The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	148265	195149	3698359	protease,transposase	uncultured_Mediterranean_phage(22.22%)	49	NA	NA
AUL31490.1|148265_148703_-|protease	ClpXP protease specificity-enhancing factor	protease	NA	NA	NA	NA
AUL31491.1|148711_149323_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUL31492.1|149475_150327_-	cytochrome c1	NA	NA	NA	NA	NA
AUL31493.1|150351_151740_-	cytochrome b	NA	NA	NA	NA	NA
AUL31494.1|151821_152463_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AUL31495.1|152611_153049_+	large-conductance mechanosensitive channel protein	NA	NA	NA	NA	NA
AUL31496.1|153106_153883_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AUL31497.1|153902_155033_+	2-alkenal reductase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	37.2	3.0e-11
AUL31498.1|155097_155883_-	twin arginine-targeting protein translocase TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	34.4	5.0e-29
AUL31499.1|155879_156377_-	twin arginine-targeting protein translocase TatB	NA	NA	NA	NA	NA
AUL31500.1|156425_156647_-	Sec-independent protein translocase TatA	NA	NA	NA	NA	NA
AUL31501.1|156662_157031_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
AUL31502.1|157038_157389_-	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
AUL31503.1|157385_157790_-	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
AUL31504.1|157791_158607_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
AUL31505.1|158603_159344_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
AUL31506.1|159410_160097_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
AUL31507.1|160115_160703_-	imidazoleglycerol-phosphate dehydratase	NA	NA	NA	NA	NA
AUL31508.1|160704_161799_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AUL31509.1|161795_163103_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
AUL31510.1|163128_163800_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
AUL31511.1|163796_165062_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUL31512.1|165061_165307_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
AUL31513.1|165310_166108_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AUL31514.1|166104_166914_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	2.8e-19
AUL31515.1|167050_167677_-	ABC transporter	NA	NA	NA	NA	NA
AUL31516.1|167702_168494_-	hypothetical protein	NA	NA	NA	NA	NA
AUL31517.1|168558_169047_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AUL31518.1|169059_169842_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL31519.1|169838_170675_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.7e-22
AUL31520.1|170856_171837_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL31521.1|171901_172537_-	hypothetical protein	NA	NA	NA	NA	NA
AUL31522.1|172737_174204_-	glutamate synthase	NA	NA	NA	NA	NA
AUL31523.1|174212_178952_-	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
AUL31524.1|179305_180526_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL31525.1|180641_181385_-	hypothetical protein	NA	NA	NA	NA	NA
AUL31526.1|181554_182661_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.1	1.4e-32
AUL31527.1|182671_183511_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AUL31528.1|183568_184258_+	hypothetical protein	NA	NA	NA	NA	NA
AUL31529.1|184354_184807_+	hypothetical protein	NA	NA	NA	NA	NA
AUL31530.1|184810_186031_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL31531.1|186254_187142_+	RNA polymerase factor sigma-32	NA	A0A248SJA5	Salicola_phage	38.5	2.1e-39
AUL34513.1|187456_188242_-	phosphodiesterase	NA	NA	NA	NA	NA
AUL31532.1|191084_191861_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AUL31533.1|192353_192614_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL31534.1|192652_193474_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL31535.1|193508_193778_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
AUL31536.1|193749_194100_+	bifunctional protein GlmU	NA	NA	NA	NA	NA
AUL31537.1|194198_195149_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	226939	263753	3698359	transposase	Leptospira_phage(40.0%)	32	NA	NA
AUL31562.1|226939_227200_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL31563.1|227292_227793_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL31564.1|228166_229387_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL31565.1|230041_231319_+	cytosine deaminase	NA	NA	NA	NA	NA
AUL31566.1|231373_231940_-	cysteine dioxygenase	NA	NA	NA	NA	NA
AUL31567.1|232025_233189_-	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUL31568.1|233357_233642_+	acylphosphatase	NA	NA	NA	NA	NA
AUL31569.1|233665_234304_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL31570.1|234425_235397_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL31571.1|236975_237746_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL31572.1|237957_238908_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL34520.1|238880_239384_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	49.7	3.4e-39
AUL31573.1|239460_240465_-	hypothetical protein	NA	NA	NA	NA	NA
AUL31574.1|240536_242105_-	acetolactate synthase large subunit	NA	G9E4W7	Ostreococcus_lucimarinus_virus	27.1	4.5e-05
AUL31575.1|242241_243291_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AUL31576.1|243293_244478_+	CoA transferase	NA	NA	NA	NA	NA
AUL31577.1|244506_245637_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL31578.1|245649_246792_+	carnitine dehydratase	NA	NA	NA	NA	NA
AUL31579.1|248601_249216_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL31580.1|249264_250167_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL31581.1|250293_250683_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUL31582.1|250684_251566_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
AUL31583.1|251594_252563_+	MFS transporter	NA	NA	NA	NA	NA
AUL31584.1|252771_253761_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL31585.1|255310_256090_+	oxidoreductase	NA	NA	NA	NA	NA
AUL34521.1|256120_257866_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AUL31586.1|257862_258765_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
AUL31587.1|259048_260257_+	ferredoxin reductase	NA	NA	NA	NA	NA
AUL31588.1|260438_260702_+	hypothetical protein	NA	NA	NA	NA	NA
AUL31589.1|260707_261187_+	DUF188 domain-containing protein	NA	NA	NA	NA	NA
AUL31590.1|261247_262357_-	porin	NA	NA	NA	NA	NA
AUL31591.1|262532_263753_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 3
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	587431	656265	3698359	tRNA,transposase	Staphylococcus_phage(21.43%)	59	NA	NA
AUL31866.1|587431_588295_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL31867.1|588378_589506_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
AUL31868.1|589514_590930_-	metallopeptidase	NA	A8ATH6	Listeria_phage	42.7	6.7e-16
AUL31869.1|591209_592439_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
AUL31870.1|592477_593134_+	phospholipid-binding protein	NA	NA	NA	NA	NA
AUL31871.1|593337_594588_+	serine hydroxymethyltransferase	NA	A0A219YCZ0	Aeromonas_phage	52.2	2.8e-98
AUL31872.1|594748_595234_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AUL31873.1|595238_596201_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL31874.1|596200_596761_-	hydrolase	NA	NA	NA	NA	NA
AUL31875.1|596796_598071_+	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	31.9	1.5e-38
AUL31876.1|598092_598734_+	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	36.1	7.2e-26
AUL31877.1|601021_602284_+	hypothetical protein	NA	NA	NA	NA	NA
AUL31878.1|602280_603801_+	SpoVR family protein	NA	NA	NA	NA	NA
AUL31879.1|603797_604634_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL31880.1|605871_606771_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL31881.1|607146_607803_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUL31882.1|607980_608388_-	alkylhydroperoxidase	NA	NA	NA	NA	NA
AUL31883.1|609702_610923_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL31884.1|610919_611390_+	MFS permease	NA	NA	NA	NA	NA
AUL31885.1|611399_611855_-	hypothetical protein	NA	NA	NA	NA	NA
AUL31886.1|612822_614391_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AUL31887.1|614613_615051_+	universal stress protein	NA	NA	NA	NA	NA
AUL31888.1|615062_615473_-	hypothetical protein	NA	NA	NA	NA	NA
AUL31889.1|615503_616277_-	NADH pyrophosphatase	NA	NA	NA	NA	NA
AUL31890.1|616504_618607_+	dehydrogenase	NA	NA	NA	NA	NA
AUL31891.1|619115_619964_+	two-component response regulator	NA	NA	NA	NA	NA
AUL31892.1|619983_620199_-	hypothetical protein	NA	NA	NA	NA	NA
AUL31893.1|620353_621250_+	hypothetical protein	NA	NA	NA	NA	NA
AUL31894.1|621353_622244_+	nicotinate-nucleotide diphosphorylase (carboxylating)	NA	NA	NA	NA	NA
AUL31895.1|622320_623289_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL31896.1|623289_624000_-	hypothetical protein	NA	NA	NA	NA	NA
AUL31897.1|624075_626169_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL31898.1|626198_626507_-	hypothetical protein	NA	NA	NA	NA	NA
AUL31899.1|626693_627479_-	enoyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
AUL31900.1|627537_628950_-	lytic transglycosylase	NA	A0A223LD43	Bacillus_phage	29.3	2.1e-06
AUL31901.1|628957_629767_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AUL31902.1|629784_630549_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL31903.1|630617_631079_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	51.5	4.5e-38
AUL31904.1|631203_632286_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUL31905.1|632301_632499_+	hypothetical protein	NA	NA	NA	NA	NA
AUL31906.1|632461_633682_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL31907.1|636691_637426_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	42.4	2.6e-40
AUL31908.1|637594_638815_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL31909.1|639189_640176_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AUL31910.1|640179_642903_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	6.6e-20
AUL31911.1|642903_644031_+	hypothetical protein	NA	NA	NA	NA	NA
AUL31912.1|644043_645456_+	RND transporter	NA	NA	NA	NA	NA
AUL31913.1|645630_646287_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL31914.1|646307_647354_+	glycosyltransferase	NA	F1C5B0	Cronobacter_phage	39.5	1.4e-58
AUL31915.1|647350_648940_+	dolichyl-phosphate-mannose--protein mannosyltransferase	NA	NA	NA	NA	NA
AUL31916.1|649094_650204_+	hypothetical protein	NA	NA	NA	NA	NA
AUL31917.1|650193_651090_-	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	33.1	6.5e-09
AUL31918.1|651136_651769_-	hypothetical protein	NA	NA	NA	NA	NA
AUL31919.1|651793_652678_-	EamA family transporter	NA	NA	NA	NA	NA
AUL31920.1|652805_654287_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL31921.1|654359_654704_+	TIGR01244 family protein	NA	NA	NA	NA	NA
AUL31922.1|654789_655254_+	universal stress protein	NA	NA	NA	NA	NA
AUL31923.1|655411_655672_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL31924.1|655764_656265_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	49.7	2.8e-41
>prophage 4
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	659573	724620	3698359	tRNA,transposase	Ralstonia_virus(42.86%)	58	NA	NA
AUL31927.1|659573_660524_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL31928.1|660556_661003_+|tRNA	cys-tRNA(pro)/cys-tRNA(cys) deacylase	tRNA	NA	NA	NA	NA
AUL31929.1|661051_661741_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
AUL31930.1|661828_662323_-	peptidoglycan-associated lipoprotein	NA	NA	NA	NA	NA
AUL31931.1|662354_663671_-	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
AUL31932.1|663687_664608_-	protein TolA	NA	NA	NA	NA	NA
AUL31933.1|664642_665104_-	protein TolR	NA	NA	NA	NA	NA
AUL31934.1|665103_665778_-	protein TolQ	NA	NA	NA	NA	NA
AUL31935.1|665780_666203_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUL31936.1|666256_667987_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	28.6	1.2e-11
AUL31937.1|668052_668622_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AUL31938.1|668602_669289_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL31939.1|669308_670814_+	sensor histidine kinase	NA	NA	NA	NA	NA
AUL31940.1|671042_671492_+	tripartite tricarboxylate transporter TctB	NA	NA	NA	NA	NA
AUL31941.1|671497_673018_+	hypothetical protein	NA	NA	NA	NA	NA
AUL31942.1|673071_674292_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL31943.1|674388_675318_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL31944.1|675476_676382_-	oxidoreductase	NA	NA	NA	NA	NA
AUL31945.1|676581_677802_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL31946.1|677857_679363_-	hypothetical protein	NA	NA	NA	NA	NA
AUL31947.1|679384_679840_-	tricarboxylate transporter	NA	NA	NA	NA	NA
AUL31948.1|680196_680769_+	hypothetical protein	NA	NA	NA	NA	NA
AUL31949.1|680768_681080_+	cell division protein ZapA	NA	NA	NA	NA	NA
AUL31950.1|681393_682155_+	hypothetical protein	NA	NA	NA	NA	NA
AUL31951.1|682123_682918_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AUL31952.1|683096_683432_+	cytochrome C	NA	NA	NA	NA	NA
AUL31953.1|683448_684006_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AUL31954.1|684067_685180_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
AUL31955.1|685320_685797_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL31956.1|692138_692333_+	hypothetical protein	NA	NA	NA	NA	NA
AUL31957.1|692460_692721_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL31958.1|692813_693314_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL31959.1|693551_693926_+	hypothetical protein	NA	NA	NA	NA	NA
AUL34541.1|694143_694422_-	DNA topoisomerase III	NA	NA	NA	NA	NA
AUL31960.1|694570_695764_+	peptidase M20	NA	NA	NA	NA	NA
AUL31961.1|695776_696835_+	dihydroorotase	NA	NA	NA	NA	NA
AUL31962.1|696872_698681_-	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	29.5	2.5e-44
AUL31963.1|699455_699884_+	cell division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
AUL31964.1|699892_700966_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	NA	NA	NA	NA
AUL31965.1|700965_701253_+	cell division protein FtsL	NA	NA	NA	NA	NA
AUL31966.1|701249_702983_+	cell division protein	NA	NA	NA	NA	NA
AUL31967.1|702979_705802_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
AUL31968.1|705791_706961_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AUL31969.1|706957_708490_+	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	NA	NA	NA	NA
AUL31970.1|708486_709680_+	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
AUL31971.1|709676_710750_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AUL31972.1|710746_712153_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
AUL31973.1|712149_713103_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AUL31974.1|713111_713936_+	cell division protein FtsQ	NA	NA	NA	NA	NA
AUL31975.1|713940_715167_+	cell division protein FtsA	NA	NA	NA	NA	NA
AUL31976.1|715362_716547_+	cell division protein FtsZ	NA	NA	NA	NA	NA
AUL31977.1|716786_717710_+	UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
AUL31978.1|717800_718016_+	hypothetical protein	NA	NA	NA	NA	NA
AUL31979.1|718052_718547_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
AUL31980.1|718589_719573_+	peptidase M23	NA	A0A292GJG6	Xanthomonas_phage	47.7	1.2e-27
AUL31981.1|719733_722469_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AUL31982.1|722470_723190_+	hypothetical protein	NA	NA	NA	NA	NA
AUL31983.1|723399_724620_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 5
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	799235	854147	3698359	holin,transposase	Ralstonia_virus(16.67%)	53	NA	NA
AUL32044.1|799235_801335_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AUL32045.1|801476_802316_-	branched chain amino acid aminotransferase	NA	NA	NA	NA	NA
AUL32046.1|803445_804333_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL32047.1|804423_804558_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL32048.1|804633_805638_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL32049.1|806544_806805_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL32050.1|807079_807715_-	endonuclease III	NA	NA	NA	NA	NA
AUL32051.1|807735_808374_-	ferredoxin	NA	NA	NA	NA	NA
AUL32052.1|808424_809651_-	esterase	NA	NA	NA	NA	NA
AUL32053.1|809787_810585_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AUL32054.1|810615_810939_-	ferredoxin	NA	NA	NA	NA	NA
AUL32055.1|811103_812279_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	32.5	4.2e-48
AUL32056.1|812317_812671_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32057.1|812701_813121_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32058.1|813213_814053_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32059.1|814249_816496_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AUL32060.1|816515_817829_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	41.0	1.5e-83
AUL32061.1|817994_819146_+	acetylornithine deacetylase (ArgE)	NA	NA	NA	NA	NA
AUL32062.1|819286_820486_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AUL32063.1|820482_821346_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AUL32064.1|821375_822254_+	acetyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
AUL32065.1|822462_823008_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32066.1|823178_823439_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL32067.1|824387_827519_-	ribonuclease E/G	NA	NA	NA	NA	NA
AUL32068.1|828098_829004_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AUL32069.1|829005_829662_+	HAD family hydrolase	NA	NA	NA	NA	NA
AUL32070.1|829779_830739_+	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AUL32071.1|830751_831378_+	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AUL32072.1|831358_832141_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	32.4	5.0e-13
AUL34547.1|832144_832855_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL32073.1|832851_833445_-	septum formation protein Maf	NA	NA	NA	NA	NA
AUL32074.1|833662_834310_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32075.1|834362_834545_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
AUL32076.1|834603_835668_+	phosphate acyltransferase	NA	NA	NA	NA	NA
AUL32077.1|835667_836654_+	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
AUL32078.1|836713_837649_+	[acyl-carrier-protein] S-malonyltransferase	NA	NA	NA	NA	NA
AUL32079.1|837651_838401_+	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.0	2.7e-16
AUL32080.1|838618_838858_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	48.5	1.6e-10
AUL32081.1|839029_840259_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AUL32082.1|840261_840693_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32083.1|840689_841289_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	26.9	2.6e-06
AUL32084.1|841301_841787_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32085.1|841786_842821_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AUL32086.1|842861_844364_+	serine peptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.2	1.1e-21
AUL32087.1|844448_845669_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	5.1e-182
AUL32088.1|845855_846806_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL32089.1|846873_848667_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.5	1.4e-23
AUL32090.1|848690_849575_+	S26 family signal peptidase	NA	NA	NA	NA	NA
AUL32091.1|849580_850336_+	ribonuclease III	NA	M4QNJ2	Ostreococcus_lucimarinus_virus	33.5	1.5e-19
AUL32092.1|850332_851223_+	GTPase Era	NA	NA	NA	NA	NA
AUL32093.1|851215_851803_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AUL32094.1|851825_852917_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.9	2.1e-17
AUL32095.1|852926_854147_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 6
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	863841	918403	3698359	transposase	Ralstonia_virus(28.57%)	52	NA	NA
AUL32104.1|863841_865062_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
AUL32105.1|865229_865565_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32106.1|865760_866426_-	hypothetical protein	NA	A0A0A8WF62	Clostridium_phage	34.5	1.6e-15
AUL32107.1|866671_868561_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	30.7	2.4e-61
AUL32108.1|868557_868965_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32109.1|869048_870275_+	MFS transporter	NA	NA	NA	NA	NA
AUL32110.1|870424_872404_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	43.6	6.1e-84
AUL32111.1|872468_873689_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL32112.1|874716_875730_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AUL32113.1|875751_876585_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL32114.1|876634_878281_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
AUL32115.1|878413_878860_+	thioesterase	NA	NA	NA	NA	NA
AUL32116.1|878974_879673_+	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUL32117.1|879685_880339_+	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUL32118.1|880539_881424_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL32119.1|881420_882401_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
AUL32120.1|882438_884319_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.8	2.0e-20
AUL32121.1|884393_885947_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
AUL32122.1|886020_886941_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
AUL32123.1|886948_887842_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
AUL32124.1|887931_888999_+	aminopeptidase	NA	NA	NA	NA	NA
AUL32125.1|889009_889828_+	aminopeptidase	NA	NA	NA	NA	NA
AUL32126.1|889842_891639_+	Xaa-Pro aminopeptidase	NA	A0A0P0I8D7	Acinetobacter_phage	49.7	1.3e-165
AUL32127.1|891882_893535_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.5	1.7e-156
AUL32128.1|893706_893910_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32129.1|893884_893989_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32130.1|893992_895279_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	63.4	5.5e-150
AUL32131.1|895352_895724_+	cell division protein FtsB	NA	NA	NA	NA	NA
AUL32132.1|895742_896372_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32133.1|896451_897372_-	Hsp33 family molecular chaperone	NA	NA	NA	NA	NA
AUL32134.1|897410_897932_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AUL32135.1|897954_899622_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	33.4	9.8e-67
AUL32136.1|899817_900657_-	UDP-2,3-diacylglucosamine hydrolase	NA	A0A218MKA7	uncultured_virus	48.1	1.9e-66
AUL32137.1|900738_901263_-	RDD family protein	NA	NA	NA	NA	NA
AUL32138.1|901585_902086_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL32139.1|902178_902439_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL32140.1|902482_903490_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.4e-147
AUL32141.1|903686_903872_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32142.1|904104_905739_-	RNA methyltransferase	NA	NA	NA	NA	NA
AUL34548.1|905763_906186_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32143.1|906245_907706_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AUL32144.1|907761_908952_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
AUL32145.1|909025_909919_-	methylisocitrate lyase	NA	NA	NA	NA	NA
AUL32146.1|910109_911099_-	malate dehydrogenase	NA	NA	NA	NA	NA
AUL32147.1|911432_912212_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL32148.1|912333_912747_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
AUL32149.1|912746_913130_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
AUL32150.1|913133_914912_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
AUL32151.1|914925_915642_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
AUL32152.1|915667_915928_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
AUL32153.1|915948_917250_+	citrate (Si)-synthase	NA	NA	NA	NA	NA
AUL32154.1|917398_918403_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
>prophage 7
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	928901	993270	3698359	tRNA,transposase	Ralstonia_virus(44.44%)	49	NA	NA
AUL32164.1|928901_930122_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
AUL32165.1|930252_932535_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
AUL32166.1|932708_935366_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AUL32167.1|935601_937647_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
AUL32168.1|937984_940855_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
AUL32169.1|940901_942092_+	dihydrolipoamide succinyltransferase	NA	NA	NA	NA	NA
AUL32170.1|942162_943590_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	1.6e-41
AUL32171.1|943667_944759_+	cell division protein ZapE	NA	NA	NA	NA	NA
AUL32172.1|944897_945419_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL32173.1|945415_946327_+	transmembrane sensor protein	NA	NA	NA	NA	NA
AUL32174.1|946420_948880_+	ligand-gated channel	NA	NA	NA	NA	NA
AUL32175.1|949112_949277_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32176.1|950887_951226_+	iron uptake protein	NA	NA	NA	NA	NA
AUL32177.1|951269_952592_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUL32178.1|952645_955033_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
AUL32179.1|955198_957247_+	helicase	NA	A0A127AW80	Bacillus_phage	28.0	3.2e-75
AUL32180.1|957312_958137_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AUL32181.1|958213_959173_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AUL32182.1|959160_959925_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32183.1|960050_961676_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
AUL32184.1|961725_962463_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL32185.1|962554_963115_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
AUL32186.1|963288_963828_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32187.1|963830_964163_+	periplasmic lipoprotein involved in iron transport	NA	NA	NA	NA	NA
AUL32188.1|964173_965019_+	FTR1 family iron permease	NA	NA	NA	NA	NA
AUL32189.1|965040_966420_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32190.1|966468_967380_+	phenazine biosynthesis protein PhzC/PhzF	NA	NA	NA	NA	NA
AUL32191.1|967546_967882_-	phospholipid-binding protein	NA	NA	NA	NA	NA
AUL32192.1|967931_969152_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL32193.1|969273_969438_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
AUL32194.1|969495_969696_-	general stress protein CsbD	NA	NA	NA	NA	NA
AUL32195.1|970000_970534_-	cytochrome B	NA	A0A0U2QLA7	Escherichia_phage	43.3	8.3e-12
AUL32196.1|976156_978433_+	ABC transporter	NA	W8CYL7	Bacillus_phage	31.3	6.6e-58
AUL32197.1|978429_978909_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32198.1|978905_980039_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL32199.1|980091_980895_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32200.1|980928_982137_+	lytic transglycosylase	NA	NA	NA	NA	NA
AUL32201.1|982218_982647_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32202.1|982979_984536_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
AUL32203.1|984572_984893_-	hypothetical protein	NA	NA	NA	NA	NA
AUL34549.1|985028_985760_+	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL32204.1|985818_986343_+	DedA family protein	NA	NA	NA	NA	NA
AUL32205.1|986394_987834_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL32206.1|988800_989130_+	regulator	NA	NA	NA	NA	NA
AUL32207.1|989126_989633_+	toxin	NA	NA	NA	NA	NA
AUL34550.1|989854_990787_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	76.8	1.9e-136
AUL32208.1|990856_991117_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL32209.1|991155_991977_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL32210.1|992049_993270_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	1095053	1127215	3698359	protease,transposase	Ralstonia_virus(33.33%)	33	NA	NA
AUL32292.1|1095053_1096274_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL32293.1|1096361_1096952_+	EamA family transporter	NA	NA	NA	NA	NA
AUL34559.1|1096939_1097251_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32294.1|1097302_1098292_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AUL32295.1|1098412_1099294_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
AUL32296.1|1099467_1100322_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32297.1|1100353_1101202_+	sulfurtransferase	NA	NA	NA	NA	NA
AUL32298.1|1101329_1102550_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
AUL32299.1|1102568_1103135_-	phosphohydrolase	NA	NA	NA	NA	NA
AUL32300.1|1103332_1104484_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUL32301.1|1104622_1105627_-	hypothetical protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
AUL32302.1|1105783_1106755_-	MFS transporter	NA	NA	NA	NA	NA
AUL32303.1|1106833_1107622_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL32304.1|1107693_1107930_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AUL32305.1|1107938_1108850_+	geranyl transferase	NA	NA	NA	NA	NA
AUL32306.1|1108893_1110765_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUL32307.1|1110925_1111723_+	GTP cyclohydrolase	NA	NA	NA	NA	NA
AUL32308.1|1111954_1112329_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
AUL32309.1|1112405_1112729_+	primosomal replication protein N	NA	NA	NA	NA	NA
AUL32310.1|1112812_1113085_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
AUL32311.1|1113099_1113555_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AUL32312.1|1113676_1114513_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32313.1|1114509_1115883_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
AUL32314.1|1116197_1117148_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL32315.1|1118052_1119030_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
AUL32316.1|1119154_1120810_-	phosphate starvation-inducible protein PhoH	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
AUL32317.1|1120858_1121323_-	peroxiredoxin	NA	NA	NA	NA	NA
AUL32318.1|1121319_1121781_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32319.1|1122006_1123194_+	alanine transaminase	NA	NA	NA	NA	NA
AUL32320.1|1123190_1124495_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
AUL32321.1|1124491_1125901_+	threonine synthase	NA	NA	NA	NA	NA
AUL32322.1|1126094_1126355_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL32323.1|1126393_1127215_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
>prophage 9
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	1132867	1193649	3698359	protease,tRNA,transposase	Leptospira_phage(23.53%)	53	NA	NA
AUL32328.1|1132867_1134328_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AUL32329.1|1134590_1135664_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
AUL32330.1|1135748_1136969_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
AUL32331.1|1138726_1139548_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL32332.1|1139586_1139847_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL34560.1|1139874_1141320_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AUL32333.1|1141333_1142437_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
AUL32334.1|1142441_1143692_+	glycolate oxidase iron-sulfur subunit	NA	NA	NA	NA	NA
AUL32335.1|1143688_1145134_-	NAD synthetase	NA	NA	NA	NA	NA
AUL32336.1|1145130_1145445_-	NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AUL32337.1|1146746_1147967_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
AUL32338.1|1148066_1148933_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
AUL32339.1|1148993_1149974_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL32340.1|1150120_1151041_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
AUL32341.1|1151049_1152162_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUL32342.1|1152243_1153065_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32343.1|1153140_1153749_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUL34561.1|1153886_1155263_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
AUL32344.1|1155324_1155768_+	cytochrome C	NA	NA	NA	NA	NA
AUL34562.1|1155834_1156506_-	cytochrome B	NA	NA	NA	NA	NA
AUL32345.1|1156533_1156794_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL32346.1|1156832_1157654_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL32347.1|1157822_1158104_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32348.1|1158814_1159603_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32349.1|1159599_1160706_+	AI-2E family transporter	NA	NA	NA	NA	NA
AUL32350.1|1161380_1162739_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
AUL32351.1|1162853_1163051_-	gas vesicle protein	NA	NA	NA	NA	NA
AUL32352.1|1163068_1163890_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL32353.1|1163928_1164189_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL32354.1|1164282_1164837_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
AUL34563.1|1165424_1166741_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32355.1|1166753_1167767_-	dimethylhistidine N-methyltransferase	NA	NA	NA	NA	NA
AUL32356.1|1169344_1169644_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32357.1|1171004_1172663_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
AUL32358.1|1172811_1174032_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32359.1|1174149_1175433_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
AUL32360.1|1175436_1176378_-	transporter	NA	NA	NA	NA	NA
AUL32361.1|1176487_1176946_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL34564.1|1177326_1177947_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AUL32362.1|1178354_1180775_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
AUL32363.1|1180882_1181620_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AUL32364.1|1181666_1182911_+	hypothetical protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
AUL32365.1|1183233_1183506_+	DNA-binding protein HU	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
AUL32366.1|1184089_1184818_+	energy transducer TonB	NA	NA	NA	NA	NA
AUL32367.1|1184839_1185757_+	flagellar motor protein MotA	NA	NA	NA	NA	NA
AUL32368.1|1185756_1186266_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUL32369.1|1186382_1187054_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL32370.1|1187163_1188231_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
AUL32371.1|1188214_1190095_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	3.5e-65
AUL32372.1|1190231_1191419_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32373.1|1191719_1192505_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32374.1|1192528_1192789_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL32375.1|1192827_1193649_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
>prophage 10
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	1201676	1264090	3698359	protease,tRNA,transposase	Ralstonia_virus(28.57%)	55	NA	NA
AUL32383.1|1201676_1202897_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL32384.1|1202972_1203254_+	malate dehydrogenase	NA	NA	NA	NA	NA
AUL32385.1|1205085_1206081_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL32386.1|1206123_1206894_+	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
AUL32387.1|1207019_1207283_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUL32388.1|1207484_1207631_-	transmembrane sensor protein	NA	NA	NA	NA	NA
AUL32389.1|1207684_1208635_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL32390.1|1208716_1209196_-	transmembrane sensor protein	NA	NA	NA	NA	NA
AUL32391.1|1210089_1210350_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL32392.1|1210407_1211607_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
AUL32393.1|1211752_1212130_-	cytochrome c family protein	NA	NA	NA	NA	NA
AUL32394.1|1212153_1213935_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
AUL32395.1|1213943_1214681_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32396.1|1214965_1216525_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
AUL32397.1|1216584_1217343_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL32398.1|1217439_1218096_-	adenylate kinase	NA	NA	NA	NA	NA
AUL32399.1|1218249_1219014_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AUL32400.1|1219028_1219208_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32401.1|1219233_1220268_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AUL32402.1|1220264_1220678_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUL32403.1|1220674_1221259_-	flagellar motor protein MotA	NA	NA	NA	NA	NA
AUL32404.1|1221611_1222970_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
AUL32405.1|1223063_1223642_+	superoxide dismutase	NA	NA	NA	NA	NA
AUL32406.1|1223766_1224588_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL32407.1|1224626_1224887_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL34566.1|1224914_1226216_+	chloride channel protein-related protein	NA	NA	NA	NA	NA
AUL32408.1|1226319_1227525_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AUL32409.1|1227588_1228038_-	hypothetical protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
AUL32410.1|1228170_1228416_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
AUL32411.1|1228640_1228955_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
AUL32412.1|1229046_1229331_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32413.1|1229598_1234161_+	alpha-2-macroglobulin	NA	NA	NA	NA	NA
AUL32414.1|1234208_1236314_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
AUL32415.1|1236367_1238677_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
AUL32416.1|1240030_1241698_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AUL32417.1|1241700_1242366_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32418.1|1242498_1246305_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL32419.1|1246530_1247676_+	branched chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL32420.1|1247794_1248724_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL32421.1|1248720_1249797_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL32422.1|1249793_1250600_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
AUL32423.1|1250596_1251328_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
AUL32424.1|1251531_1251714_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32425.1|1251704_1252943_-	ammonia channel protein	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
AUL32426.1|1252990_1253329_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL32427.1|1253576_1254527_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL32428.1|1254845_1255028_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32429.1|1255093_1256314_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL32430.1|1256407_1257628_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL32431.1|1257687_1257951_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32432.1|1258072_1259572_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AUL32433.1|1259992_1260190_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AUL32434.1|1260205_1260565_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AUL32435.1|1260637_1261660_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
AUL32436.1|1261672_1264090_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 11
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	1273437	1319811	3698359	holin,tRNA,transposase	Ralstonia_virus(20.0%)	46	NA	NA
AUL32449.1|1273437_1275399_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	29.9	2.3e-27
AUL32450.1|1275527_1275776_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32451.1|1275905_1276184_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32452.1|1276277_1276730_+	hypothetical protein	NA	G1JW61	Mycobacterium_phage	36.3	8.9e-07
AUL32453.1|1276726_1277197_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUL32454.1|1277488_1278082_+	twin-arginine translocation pathway signal	NA	NA	NA	NA	NA
AUL32455.1|1278129_1278414_+	CsbD family protein	NA	NA	NA	NA	NA
AUL32456.1|1278470_1278653_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32457.1|1278804_1279008_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32458.1|1279102_1279345_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32459.1|1279492_1279705_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32460.1|1279832_1280915_+	N-acylglucosamine 2-epimerase	NA	NA	NA	NA	NA
AUL32461.1|1281005_1281221_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32462.1|1281227_1281593_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUL32463.1|1281646_1283446_-	metal ABC transporter permease	NA	W8CYL7	Bacillus_phage	28.4	8.7e-45
AUL32464.1|1283595_1283970_+	2,5-diketo-D-gluconic acid reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.5e-20
AUL32465.1|1283993_1284254_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL32466.1|1284292_1285114_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL32467.1|1285597_1286584_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUL32468.1|1286630_1286837_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32469.1|1286833_1288009_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32470.1|1288186_1288840_+	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	47.7	6.3e-54
AUL32471.1|1288834_1291357_-	penicillin-binding protein	NA	NA	NA	NA	NA
AUL32472.1|1291528_1293445_-	S9 family peptidase	NA	NA	NA	NA	NA
AUL32473.1|1293577_1294024_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32474.1|1294052_1294481_-	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
AUL32475.1|1295108_1296329_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
AUL32476.1|1297063_1297525_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	44.1	2.0e-17
AUL32477.1|1297663_1298890_+	nitric oxide dioxygenase	NA	NA	NA	NA	NA
AUL32478.1|1298911_1299349_+	BadM/Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AUL32479.1|1299471_1300719_+	D-amino acid dehydrogenase small subunit	NA	NA	NA	NA	NA
AUL32480.1|1300726_1301560_-	class III aminotransferase	NA	NA	NA	NA	NA
AUL32481.1|1301556_1302084_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL32482.1|1302173_1303394_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL32483.1|1303401_1305066_-	long-chain-fatty-acid--CoA ligase	NA	Q75ZG1	Hepacivirus	27.3	2.0e-40
AUL32484.1|1305073_1305583_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32485.1|1305579_1306194_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
AUL32486.1|1306194_1307388_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUL32487.1|1307397_1309782_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL32488.1|1309841_1311134_-	fatty acid transporter	NA	NA	NA	NA	NA
AUL32489.1|1311155_1313114_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUL32490.1|1313110_1314403_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUL32491.1|1314413_1316744_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL32492.1|1316769_1317438_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL32493.1|1317817_1318762_+	serine acetyltransferase	NA	NA	NA	NA	NA
AUL32494.1|1318860_1319811_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 12
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	1554659	1611793	3698359	tRNA,transposase	Leptospira_phage(15.79%)	45	NA	NA
AUL32702.1|1554659_1555148_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AUL32703.1|1555262_1556378_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
AUL34582.1|1557010_1558174_+	MFS transporter	NA	NA	NA	NA	NA
AUL32704.1|1558356_1561014_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32705.1|1561017_1564407_+	nuclease	NA	NA	NA	NA	NA
AUL32706.1|1564797_1566867_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.7	8.2e-47
AUL32707.1|1566905_1567232_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AUL32708.1|1567246_1567855_+	recombination protein RecR	NA	NA	NA	NA	NA
AUL32709.1|1569295_1570336_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL32710.1|1570328_1571138_+	mannosyltransferase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.5	1.1e-12
AUL32711.1|1571143_1571938_+	ABC transporter permease	NA	NA	NA	NA	NA
AUL34583.1|1572001_1572958_-	transaldolase	NA	M4SPL0	Cyanophage	30.7	3.6e-13
AUL32712.1|1573181_1574336_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.1	2.6e-50
AUL32713.1|1574346_1577586_+	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
AUL32714.1|1577650_1578547_+	aspartyl beta-hydroxylase	NA	H8ZJK8	Ostreococcus_tauri_virus	38.3	2.2e-36
AUL32715.1|1578614_1579376_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL32716.1|1579381_1580020_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AUL32717.1|1580012_1580921_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL32718.1|1582026_1583718_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL32719.1|1583785_1585108_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL32720.1|1585205_1585481_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32721.1|1585616_1586933_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	68.0	2.9e-154
AUL32722.1|1587133_1587562_+	transcriptional regulator	NA	A0A1X9I5R1	Streptococcus_phage	30.3	4.2e-06
AUL32723.1|1587627_1588848_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL32724.1|1589202_1589679_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AUL32725.1|1589937_1590546_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32726.1|1590564_1591236_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AUL32727.1|1591409_1593296_+	cell division protein FtsH	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
AUL32728.1|1593323_1594166_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
AUL32729.1|1594162_1595506_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
AUL32730.1|1595690_1596506_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL32731.1|1596571_1598053_-	exopolyphosphatase	NA	NA	NA	NA	NA
AUL32732.1|1598251_1600324_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
AUL32733.1|1600543_1601581_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
AUL32734.1|1601702_1603625_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32735.1|1603652_1604429_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
AUL32736.1|1605256_1605766_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32737.1|1606007_1606712_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	36.5	1.9e-27
AUL32738.1|1606843_1607614_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL34584.1|1607610_1608621_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL34585.1|1608679_1608940_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL34586.1|1608972_1609761_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.5	1.4e-44
AUL32739.1|1609928_1610189_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL32740.1|1610227_1611049_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AUL32741.1|1611103_1611793_+	hypothetical protein	NA	A0A1B0VBP7	Salmonella_phage	47.1	1.3e-49
>prophage 13
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	1629051	1676050	3698359	tRNA,transposase	Ralstonia_virus(20.0%)	47	NA	NA
AUL32759.1|1629051_1630272_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL32760.1|1630530_1631136_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32761.1|1631146_1632307_+	succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
AUL32762.1|1632328_1633210_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
AUL32763.1|1633506_1634205_+	hypothetical protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
AUL32764.1|1634346_1635069_+	hypothetical protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
AUL32765.1|1635187_1636126_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AUL32766.1|1636156_1636936_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AUL32767.1|1636922_1638146_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
AUL32768.1|1638150_1639698_+	protoheme IX synthesis protein	NA	NA	NA	NA	NA
AUL32769.1|1639733_1640267_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
AUL34588.1|1640510_1641206_+	5-carboxymethyl-2-hydroxymuconate isomerase	NA	NA	NA	NA	NA
AUL32770.1|1641220_1641352_+	entericidin	NA	NA	NA	NA	NA
AUL32771.1|1641399_1642524_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL32772.1|1642529_1644869_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
AUL32773.1|1644865_1645273_-	heat-shock protein Hsp20	NA	NA	NA	NA	NA
AUL32774.1|1645534_1645795_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32775.1|1646017_1646968_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL32776.1|1647017_1648226_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL32777.1|1648447_1648987_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL32778.1|1649211_1649616_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL32779.1|1649680_1650436_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
AUL32780.1|1650435_1651797_+	secretion protein	NA	NA	NA	NA	NA
AUL32781.1|1651793_1652417_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL32782.1|1652460_1652721_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL32783.1|1652759_1653581_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL32784.1|1653531_1654236_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL32785.1|1654232_1654988_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL34589.1|1655164_1655959_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL32786.1|1655955_1656393_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32787.1|1657077_1658046_-	homoserine kinase	NA	NA	NA	NA	NA
AUL32788.1|1658202_1659210_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AUL32789.1|1659267_1659726_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32790.1|1659799_1661146_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32791.1|1661163_1661535_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32792.1|1661534_1663004_+	hypothetical protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
AUL32793.1|1663159_1663885_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32794.1|1663898_1666613_-	histidine kinase	NA	NA	NA	NA	NA
AUL32795.1|1666864_1668229_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUL32796.1|1668268_1669327_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
AUL32797.1|1669354_1670173_+	peptidase M48	NA	NA	NA	NA	NA
AUL34590.1|1670210_1670489_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AUL32798.1|1671434_1671695_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL32799.1|1671752_1672052_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AUL32800.1|1672621_1674025_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AUL32801.1|1674037_1674688_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AUL32802.1|1674829_1676050_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 14
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	1680252	1800113	3698359	holin,integrase,tRNA,transposase	Leptospira_phage(16.67%)	116	1717667:1717726	1795146:1795484
AUL32806.1|1680252_1681068_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AUL34591.1|1681115_1682153_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL32807.1|1682204_1682864_+	N-(5'-phosphoribosyl)anthranilate isomerase	NA	NA	NA	NA	NA
AUL32808.1|1683503_1684379_-|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL34592.1|1684375_1684666_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL32809.1|1685430_1685691_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL32810.1|1686089_1686779_+	permease	NA	NA	NA	NA	NA
AUL32811.1|1686878_1687040_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32812.1|1687481_1687718_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32813.1|1687907_1688156_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32814.1|1688269_1689640_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AUL32815.1|1689640_1690381_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL32816.1|1690867_1692820_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
AUL32817.1|1692840_1693389_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.3	3.8e-12
AUL32818.1|1693554_1694511_+	glutathione synthase	NA	NA	NA	NA	NA
AUL34593.1|1694524_1694923_+	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
AUL34594.1|1694985_1695255_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AUL32819.1|1695283_1697059_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AUL32820.1|1697106_1697316_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32821.1|1697362_1697785_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AUL32822.1|1697904_1698882_+	ornithine cyclodeaminase	NA	NA	NA	NA	NA
AUL32823.1|1698950_1700114_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL32824.1|1700282_1701170_+	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
AUL32825.1|1701180_1701822_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
AUL32826.1|1701818_1702490_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
AUL32827.1|1702489_1703260_+	ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA	NA	G9BWD6	Planktothrix_phage	35.8	2.0e-27
AUL32828.1|1703310_1703760_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	Q2NP83	Xanthomonas_phage	62.8	2.3e-47
AUL32829.1|1703801_1704260_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32830.1|1704280_1704913_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32831.1|1705022_1705490_+	hydrolase	NA	NA	NA	NA	NA
AUL32832.1|1705511_1706054_+	hydrolase	NA	NA	NA	NA	NA
AUL32833.1|1706066_1706771_+	dipeptidase E	NA	NA	NA	NA	NA
AUL32834.1|1706789_1707260_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL32835.1|1707352_1708093_+	permease	NA	NA	NA	NA	NA
AUL32836.1|1708136_1708397_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL32837.1|1709272_1710484_-	phosphopantothenate synthase	NA	Q9HH70	Methanothermobacter_phage	30.4	2.2e-36
AUL32838.1|1710544_1711060_-	signal peptidase II	NA	NA	NA	NA	NA
AUL32839.1|1711062_1713924_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
AUL34595.1|1713913_1714879_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
AUL32840.1|1715635_1717111_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AUL34596.1|1717115_1717391_-	hypothetical protein	NA	NA	NA	NA	NA
1717667:1717726	attL	GTGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGC	NA	NA	NA	NA
AUL32841.1|1717727_1717988_+|transposase	transposase	transposase	NA	NA	NA	NA
1717667:1717726	attL	GTGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGC	NA	NA	NA	NA
AUL32842.1|1718026_1718848_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AUL32843.1|1719148_1720357_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
AUL32844.1|1720353_1722636_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
AUL32845.1|1722646_1725028_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL32846.1|1725291_1727199_-	ABC transporter	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
AUL32847.1|1727213_1728104_-	ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUL32848.1|1728110_1729244_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AUL32849.1|1729243_1730065_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AUL32850.1|1730089_1731280_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
AUL32851.1|1731581_1731863_+|integrase	integrase	integrase	NA	NA	NA	NA
AUL32852.1|1732028_1732349_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32853.1|1732388_1732655_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL34597.1|1732687_1733476_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.5	1.4e-44
AUL32854.1|1733671_1733932_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32855.1|1734010_1734271_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL32856.1|1734424_1735195_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
1733950:1734346	attR	GTGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGCAATGAAGAAACGATTTACGGAAGAGCAAATCATCGGCGTGCTCAAGGAAGCCGATGCAGGTGCCAAGCCCGCAGAGTTGTGCCGCAAGCACGGAATCTCCGAGGCAACGTACTACAACTGGAAGGCGAAGTTCGGTGGCATGACGGTGTCGGACGCTCAGAGGCTCAAGGAGCTGGAGCAGGAGAACAACAAGCTCAAGAAGCTGTTGGCCGAGTCGATGCTGGACAAGGCGGCGCTTCAGGATCTGCTAAGCCGAAAGTAGTCAGCCCGCAGGCCAAACGCGAGGCGGTCAGGACATTAATGACCGAGCGCAGCATGGGTGTTACCCGGGCCTGTG	NA	NA	NA	NA
AUL34598.1|1735191_1736202_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
1733950:1734346	attR	GTGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGCAATGAAGAAACGATTTACGGAAGAGCAAATCATCGGCGTGCTCAAGGAAGCCGATGCAGGTGCCAAGCCCGCAGAGTTGTGCCGCAAGCACGGAATCTCCGAGGCAACGTACTACAACTGGAAGGCGAAGTTCGGTGGCATGACGGTGTCGGACGCTCAGAGGCTCAAGGAGCTGGAGCAGGAGAACAACAAGCTCAAGAAGCTGTTGGCCGAGTCGATGCTGGACAAGGCGGCGCTTCAGGATCTGCTAAGCCGAAAGTAGTCAGCCCGCAGGCCAAACGCGAGGCGGTCAGGACATTAATGACCGAGCGCAGCATGGGTGTTACCCGGGCCTGTG	NA	NA	NA	NA
AUL34599.1|1736260_1737079_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.2e-54
AUL32857.1|1737541_1738327_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
AUL32858.1|1739186_1739447_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL32859.1|1739485_1740307_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL32860.1|1741372_1742377_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
AUL32861.1|1742452_1743265_+	nucleotide pyrophosphatase	NA	NA	NA	NA	NA
AUL32862.1|1743492_1745664_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AUL32863.1|1745717_1747037_-	MFS transporter	NA	NA	NA	NA	NA
AUL32864.1|1747125_1748346_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL32865.1|1748564_1749425_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL32866.1|1749421_1750645_-	MFS transporter	NA	NA	NA	NA	NA
AUL32867.1|1750943_1751441_+	osmotically inducible protein Y	NA	NA	NA	NA	NA
AUL32868.1|1751479_1752262_-	hydrolase	NA	NA	NA	NA	NA
AUL32869.1|1752287_1752506_-	SlyX protein	NA	NA	NA	NA	NA
AUL32870.1|1752580_1752850_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32871.1|1753069_1753534_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL32872.1|1753607_1753889_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUL34600.1|1754005_1754989_-|integrase	integrase	integrase	NA	NA	NA	NA
AUL32873.1|1755232_1756231_+	cointegrate resolution protein	NA	NA	NA	NA	NA
AUL32874.1|1756333_1756765_+	energy transducer TonB	NA	NA	NA	NA	NA
AUL32875.1|1756829_1757741_+	3-phosphoglycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	30.7	3.7e-20
AUL32876.1|1757873_1759955_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AUL32877.1|1759993_1760698_-	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AUL32878.1|1760790_1761675_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL32879.1|1761750_1762152_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32880.1|1762242_1762389_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
AUL32881.1|1762650_1763586_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL32882.1|1763667_1764321_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL32883.1|1764937_1765414_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL32884.1|1765438_1766233_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL32885.1|1766249_1767230_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL32886.1|1767402_1767615_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32887.1|1768028_1769804_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	3.5e-38
AUL32888.1|1769819_1771484_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
AUL32889.1|1771496_1774208_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AUL34601.1|1774753_1776508_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
AUL32890.1|1776504_1777131_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL32891.1|1777127_1777982_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.8	1.4e-29
AUL32892.1|1778101_1780156_+	oligopeptidase A	NA	NA	NA	NA	NA
AUL32893.1|1780265_1781216_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL32894.1|1781212_1781728_-	methyltransferase	NA	NA	NA	NA	NA
AUL32895.1|1782085_1782706_+	SCO family protein	NA	NA	NA	NA	NA
AUL32896.1|1782805_1783057_+	hypothetical protein	NA	NA	NA	NA	NA
AUL32897.1|1783144_1784623_-	multidrug transporter	NA	NA	NA	NA	NA
AUL32898.1|1784619_1787790_-	multidrug efflux RND transporter permease	NA	NA	NA	NA	NA
AUL32899.1|1787802_1788999_-	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUL32900.1|1789187_1790120_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL32901.1|1790187_1790919_-	pseudouridylate synthase	NA	NA	NA	NA	NA
AUL32902.1|1790984_1791620_+	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AUL32903.1|1791605_1792784_-	arabinose transporter	NA	NA	NA	NA	NA
AUL32904.1|1792944_1793493_-	hypothetical protein	NA	NA	NA	NA	NA
AUL32905.1|1793573_1793933_+	lysine transporter LysE	NA	NA	NA	NA	NA
AUL32906.1|1793980_1795201_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL32907.1|1795276_1796398_-	transporter	NA	NA	NA	NA	NA
AUL32908.1|1796435_1797149_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
AUL32909.1|1797159_1798380_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
AUL32910.1|1799162_1800113_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 15
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	1963309	2019919	3698359	integrase,transposase	Leptospira_phage(22.22%)	46	1957993:1958008	1988154:1988169
1957993:1958008	attL	GGCTGTTGCCGGCAAG	NA	NA	NA	NA
AUL33057.1|1963309_1963570_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL33058.1|1963593_1963788_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33059.1|1963787_1965995_-	outer membrane receptor protein	NA	NA	NA	NA	NA
AUL33060.1|1966267_1967065_+	enterobactin-dependent positive regulator	NA	NA	NA	NA	NA
AUL33061.1|1967110_1968166_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUL33062.1|1968200_1968395_-|integrase	integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	52.8	1.1e-06
AUL33063.1|1968391_1969333_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AUL33064.1|1969835_1970720_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33065.1|1971144_1973373_+	isocitrate dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AUL33066.1|1973657_1974122_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33067.1|1974128_1975646_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33068.1|1975694_1976447_-	polar amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	4.3e-30
AUL33069.1|1976454_1977108_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL33070.1|1977144_1977933_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL33071.1|1978050_1978632_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AUL33072.1|1978914_1979298_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33073.1|1979882_1980212_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33074.1|1981391_1982120_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.1	1.8e-09
AUL33075.1|1982116_1982881_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.3e-18
AUL33076.1|1982880_1984764_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL33077.1|1984776_1985982_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL33078.1|1987698_1988433_-	hypothetical protein	NA	NA	NA	NA	NA
1988154:1988169	attR	GGCTGTTGCCGGCAAG	NA	NA	NA	NA
AUL33079.1|1988609_1989401_+	hydratase	NA	NA	NA	NA	NA
AUL33080.1|1989423_1990968_-	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	42.9	8.8e-38
AUL33081.1|1991712_1992912_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AUL33082.1|1993348_1993972_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL33083.1|1993977_1997634_+	virulence sensor protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.0	6.5e-39
AUL33084.1|1999822_2001520_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33085.1|2001904_2002165_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL33086.1|2002203_2003025_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL33087.1|2003057_2003372_+	glutamate decarboxylase	NA	NA	NA	NA	NA
AUL33088.1|2003461_2005162_+	transporter	NA	NA	NA	NA	NA
AUL33089.1|2005241_2005619_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33090.1|2005755_2006481_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL33091.1|2006613_2007600_+	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL33092.1|2007602_2008076_+	TRAP transporter small permease protein	NA	NA	NA	NA	NA
AUL33093.1|2008080_2009364_+	C4-dicarboxylate ABC transporter permease	NA	NA	NA	NA	NA
AUL33094.1|2009360_2010251_+	CoA ester lyase	NA	NA	NA	NA	NA
AUL33095.1|2010247_2011945_+	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.7	4.0e-31
AUL33096.1|2013269_2014769_+	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
AUL33097.1|2014841_2015360_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33098.1|2015433_2016324_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AUL33099.1|2016381_2017635_+	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUL33100.1|2017669_2018434_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL33101.1|2018798_2019620_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AUL33102.1|2019658_2019919_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 16
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	2127805	2183474	3698359	protease,tRNA,transposase	uncultured_Mediterranean_phage(14.29%)	60	NA	NA
AUL33182.1|2127805_2128066_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL33183.1|2128104_2128926_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL33184.1|2128969_2129722_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33185.1|2130013_2130436_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33186.1|2130705_2131485_-	3'-5' exonuclease	NA	NA	NA	NA	NA
AUL33187.1|2131481_2132345_-	peptidase	NA	A0A292GJG6	Xanthomonas_phage	40.5	8.5e-14
AUL33188.1|2132362_2133160_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.5	9.8e-33
AUL33189.1|2133144_2133903_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.3	1.9e-70
AUL33190.1|2134067_2134706_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUL33191.1|2134702_2135281_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33192.1|2135292_2135826_-	carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUL33193.1|2135830_2136790_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL33194.1|2136820_2137603_-	amidohydrolase	NA	NA	NA	NA	NA
AUL33195.1|2137712_2138705_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL33196.1|2138706_2139744_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.7	5.6e-97
AUL33197.1|2139828_2141121_+	guanine permease	NA	A0A0R6PHV4	Moraxella_phage	36.7	2.9e-66
AUL33198.1|2141303_2142320_+	luciferase	NA	NA	NA	NA	NA
AUL33199.1|2142428_2142812_+	thioredoxin	NA	V9SJ74	Achromobacter_phage	26.8	1.2e-09
AUL34619.1|2142815_2143172_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33200.1|2143192_2143423_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33201.1|2143446_2144244_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL33202.1|2144248_2145016_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL33203.1|2145012_2146008_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL33204.1|2146057_2146822_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	6.3e-29
AUL33205.1|2146994_2148599_-	ABC-F family ATPase	NA	A0A1V0SKJ1	Klosneuvirus	28.9	7.7e-53
AUL33206.1|2148852_2149833_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AUL33207.1|2149829_2150318_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
AUL33208.1|2150310_2151159_-	hydrolase	NA	NA	NA	NA	NA
AUL33209.1|2151250_2151748_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33210.1|2151885_2152245_-	cation:proton antiporter	NA	NA	NA	NA	NA
AUL33211.1|2152241_2152523_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
AUL33212.1|2152522_2153005_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
AUL33213.1|2153006_2154635_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
AUL33214.1|2154631_2154976_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
AUL33215.1|2154977_2157920_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
AUL33216.1|2158365_2159337_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL34620.1|2159326_2160709_-	GTP-binding protein	NA	NA	NA	NA	NA
AUL33217.1|2160851_2161802_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL33218.1|2161761_2163003_-	GTP-binding protein	NA	NA	NA	NA	NA
AUL33219.1|2162999_2164121_-	DNA repair exonuclease	NA	NA	NA	NA	NA
AUL33220.1|2165612_2166080_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL33221.1|2166150_2166801_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33222.1|2166887_2168027_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33223.1|2168195_2169200_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
AUL33224.1|2169196_2170444_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUL33225.1|2170796_2171663_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
AUL33226.1|2171622_2173227_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL33227.1|2173238_2173925_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
AUL33228.1|2173921_2174962_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL33229.1|2175077_2175749_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL34621.1|2175769_2176738_+	secretion protein HlyD	NA	NA	NA	NA	NA
AUL33230.1|2176734_2177673_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
AUL33231.1|2177669_2178824_+	mannose-1-phosphate guanyltransferase	NA	NA	NA	NA	NA
AUL33232.1|2178832_2180284_+	ABC transporter permease	NA	NA	NA	NA	NA
AUL33233.1|2180314_2180797_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33234.1|2180798_2181692_+	hypothetical protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
AUL33235.1|2181688_2182132_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33236.1|2182144_2182522_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33237.1|2182661_2183060_+|protease	membrane-associated protease	protease	NA	NA	NA	NA
AUL33238.1|2183186_2183474_+|protease	CAAX protease family protein	protease	NA	NA	NA	NA
>prophage 17
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	2281279	2339691	3698359	tRNA,transposase	Shigella_phage(22.22%)	50	NA	NA
AUL33329.1|2281279_2281540_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL33330.1|2281750_2283049_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUL33331.1|2283091_2284120_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUL33332.1|2284234_2284801_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
AUL33333.1|2284859_2285705_-	phosphatase	NA	NA	NA	NA	NA
AUL34628.1|2285762_2286638_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUL33334.1|2286889_2287504_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33335.1|2287513_2288734_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL33336.1|2288782_2289448_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33337.1|2289495_2290491_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33338.1|2293668_2294583_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL33339.1|2294732_2295698_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL33340.1|2295705_2296122_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUL33341.1|2296118_2297036_+	oxidoreductase	NA	NA	NA	NA	NA
AUL33342.1|2297047_2297467_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33343.1|2297375_2298764_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL34629.1|2298760_2299012_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33344.1|2299182_2300139_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL33345.1|2300121_2300334_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33346.1|2300383_2301157_+	MBL fold hydrolase	NA	NA	NA	NA	NA
AUL33347.1|2301153_2302287_+	malate dehydrogenase	NA	NA	NA	NA	NA
AUL33348.1|2302296_2303247_+	D-3-phosphoglycerate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	28.4	4.8e-18
AUL33349.1|2303278_2304079_+	aldolase	NA	NA	NA	NA	NA
AUL33350.1|2304093_2305248_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33351.1|2305075_2305951_-|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL34630.1|2305947_2306238_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL33352.1|2306350_2307319_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33353.1|2307315_2308236_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33354.1|2308332_2312811_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33355.1|2313189_2317524_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33356.1|2318162_2318726_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33357.1|2318737_2318983_-	RNA-binding protein	NA	NA	NA	NA	NA
AUL33358.1|2319138_2319648_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL33359.1|2319693_2320674_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL33360.1|2320885_2323237_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL34631.1|2323283_2324090_-	DNAase	NA	NA	NA	NA	NA
AUL33361.1|2324110_2324800_-	lipoprotein ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	3.1e-35
AUL33362.1|2324792_2326073_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL33363.1|2326170_2327109_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33364.1|2327090_2328797_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
AUL33365.1|2330030_2330780_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL33366.1|2330786_2332301_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
AUL33367.1|2332313_2332601_+	hypothetical protein	NA	NA	NA	NA	NA
AUL34632.1|2332621_2333509_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AUL33368.1|2333659_2334166_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL33369.1|2334162_2335119_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL33370.1|2335306_2336653_+	protein FpvAIII	NA	NA	NA	NA	NA
AUL33371.1|2337598_2338369_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL34633.1|2338365_2339376_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL33372.1|2339445_2339691_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	2355601	2390784	3698359	protease,transposase	Leptospira_phage(20.0%)	34	NA	NA
AUL33390.1|2355601_2356645_+	alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
AUL34634.1|2356641_2356743_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33391.1|2356834_2357095_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL33392.1|2357133_2357955_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL33393.1|2358204_2358858_+	repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
AUL33394.1|2358973_2360194_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL33395.1|2360244_2362674_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
AUL33396.1|2362839_2364138_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
AUL33397.1|2364242_2364896_-	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
AUL33398.1|2364898_2366209_-	trigger factor	NA	NA	NA	NA	NA
AUL33399.1|2366436_2366976_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
AUL33400.1|2367460_2367721_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL34635.1|2368006_2369017_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL33401.1|2369013_2369784_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL33402.1|2369863_2370529_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	46.1	2.1e-49
AUL33403.1|2370496_2370988_-	SpoVR like family protein	NA	NA	NA	NA	NA
AUL33404.1|2371097_2371301_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
AUL33405.1|2371618_2371939_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33406.1|2371922_2372258_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33407.1|2372312_2372525_-	autotransporter	NA	NA	NA	NA	NA
AUL33408.1|2372600_2372939_+|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	50.0	3.7e-05
AUL34636.1|2372935_2373271_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL33409.1|2373333_2374905_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
AUL33410.1|2375698_2376010_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33411.1|2376202_2377024_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL33412.1|2377062_2377323_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL33413.1|2377450_2377645_-	hypothetical protein	NA	NA	NA	NA	NA
AUL34637.1|2383727_2384018_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL33414.1|2384014_2384890_+|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL33415.1|2385274_2386738_+	ribonuclease E/G	NA	NA	NA	NA	NA
AUL33416.1|2386870_2388421_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
AUL33417.1|2388732_2389554_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL33418.1|2389592_2389853_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL33419.1|2389929_2390784_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	77.8	7.3e-127
>prophage 19
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	2472781	2516609	3698359	protease,tRNA,transposase	Shigella_phage(40.0%)	35	NA	NA
AUL33490.1|2472781_2473429_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AUL33491.1|2473513_2474140_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AUL33492.1|2474204_2475050_+	hypothetical protein	NA	A0A1I9SA48	Rhodococcus_phage	35.1	2.4e-37
AUL33493.1|2475379_2475931_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33494.1|2476694_2476988_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33495.1|2477202_2477532_-	alkylhydroperoxidase	NA	NA	NA	NA	NA
AUL33496.1|2478115_2479576_+	cardiolipin synthase	NA	NA	NA	NA	NA
AUL33497.1|2479534_2479759_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33498.1|2480135_2481455_-	MFS transporter	NA	NA	NA	NA	NA
AUL33499.1|2481497_2481971_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33500.1|2481967_2482978_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33501.1|2483042_2484008_-	pyridoxal-5'-phosphate-dependent protein	NA	NA	NA	NA	NA
AUL33502.1|2484132_2484393_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL33503.1|2485236_2486112_-|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL34640.1|2486108_2486399_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL33504.1|2486668_2487586_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL33505.1|2488941_2490228_+	phospholipase	NA	NA	NA	NA	NA
AUL33506.1|2490321_2490921_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33507.1|2491145_2491667_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33508.1|2491932_2492487_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33509.1|2492506_2493868_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33510.1|2494220_2496800_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AUL33511.1|2496846_2497953_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AUL33512.1|2498099_2498609_+	dehydratase	NA	NA	NA	NA	NA
AUL33513.1|2498632_2499613_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUL34641.1|2499618_2501034_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AUL33514.1|2501030_2502203_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL33515.1|2502199_2503420_+	CoA transferase	NA	NA	NA	NA	NA
AUL33516.1|2503416_2504214_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL33517.1|2505022_2509702_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	28.4	1.1e-27
AUL33518.1|2512850_2513813_-	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL33519.1|2513809_2514328_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL33520.1|2514482_2514803_+	amidohydrolase	NA	NA	NA	NA	NA
AUL33521.1|2515488_2515749_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL33522.1|2515787_2516609_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.4	2.9e-56
>prophage 20
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	2555430	2656150	3698359	tRNA,transposase	Ralstonia_virus(15.79%)	97	NA	NA
AUL33558.1|2555430_2555691_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL33559.1|2556700_2557216_+	hypothetical protein	NA	T1SAR8	Salmonella_phage	44.6	3.9e-06
AUL33560.1|2557488_2557803_+	virulence factor	NA	NA	NA	NA	NA
AUL33561.1|2557990_2558227_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33562.1|2558517_2559873_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.5	2.1e-83
AUL34643.1|2559919_2561260_-	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	38.9	9.3e-76
AUL33563.1|2561361_2561994_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUL33564.1|2561993_2564363_-	cell division protein FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	2.2e-80
AUL33565.1|2564395_2565355_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	40.5	4.8e-58
AUL33566.1|2565341_2566034_+	DNA mismatch repair protein MutS	NA	NA	NA	NA	NA
AUL33567.1|2566030_2566363_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AUL33568.1|2566478_2567429_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL33569.1|2567425_2569492_-	cation acetate symporter	NA	NA	NA	NA	NA
AUL33570.1|2569491_2569764_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33571.1|2570458_2570548_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUL33572.1|2570547_2572332_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AUL33573.1|2572355_2574521_+	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.9	7.8e-24
AUL33574.1|2574531_2575131_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AUL33575.1|2577894_2578590_+	two-component system response regulator KdpE	NA	NA	NA	NA	NA
AUL33576.1|2578598_2579840_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33577.1|2579989_2580970_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33578.1|2581168_2582425_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	1.2e-11
AUL33579.1|2582627_2583053_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33580.1|2583103_2583466_-	cytochrome	NA	NA	NA	NA	NA
AUL34644.1|2583994_2584882_+	ATP-binding protein	NA	NA	NA	NA	NA
AUL33581.1|2586078_2586321_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUL33582.1|2586317_2586692_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33583.1|2587024_2589775_+	peptidase M16	NA	A0A2K9LA15	Tupanvirus	28.1	1.5e-19
AUL33584.1|2589943_2591089_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	60.8	4.0e-19
AUL33585.1|2591189_2593115_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.7	2.7e-145
AUL33586.1|2593203_2593578_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUL33587.1|2593599_2594130_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUL33588.1|2594243_2594477_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33589.1|2594563_2595655_-	ferrochelatase	NA	NA	NA	NA	NA
AUL33590.1|2595687_2596692_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AUL33591.1|2596801_2597701_+	NAD kinase	NA	NA	NA	NA	NA
AUL33592.1|2597722_2599378_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AUL34645.1|2599482_2600226_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	73.7	2.1e-101
AUL33593.1|2601055_2601316_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL33594.1|2602030_2602447_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
AUL34646.1|2602717_2603215_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33595.1|2603230_2604022_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AUL34647.1|2604079_2605066_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AUL34648.1|2605412_2605958_-|transposase	transposase	transposase	U5P429	Shigella_phage	66.3	2.2e-68
AUL33596.1|2606000_2606261_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL33597.1|2606353_2606854_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL33598.1|2607370_2608024_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
AUL33599.1|2608205_2608913_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL33600.1|2608909_2611525_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
AUL33601.1|2611581_2612766_+	putative methylaconitate Delta-isomerase PrpF	NA	NA	NA	NA	NA
AUL33602.1|2612826_2613435_+	lysine transporter LysE	NA	NA	NA	NA	NA
AUL33603.1|2613557_2614583_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUL33604.1|2614646_2615177_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL33605.1|2615056_2615398_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33606.1|2615394_2616102_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL33607.1|2616111_2617005_-	carboxyvinyl-carboxyphosphonate phosphorylmutase	NA	NA	NA	NA	NA
AUL33608.1|2616988_2617747_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL33609.1|2618038_2620714_+	aconitate hydratase 1	NA	NA	NA	NA	NA
AUL33610.1|2620730_2622092_+	dihydroorotase	NA	NA	NA	NA	NA
AUL33611.1|2622111_2622834_+	hydrolase	NA	NA	NA	NA	NA
AUL33612.1|2622838_2623837_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
AUL33613.1|2624257_2624566_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33614.1|2624613_2625186_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33615.1|2625163_2625568_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33616.1|2625686_2626604_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL33617.1|2626613_2627195_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AUL33618.1|2627191_2627944_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUL33619.1|2627986_2628706_+	arginyltransferase	NA	NA	NA	NA	NA
AUL33620.1|2628748_2629804_+	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AUL33621.1|2629913_2630756_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	77.8	4.5e-129
AUL33622.1|2630813_2631074_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL33623.1|2631112_2631934_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL33624.1|2632493_2633072_-	Phasin (PHA-granule associated protein)	NA	NA	NA	NA	NA
AUL33625.1|2633214_2634435_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL33626.1|2634739_2635717_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL33627.1|2635865_2636696_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL33628.1|2636809_2637625_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
AUL33629.1|2637647_2638502_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33630.1|2638500_2638884_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUL33631.1|2638990_2640364_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	1.8e-50
AUL33632.1|2640435_2640927_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33633.1|2640926_2641679_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33634.1|2642026_2642230_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33635.1|2642259_2642682_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AUL33636.1|2642693_2643791_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUL33637.1|2643803_2645321_-	peptidase	NA	NA	NA	NA	NA
AUL33638.1|2645394_2646234_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
AUL33639.1|2646255_2647113_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33640.1|2647185_2648304_-	porin	NA	NA	NA	NA	NA
AUL33641.1|2648934_2649756_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL33642.1|2649794_2650055_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL33643.1|2650098_2650728_-	calcium:sodium antiporter	NA	NA	NA	NA	NA
AUL33644.1|2650885_2652229_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AUL33645.1|2652237_2652621_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33646.1|2652780_2653932_+	monooxygenase	NA	NA	NA	NA	NA
AUL33647.1|2654030_2654981_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL33648.1|2655124_2656150_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
>prophage 21
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	2937304	3038123	3698359	tRNA,transposase	Ralstonia_virus(20.0%)	83	NA	NA
AUL33883.1|2937304_2938084_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AUL33884.1|2938106_2939054_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
AUL33885.1|2939055_2939256_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AUL33886.1|2939590_2939851_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL33887.1|2939889_2940711_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL33888.1|2941031_2941748_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
AUL33889.1|2941744_2942638_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL33890.1|2942801_2944022_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL33891.1|2944174_2945257_+	iron ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
AUL33892.1|2946936_2947920_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL33893.1|2947982_2949395_-	signal recognition particle protein	NA	NA	NA	NA	NA
AUL33894.1|2949512_2950355_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33895.1|2950633_2951242_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
AUL33896.1|2951257_2951878_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUL33897.1|2951943_2952654_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.6e-13
AUL33898.1|2952655_2953378_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
AUL33899.1|2953364_2953655_-	inner-membrane translocator	NA	NA	NA	NA	NA
AUL33900.1|2953730_2954951_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	4.6e-183
AUL33901.1|2955675_2956527_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL33902.1|2956578_2957832_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL33903.1|2958008_2958797_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33904.1|2958916_2959831_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL33905.1|2959963_2961856_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
AUL33906.1|2962041_2963421_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
AUL33907.1|2963865_2964162_+	site-specific recombinase	NA	NA	NA	NA	NA
AUL33908.1|2964205_2964466_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL33909.1|2964558_2965059_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL33910.1|2965072_2965297_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL33911.1|2967962_2968565_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AUL33912.1|2968698_2969157_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AUL33913.1|2969158_2969758_-	iron transport sensor protein	NA	NA	NA	NA	NA
AUL33914.1|2969766_2970576_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL33915.1|2970610_2971465_+	permease	NA	NA	NA	NA	NA
AUL33916.1|2971584_2972172_+	histidine utilization protein HutD	NA	NA	NA	NA	NA
AUL33917.1|2972168_2973548_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
AUL33918.1|2981869_2983210_+	8-amino-7-oxononanoate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
AUL33919.1|2983223_2984075_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
AUL33920.1|2984086_2985352_-	capsule biosynthesis protein CapA	NA	NA	NA	NA	NA
AUL33921.1|2985413_2987495_-	beta-3-deoxy-D-manno-oct-2-ulosonic acid transferase	NA	NA	NA	NA	NA
AUL33922.1|2988443_2988704_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL33923.1|2988796_2989297_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL33924.1|2989293_2990148_-	sulfatase	NA	NA	NA	NA	NA
AUL33925.1|2990140_2990935_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL33926.1|2991150_2992101_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL33927.1|2992199_2993150_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL33928.1|2993752_2994550_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL33929.1|2994589_2995243_-	DL-methionine transporter permease subunit	NA	NA	NA	NA	NA
AUL33930.1|2995223_2996288_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
AUL33931.1|2996451_2998677_-	glycosyl hydrolase	NA	NA	NA	NA	NA
AUL33932.1|2998922_3000767_-	FAD-dependent cmnm(5)s(2)U34 oxidoreductase	NA	NA	NA	NA	NA
AUL33933.1|3000883_3001756_+	inositol monophosphatase	NA	NA	NA	NA	NA
AUL33934.1|3001802_3003503_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
AUL33935.1|3003565_3004765_+	amidohydrolase	NA	NA	NA	NA	NA
AUL33936.1|3004775_3005654_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL33937.1|3005761_3006799_+	hypothetical protein	NA	NA	NA	NA	NA
AUL34658.1|3006879_3007284_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUL33938.1|3007295_3008753_+	magnesium transporter	NA	NA	NA	NA	NA
AUL33939.1|3009395_3009992_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AUL33940.1|3010152_3010611_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL33941.1|3011388_3012360_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33942.1|3012481_3012901_+	hypothetical protein	NA	NA	NA	NA	NA
AUL33943.1|3013776_3014037_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL33944.1|3014192_3015413_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL33945.1|3015474_3016362_-	HflC protein	NA	NA	NA	NA	NA
AUL33946.1|3016379_3017684_-	HflK protein	NA	NA	NA	NA	NA
AUL33947.1|3017649_3018756_-	GTPase HflX	NA	NA	NA	NA	NA
AUL33948.1|3018843_3019080_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
AUL33949.1|3019263_3020337_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AUL33950.1|3020333_3021689_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AUL33951.1|3021713_3022871_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AUL33952.1|3022876_3023515_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33953.1|3023518_3024814_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AUL33954.1|3024846_3026133_-	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase	NA	NA	NA	NA	NA
AUL33955.1|3026145_3026634_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL33956.1|3026630_3027779_-	23S rRNA (adenine(2503)-C(2))-methyltransferase	NA	NA	NA	NA	NA
AUL33957.1|3027808_3028234_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.9	2.4e-22
AUL33958.1|3028553_3031433_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	1.1e-137
AUL33959.1|3031486_3032707_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL33960.1|3032755_3033619_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AUL33961.1|3033618_3034212_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUL33962.1|3034503_3034764_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUL33963.1|3035263_3035515_-	hypothetical protein	NA	NA	NA	NA	NA
AUL33964.1|3035501_3038123_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.5	2.8e-84
>prophage 22
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	3096980	3152279	3698359	protease,tRNA,transposase	Ralstonia_virus(25.0%)	39	NA	NA
AUL34015.1|3096980_3098201_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL34660.1|3098242_3099499_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL34016.1|3099739_3100885_+	Bcr/CflA family drug resistance efflux transporter	NA	NA	NA	NA	NA
AUL34017.1|3101191_3101428_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AUL34018.1|3101508_3101676_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AUL34019.1|3101832_3102921_+	hypothetical protein	NA	NA	NA	NA	NA
AUL34020.1|3102946_3104167_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL34021.1|3106385_3106817_+	DNA-binding protein	NA	NA	NA	NA	NA
AUL34022.1|3106943_3107456_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUL34661.1|3107488_3108649_+	MFS transporter	NA	NA	NA	NA	NA
AUL34023.1|3108720_3111378_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	38.7	7.5e-170
AUL34024.1|3111389_3112067_+	hypothetical protein	NA	NA	NA	NA	NA
AUL34025.1|3112066_3113116_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AUL34026.1|3113139_3114399_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.2	1.9e-94
AUL34027.1|3114405_3114795_+	hypothetical protein	NA	NA	NA	NA	NA
AUL34028.1|3114946_3115231_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL34029.1|3115227_3115617_+	hypothetical protein	NA	NA	NA	NA	NA
AUL34662.1|3115629_3116793_-	secretion protein	NA	NA	NA	NA	NA
AUL34030.1|3116819_3118580_-|protease	protease/lipase ABC transporter ATP-binding protein	protease	F2Y2R6	Organic_Lake_phycodnavirus	28.5	3.5e-14
AUL34031.1|3118576_3119878_-	hypothetical protein	NA	NA	NA	NA	NA
AUL34032.1|3120115_3120376_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL34033.1|3120414_3121236_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL34034.1|3127636_3129154_-	propionyl-CoA--succinate CoA transferase	NA	NA	NA	NA	NA
AUL34035.1|3130388_3132779_+	mechanosensitive ion channel protein	NA	NA	NA	NA	NA
AUL34036.1|3132780_3133551_-	hypothetical protein	NA	NA	NA	NA	NA
AUL34037.1|3133547_3134426_-	EamA family transporter	NA	NA	NA	NA	NA
AUL34038.1|3134609_3134900_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AUL34039.1|3134915_3135458_-	DNA polymerase III subunit epsilon	NA	A0A0A7RWA3	Clostridium_phage	29.7	7.2e-11
AUL34040.1|3135681_3138273_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
AUL34041.1|3140937_3141540_+	hypothetical protein	NA	NA	NA	NA	NA
AUL34663.1|3141788_3144494_+	aconitate hydratase 1	NA	NA	NA	NA	NA
AUL34042.1|3144559_3145342_-	dioxygenase	NA	NA	NA	NA	NA
AUL34043.1|3145503_3146709_+	hypothetical protein	NA	NA	NA	NA	NA
AUL34044.1|3146715_3147804_+	hypothetical protein	NA	NA	NA	NA	NA
AUL34045.1|3147961_3148519_+	elongation factor P	NA	NA	NA	NA	NA
AUL34046.1|3148600_3149035_-	hypothetical protein	NA	NA	NA	NA	NA
AUL34047.1|3149915_3151298_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUL34048.1|3151307_3151760_-	hypothetical protein	NA	NA	NA	NA	NA
AUL34049.1|3151778_3152279_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
>prophage 23
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	3352401	3417994	3698359	tRNA,transposase	Synechococcus_phage(12.5%)	60	NA	NA
AUL34220.1|3352401_3354537_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUL34221.1|3354533_3355073_+	D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AUL34222.1|3355076_3355805_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUL34223.1|3355791_3356625_+	hypothetical protein	NA	NA	NA	NA	NA
AUL34224.1|3356629_3357556_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL34673.1|3357634_3359050_+	FAD-binding dehydrogenase	NA	NA	NA	NA	NA
AUL34225.1|3359036_3360119_+	tricarballylate utilization protein B	NA	NA	NA	NA	NA
AUL34226.1|3360232_3360628_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
AUL34227.1|3360633_3361167_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.6	7.5e-13
AUL34228.1|3363557_3364787_+	hypothetical protein	NA	NA	NA	NA	NA
AUL34229.1|3364787_3366230_-	pyruvate kinase	NA	NA	NA	NA	NA
AUL34230.1|3366325_3367468_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.0	3.2e-37
AUL34231.1|3367486_3367966_+	thioesterase	NA	NA	NA	NA	NA
AUL34232.1|3367994_3368783_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase	NA	NA	NA	NA	NA
AUL34233.1|3368796_3370335_-	molecular chaperone SurA	NA	NA	NA	NA	NA
AUL34234.1|3370331_3372740_-	LPS biosynthesis protein	NA	NA	NA	NA	NA
AUL34235.1|3372893_3373961_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AUL34236.1|3373960_3374641_+	mannose-1-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AUL34237.1|3374782_3375508_+	hypothetical protein	NA	NA	NA	NA	NA
AUL34238.1|3375516_3375840_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
AUL34239.1|3375893_3376541_-	hypothetical protein	NA	NA	NA	NA	NA
AUL34240.1|3376676_3377090_+	hypothetical protein	NA	NA	NA	NA	NA
AUL34241.1|3377175_3378225_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AUL34242.1|3378370_3379321_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL34243.1|3379359_3380067_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL34244.1|3380034_3380856_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL34245.1|3380894_3381155_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL34246.1|3381212_3382721_-	sulfite reductase	NA	NA	NA	NA	NA
AUL34247.1|3382877_3384401_-	hypothetical protein	NA	NA	NA	NA	NA
AUL34248.1|3384455_3385103_-	carbonate dehydratase	NA	NA	NA	NA	NA
AUL34249.1|3385245_3385587_-	hypothetical protein	NA	NA	NA	NA	NA
AUL34250.1|3385744_3386077_+	PsiF repeat family protein	NA	NA	NA	NA	NA
AUL34251.1|3386125_3387166_-	cyclase	NA	NA	NA	NA	NA
AUL34252.1|3387169_3387949_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AUL34253.1|3387984_3388281_-	hypothetical protein	NA	NA	NA	NA	NA
AUL34254.1|3388295_3388571_-	muconolactone delta-isomerase	NA	NA	NA	NA	NA
AUL34255.1|3388638_3389283_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUL34256.1|3389285_3389375_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUL34257.1|3389565_3390351_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL34258.1|3390388_3391114_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL34259.1|3391127_3392468_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
AUL34260.1|3392562_3393495_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL34261.1|3393723_3396495_-	peptidase S8	NA	NA	NA	NA	NA
AUL34262.1|3396934_3399781_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AUL34263.1|3399927_3400641_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	41.4	1.6e-47
AUL34264.1|3400653_3401196_-	GNAT family N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	45.8	1.1e-27
AUL34265.1|3401301_3402210_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.7	4.4e-05
AUL34266.1|3402301_3404158_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AUL34267.1|3404341_3405382_-	GntR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.2	4.3e-20
AUL34268.1|3405524_3406430_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AUL34269.1|3408117_3409068_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL34270.1|3409124_3409892_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
AUL34271.1|3410009_3410654_+	hypothetical protein	NA	NA	NA	NA	NA
AUL34272.1|3410917_3411214_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AUL34273.1|3411360_3412431_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AUL34274.1|3412663_3412858_-	hypothetical protein	NA	NA	NA	NA	NA
AUL34275.1|3413127_3413982_+	hypothetical protein	NA	NA	NA	NA	NA
AUL34276.1|3414007_3415228_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL34674.1|3415458_3417261_+	autotransporter	NA	NA	NA	NA	NA
AUL34277.1|3417733_3417994_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
CP018894	Bordetella holmesii isolate F626 chromosome, complete genome	3698359	3611744	3660445	3698359	holin,tRNA,transposase	Catovirus(20.0%)	39	NA	NA
AUL34447.1|3611744_3613535_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.5	5.5e-07
AUL34448.1|3613576_3614212_-	hypothetical protein	NA	A0A2I7S9X1	Vibrio_phage	29.0	1.2e-12
AUL34449.1|3614214_3614529_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
AUL34450.1|3616079_3617702_-|holin	choline dehydrogenase	holin	A0A1V0S9J5	Catovirus	29.6	5.4e-46
AUL34451.1|3617872_3617977_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
AUL34452.1|3617969_3618680_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
AUL34453.1|3618954_3619443_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUL34454.1|3619584_3620784_+	2-aminoadipate aminotransferase	NA	NA	NA	NA	NA
AUL34455.1|3620859_3621783_+	4-hydroxybenzoate polyprenyltransferase	NA	NA	NA	NA	NA
AUL34456.1|3622117_3622498_+	hypothetical protein	NA	NA	NA	NA	NA
AUL34682.1|3622641_3623400_-	transcriptional regulator GlcC	NA	NA	NA	NA	NA
AUL34683.1|3623611_3625783_+	malate synthase G	NA	NA	NA	NA	NA
AUL34457.1|3625840_3626914_-	lipase	NA	G9BWD6	Planktothrix_phage	37.1	2.6e-28
AUL34458.1|3626906_3628676_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AUL34459.1|3628690_3629800_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL34460.1|3629915_3632405_-	signal protein	NA	NA	NA	NA	NA
AUL34461.1|3632391_3633063_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL34462.1|3633586_3634633_+	oxidoreductase	NA	NA	NA	NA	NA
AUL34463.1|3634641_3635211_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUL34464.1|3636308_3637391_+	UDP-N-acetylglucosamine 2-epimerase	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	33.2	1.1e-45
AUL34465.1|3637415_3638669_+	glycosyltransferase WbuB	NA	NA	NA	NA	NA
AUL34466.1|3638673_3639861_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	NA	NA	NA	NA
AUL34467.1|3639857_3640451_+	sugar transferase	NA	NA	NA	NA	NA
AUL34468.1|3640837_3642775_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	27.9	2.2e-25
AUL34469.1|3642908_3643859_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL34470.1|3643940_3644648_-	hypothetical protein	NA	NA	NA	NA	NA
AUL34471.1|3644711_3647348_+	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	26.3	8.0e-23
AUL34472.1|3647477_3648698_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.1e-181
AUL34473.1|3648776_3649832_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL34474.1|3649831_3650602_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL34475.1|3651169_3651970_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
AUL34476.1|3652058_3653486_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUL34477.1|3653580_3654081_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL34478.1|3654173_3654434_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL34684.1|3654499_3655198_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL34479.1|3657161_3657641_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL34480.1|3657628_3658555_-	bestrophin	NA	NA	NA	NA	NA
AUL34481.1|3658671_3659199_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
AUL34482.1|3659224_3660445_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
