283_2995509_-	glycosyl hydrolase	NA	NA	NA	NA	NA
AUL37290.1|2995754_2997599_-	FAD-dependent cmnm(5)s(2)U34 oxidoreductase	NA	NA	NA	NA	NA
AUL37291.1|2997715_2998588_+	inositol monophosphatase	NA	NA	NA	NA	NA
AUL37292.1|2998634_3000335_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
AUL37293.1|3000397_3001597_+	amidohydrolase	NA	NA	NA	NA	NA
AUL37294.1|3001607_3002486_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL37295.1|3002592_3003630_+	hypothetical protein	NA	NA	NA	NA	NA
AUL37994.1|3003710_3004115_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUL37296.1|3004126_3005584_+	magnesium transporter	NA	NA	NA	NA	NA
AUL37297.1|3006226_3006823_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AUL37298.1|3006983_3007442_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL37299.1|3008219_3009191_-	hypothetical protein	NA	NA	NA	NA	NA
AUL37300.1|3009312_3009732_+	hypothetical protein	NA	NA	NA	NA	NA
AUL37301.1|3010607_3010868_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL37302.1|3011023_3012244_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL37303.1|3012305_3013193_-	HflC protein	NA	NA	NA	NA	NA
AUL37304.1|3013210_3014515_-	HflK protein	NA	NA	NA	NA	NA
AUL37305.1|3014480_3015587_-	GTPase HflX	NA	NA	NA	NA	NA
AUL37306.1|3015674_3015911_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
AUL37307.1|3016094_3017168_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AUL37308.1|3017164_3018520_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AUL37309.1|3018544_3019702_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AUL37310.1|3019707_3020346_-	hypothetical protein	NA	NA	NA	NA	NA
AUL37311.1|3020349_3021645_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AUL37312.1|3021677_3022964_-	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase	NA	NA	NA	NA	NA
AUL37313.1|3022976_3023465_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL37314.1|3023461_3024610_-	23S rRNA (adenine(2503)-C(2))-methyltransferase	NA	NA	NA	NA	NA
AUL37315.1|3024639_3025065_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.9	2.4e-22
AUL37316.1|3025384_3028264_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	1.1e-137
AUL37317.1|3028317_3029538_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL37318.1|3029586_3030450_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AUL37319.1|3030449_3031043_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUL37320.1|3031334_3031595_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUL37321.1|3032094_3032346_-	hypothetical protein	NA	NA	NA	NA	NA
AUL37322.1|3032332_3034954_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.5	2.8e-84
>prophage 22
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	3093811	3149111	3695370	tRNA,transposase,protease	Ralstonia_virus(25.0%)	39	NA	NA
AUL37371.1|3093811_3095032_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL37997.1|3095073_3096330_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL37372.1|3096570_3097716_+	Bcr/CflA family drug resistance efflux transporter	NA	NA	NA	NA	NA
AUL37373.1|3098022_3098259_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AUL37374.1|3098339_3098507_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AUL37375.1|3098663_3099752_+	hypothetical protein	NA	NA	NA	NA	NA
AUL37376.1|3099777_3100998_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL37377.1|3103216_3103648_+	DNA-binding protein	NA	NA	NA	NA	NA
AUL37378.1|3103774_3104287_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUL37998.1|3104319_3105480_+	MFS transporter	NA	NA	NA	NA	NA
AUL37379.1|3105551_3108209_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	38.7	7.5e-170
AUL37380.1|3108220_3108898_+	hypothetical protein	NA	NA	NA	NA	NA
AUL37381.1|3108897_3109947_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AUL37382.1|3109970_3111230_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.2	1.9e-94
AUL37383.1|3111236_3111626_+	hypothetical protein	NA	NA	NA	NA	NA
AUL37384.1|3111777_3112062_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL37385.1|3112058_3112448_+	hypothetical protein	NA	NA	NA	NA	NA
AUL37999.1|3112460_3113624_-	secretion protein	NA	NA	NA	NA	NA
AUL37386.1|3113650_3115411_-|protease	protease/lipase ABC transporter ATP-binding protein	protease	F2Y2R6	Organic_Lake_phycodnavirus	28.5	3.5e-14
AUL37387.1|3115407_3116709_-	hypothetical protein	NA	NA	NA	NA	NA
AUL37388.1|3116946_3117207_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL37389.1|3117245_3118067_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL37390.1|3124467_3125985_-	propionyl-CoA--succinate CoA transferase	NA	NA	NA	NA	NA
AUL37391.1|3127219_3129610_+	mechanosensitive ion channel protein	NA	NA	NA	NA	NA
AUL37392.1|3129611_3130382_-	hypothetical protein	NA	NA	NA	NA	NA
AUL37393.1|3130378_3131257_-	EamA family transporter	NA	NA	NA	NA	NA
AUL37394.1|3131440_3131731_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AUL38000.1|3131746_3132289_-	DNA polymerase III subunit epsilon	NA	A0A0A7RWA3	Clostridium_phage	29.7	7.2e-11
AUL37395.1|3132512_3135104_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
AUL37396.1|3137768_3138371_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38001.1|3138619_3141325_+	aconitate hydratase 1	NA	NA	NA	NA	NA
AUL37397.1|3141390_3142173_-	dioxygenase	NA	NA	NA	NA	NA
AUL37398.1|3142334_3143540_+	hypothetical protein	NA	NA	NA	NA	NA
AUL37399.1|3143546_3144635_+	hypothetical protein	NA	NA	NA	NA	NA
AUL37400.1|3144792_3145350_+	elongation factor P	NA	NA	NA	NA	NA
AUL37401.1|3145431_3145866_-	hypothetical protein	NA	NA	NA	NA	NA
AUL37402.1|3146747_3148130_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUL37403.1|3148139_3148592_-	hypothetical protein	NA	NA	NA	NA	NA
AUL37404.1|3148610_3149111_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
>prophage 23
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	3348282	3415865	3695370	tRNA,transposase	Leptospira_phage(22.22%)	60	NA	NA
AUL37574.1|3348282_3349194_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AUL37575.1|3349195_3351331_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUL37576.1|3351327_3351867_+	D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AUL37577.1|3351870_3352599_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUL37578.1|3352585_3353419_+	hypothetical protein	NA	NA	NA	NA	NA
AUL37579.1|3353423_3354350_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL38011.1|3354428_3355844_+	FAD-binding dehydrogenase	NA	NA	NA	NA	NA
AUL37580.1|3355830_3356913_+	tricarballylate utilization protein B	NA	NA	NA	NA	NA
AUL37581.1|3357026_3357422_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
AUL37582.1|3357427_3357961_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.6	7.5e-13
AUL37583.1|3360351_3361581_+	hypothetical protein	NA	NA	NA	NA	NA
AUL37584.1|3361581_3363024_-	pyruvate kinase	NA	NA	NA	NA	NA
AUL37585.1|3363119_3364262_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.0	3.2e-37
AUL37586.1|3364280_3364760_+	thioesterase	NA	NA	NA	NA	NA
AUL37587.1|3364788_3365577_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase	NA	NA	NA	NA	NA
AUL37588.1|3365590_3367129_-	molecular chaperone SurA	NA	NA	NA	NA	NA
AUL38012.1|3367125_3369534_-	LPS biosynthesis protein	NA	NA	NA	NA	NA
AUL37589.1|3369687_3370755_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AUL37590.1|3370754_3371435_+	mannose-1-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AUL37591.1|3371576_3372302_+	hypothetical protein	NA	NA	NA	NA	NA
AUL37592.1|3372310_3372634_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
AUL37593.1|3372687_3373335_-	hypothetical protein	NA	NA	NA	NA	NA
AUL37594.1|3373470_3373884_+	hypothetical protein	NA	NA	NA	NA	NA
AUL37595.1|3373969_3375019_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AUL37596.1|3375164_3376115_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL37597.1|3376153_3376861_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL37598.1|3376828_3377650_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AUL37599.1|3377688_3377949_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL37600.1|3378006_3379515_-	sulfite reductase	NA	NA	NA	NA	NA
AUL37601.1|3379671_3381195_-	hypothetical protein	NA	NA	NA	NA	NA
AUL37602.1|3381249_3381897_-	carbonate dehydratase	NA	NA	NA	NA	NA
AUL37603.1|3382039_3382381_-	hypothetical protein	NA	NA	NA	NA	NA
AUL37604.1|3382538_3382871_+	PsiF repeat family protein	NA	NA	NA	NA	NA
AUL37605.1|3382919_3383960_-	cyclase	NA	NA	NA	NA	NA
AUL37606.1|3383963_3384743_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AUL37607.1|3384778_3385075_-	hypothetical protein	NA	NA	NA	NA	NA
AUL37608.1|3385089_3385365_-	muconolactone delta-isomerase	NA	NA	NA	NA	NA
AUL37609.1|3385432_3386077_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUL37610.1|3386079_3386169_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUL37611.1|3386359_3387145_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL37612.1|3387182_3387908_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL37613.1|3387921_3389262_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
AUL37614.1|3389356_3390289_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL37615.1|3390517_3393289_-	peptidase S8	NA	NA	NA	NA	NA
AUL37616.1|3393728_3396575_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AUL37617.1|3396721_3397435_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	41.4	1.6e-47
AUL37618.1|3397447_3397990_-	GNAT family N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	45.8	1.1e-27
AUL37619.1|3398095_3399004_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.7	4.4e-05
AUL37620.1|3399095_3400952_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AUL37621.1|3401135_3402176_-	GntR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.2	4.3e-20
AUL37622.1|3402318_3403224_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AUL37623.1|3405919_3406687_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
AUL38013.1|3406804_3407449_+	hypothetical protein	NA	NA	NA	NA	NA
AUL37624.1|3407712_3408009_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AUL37625.1|3408155_3409226_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AUL37626.1|3409922_3410777_+	hypothetical protein	NA	NA	NA	NA	NA
AUL37627.1|3410802_3412023_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL38014.1|3412340_3414272_+	hypothetical protein	NA	NA	NA	NA	NA
AUL37628.1|3414744_3415005_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL37629.1|3415043_3415865_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
>prophage 24
CP018895	Bordetella holmesii isolate H656 chromosome, complete genome	3695370	3608755	3657456	3695370	tRNA,transposase,holin	Catovirus(20.0%)	39	NA	NA
AUL37798.1|3608755_3610546_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.5	5.5e-07
AUL37799.1|3610587_3611223_-	hypothetical protein	NA	A0A2I7S9X1	Vibrio_phage	29.0	1.2e-12
AUL37800.1|3611225_3611540_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
AUL37801.1|3613090_3614713_-|holin	choline dehydrogenase	holin	A0A1V0S9J5	Catovirus	29.6	5.4e-46
AUL37802.1|3614883_3614988_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
AUL37803.1|3614980_3615691_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
AUL37804.1|3615965_3616454_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUL37805.1|3616595_3617795_+	2-aminoadipate aminotransferase	NA	NA	NA	NA	NA
AUL37806.1|3617870_3618794_+	4-hydroxybenzoate polyprenyltransferase	NA	NA	NA	NA	NA
AUL37807.1|3619128_3619509_+	hypothetical protein	NA	NA	NA	NA	NA
AUL38022.1|3619652_3620411_-	transcriptional regulator GlcC	NA	NA	NA	NA	NA
AUL38023.1|3620622_3622794_+	malate synthase G	NA	NA	NA	NA	NA
AUL37808.1|3622851_3623925_-	lipase	NA	G9BWD6	Planktothrix_phage	37.1	2.6e-28
AUL37809.1|3623917_3625687_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AUL37810.1|3625701_3626811_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL37811.1|3626926_3629416_-	signal protein	NA	NA	NA	NA	NA
AUL37812.1|3629402_3630074_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL37813.1|3630597_3631644_+	oxidoreductase	NA	NA	NA	NA	NA
AUL37814.1|3631652_3632222_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUL37815.1|3633319_3634402_+	UDP-N-acetylglucosamine 2-epimerase	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	33.2	1.1e-45
AUL37816.1|3634426_3635680_+	glycosyltransferase WbuB	NA	NA	NA	NA	NA
AUL37817.1|3635684_3636872_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	NA	NA	NA	NA
AUL37818.1|3636868_3637462_+	sugar transferase	NA	NA	NA	NA	NA
AUL37819.1|3637848_3639786_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	27.9	2.2e-25
AUL37820.1|3639919_3640870_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL37821.1|3640951_3641659_-	hypothetical protein	NA	NA	NA	NA	NA
AUL37822.1|3641722_3644359_+	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	26.3	8.0e-23
AUL37823.1|3644488_3645709_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.1e-181
AUL37824.1|3645787_3646843_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL37825.1|3646842_3647613_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL37826.1|3648180_3648981_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
AUL37827.1|3649069_3650497_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUL37828.1|3650591_3651092_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL37829.1|3651184_3651445_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL38024.1|3651510_3652209_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL37830.1|3654172_3654652_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL37831.1|3654639_3655566_-	bestrophin	NA	NA	NA	NA	NA
AUL37832.1|3655682_3656210_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
AUL37833.1|3656235_3657456_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
