The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	148265	195149	3699930	transposase,protease	uncultured_Mediterranean_phage(22.22%)	49	NA	NA
AUL28154.1|148265_148703_-|protease	ClpXP protease specificity-enhancing factor	protease	NA	NA	NA	NA
AUL28155.1|148711_149323_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUL28156.1|149475_150327_-	cytochrome c1	NA	NA	NA	NA	NA
AUL28157.1|150351_151740_-	cytochrome b	NA	NA	NA	NA	NA
AUL28158.1|151821_152463_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AUL28159.1|152611_153049_+	large-conductance mechanosensitive channel protein	NA	NA	NA	NA	NA
AUL28160.1|153106_153883_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AUL31187.1|153902_155033_+	2-alkenal reductase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	37.2	3.0e-11
AUL28161.1|155097_155883_-	twin arginine-targeting protein translocase TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	34.4	5.0e-29
AUL28162.1|155879_156377_-	twin arginine-targeting protein translocase TatB	NA	NA	NA	NA	NA
AUL28163.1|156425_156647_-	Sec-independent protein translocase TatA	NA	NA	NA	NA	NA
AUL28164.1|156662_157031_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
AUL28165.1|157038_157389_-	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
AUL28166.1|157385_157790_-	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
AUL28167.1|157791_158607_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
AUL28168.1|158603_159344_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
AUL28169.1|159410_160097_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
AUL28170.1|160115_160703_-	imidazoleglycerol-phosphate dehydratase	NA	NA	NA	NA	NA
AUL28171.1|160704_161799_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AUL28172.1|161795_163103_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
AUL28173.1|163128_163800_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
AUL28174.1|163796_165062_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUL28175.1|165061_165307_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
AUL28176.1|165310_166108_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AUL28177.1|166104_166914_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	2.8e-19
AUL28178.1|167050_167677_-	ABC transporter	NA	NA	NA	NA	NA
AUL28179.1|167702_168494_-	hypothetical protein	NA	NA	NA	NA	NA
AUL28180.1|168558_169047_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AUL28181.1|169059_169842_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL28182.1|169838_170675_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.7e-22
AUL28183.1|170856_171837_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL28184.1|171901_172537_-	hypothetical protein	NA	NA	NA	NA	NA
AUL28185.1|172737_174204_-	glutamate synthase	NA	NA	NA	NA	NA
AUL28186.1|174212_178952_-	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
AUL28187.1|179305_180526_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL28188.1|180641_181385_-	hypothetical protein	NA	NA	NA	NA	NA
AUL28189.1|181554_182661_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.1	1.4e-32
AUL28190.1|182671_183511_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AUL28191.1|183568_184258_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28192.1|184354_184807_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28193.1|184810_186031_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL28194.1|186254_187142_+	RNA polymerase factor sigma-32	NA	A0A248SJA5	Salicola_phage	38.5	2.1e-39
AUL28195.1|187456_188242_-	phosphodiesterase	NA	NA	NA	NA	NA
AUL28196.1|191084_191861_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AUL28197.1|192353_192614_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL28198.1|192652_193474_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL28199.1|193508_193778_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
AUL28200.1|193749_194100_+	bifunctional protein GlmU	NA	NA	NA	NA	NA
AUL28201.1|194198_195149_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	226939	263753	3699930	transposase	Leptospira_phage(40.0%)	32	NA	NA
AUL28224.1|226939_227200_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL28225.1|227292_227793_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL28226.1|228166_229387_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL28227.1|230041_231319_+	cytosine deaminase	NA	NA	NA	NA	NA
AUL28228.1|231373_231940_-	cysteine dioxygenase	NA	NA	NA	NA	NA
AUL28229.1|232025_233189_-	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUL28230.1|233357_233642_+	acylphosphatase	NA	NA	NA	NA	NA
AUL28231.1|233665_234304_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL28232.1|234425_235397_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL28233.1|236975_237746_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL28234.1|237957_238908_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL31196.1|238880_239384_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	49.7	3.4e-39
AUL28235.1|239460_240465_-	hypothetical protein	NA	NA	NA	NA	NA
AUL28236.1|240536_242105_-	acetolactate synthase large subunit	NA	G9E4W7	Ostreococcus_lucimarinus_virus	27.1	4.5e-05
AUL28237.1|242241_243291_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AUL28238.1|243293_244478_+	CoA transferase	NA	NA	NA	NA	NA
AUL28239.1|244506_245637_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL28240.1|245649_246792_+	carnitine dehydratase	NA	NA	NA	NA	NA
AUL28241.1|248601_249216_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL28242.1|249264_250167_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL28243.1|250293_250683_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUL28244.1|250684_251566_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
AUL28245.1|251594_252563_+	MFS transporter	NA	NA	NA	NA	NA
AUL28246.1|252771_253761_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL28247.1|255310_256090_+	oxidoreductase	NA	NA	NA	NA	NA
AUL28248.1|256120_257866_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AUL28249.1|257862_258765_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
AUL28250.1|259048_260257_+	ferredoxin reductase	NA	NA	NA	NA	NA
AUL28251.1|260438_260702_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28252.1|260707_261187_+	DUF188 domain-containing protein	NA	NA	NA	NA	NA
AUL28253.1|261247_262357_-	porin	NA	NA	NA	NA	NA
AUL28254.1|262532_263753_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 3
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	587472	656306	3699930	transposase,tRNA	Staphylococcus_phage(21.43%)	59	NA	NA
AUL28529.1|587472_588336_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL28530.1|588419_589547_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
AUL28531.1|589555_590971_-	metallopeptidase	NA	A8ATH6	Listeria_phage	42.7	6.7e-16
AUL28532.1|591250_592480_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
AUL28533.1|592518_593175_+	phospholipid-binding protein	NA	NA	NA	NA	NA
AUL28534.1|593378_594629_+	serine hydroxymethyltransferase	NA	A0A219YCZ0	Aeromonas_phage	52.2	2.8e-98
AUL28535.1|594789_595275_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AUL28536.1|595279_596242_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL28537.1|596241_596802_-	hydrolase	NA	NA	NA	NA	NA
AUL28538.1|596837_598112_+	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	31.9	1.5e-38
AUL28539.1|598133_598775_+	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	36.1	7.2e-26
AUL28540.1|601062_602325_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28541.1|602321_603842_+	SpoVR family protein	NA	NA	NA	NA	NA
AUL28542.1|603838_604675_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL28543.1|605912_606812_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL28544.1|607187_607844_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUL28545.1|608021_608429_-	alkylhydroperoxidase	NA	NA	NA	NA	NA
AUL28546.1|609743_610964_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL28547.1|610960_611431_+	MFS permease	NA	NA	NA	NA	NA
AUL28548.1|611440_611896_-	hypothetical protein	NA	NA	NA	NA	NA
AUL28549.1|612863_614432_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AUL28550.1|614654_615092_+	universal stress protein	NA	NA	NA	NA	NA
AUL28551.1|615103_615514_-	hypothetical protein	NA	NA	NA	NA	NA
AUL28552.1|615544_616318_-	NADH pyrophosphatase	NA	NA	NA	NA	NA
AUL28553.1|616545_618648_+	dehydrogenase	NA	NA	NA	NA	NA
AUL28554.1|619156_620005_+	two-component response regulator	NA	NA	NA	NA	NA
AUL28555.1|620024_620240_-	hypothetical protein	NA	NA	NA	NA	NA
AUL28556.1|620394_621291_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28557.1|621394_622285_+	nicotinate-nucleotide diphosphorylase (carboxylating)	NA	NA	NA	NA	NA
AUL28558.1|622361_623330_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL28559.1|623330_624041_-	hypothetical protein	NA	NA	NA	NA	NA
AUL28560.1|624116_626210_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL28561.1|626239_626548_-	hypothetical protein	NA	NA	NA	NA	NA
AUL28562.1|626734_627520_-	enoyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
AUL28563.1|627578_628991_-	lytic transglycosylase	NA	A0A223LD43	Bacillus_phage	29.3	2.1e-06
AUL28564.1|628998_629808_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AUL28565.1|629825_630590_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL28566.1|630658_631120_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	51.5	4.5e-38
AUL28567.1|631244_632327_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUL28568.1|632342_632540_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28569.1|632502_633723_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL28570.1|636732_637467_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	42.4	2.6e-40
AUL28571.1|637635_638856_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL28572.1|639230_640217_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AUL28573.1|640220_642944_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	6.6e-20
AUL28574.1|642944_644072_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28575.1|644084_645497_+	RND transporter	NA	NA	NA	NA	NA
AUL28576.1|645671_646328_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL28577.1|646348_647395_+	glycosyltransferase	NA	F1C5B0	Cronobacter_phage	39.5	1.4e-58
AUL28578.1|647391_648981_+	dolichyl-phosphate-mannose--protein mannosyltransferase	NA	NA	NA	NA	NA
AUL28579.1|649135_650245_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28580.1|650234_651131_-	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	33.1	6.5e-09
AUL28581.1|651177_651810_-	hypothetical protein	NA	NA	NA	NA	NA
AUL28582.1|651834_652719_-	EamA family transporter	NA	NA	NA	NA	NA
AUL28583.1|652846_654328_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL28584.1|654400_654745_+	TIGR01244 family protein	NA	NA	NA	NA	NA
AUL28585.1|654830_655295_+	universal stress protein	NA	NA	NA	NA	NA
AUL28586.1|655452_655713_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL28587.1|655805_656306_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	49.7	2.8e-41
>prophage 4
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	659614	724661	3699930	transposase,tRNA	Ralstonia_virus(42.86%)	58	NA	NA
AUL28590.1|659614_660565_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL28591.1|660597_661044_+|tRNA	cys-tRNA(pro)/cys-tRNA(cys) deacylase	tRNA	NA	NA	NA	NA
AUL28592.1|661092_661782_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
AUL28593.1|661869_662364_-	peptidoglycan-associated lipoprotein	NA	NA	NA	NA	NA
AUL28594.1|662395_663712_-	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
AUL28595.1|663728_664649_-	protein TolA	NA	NA	NA	NA	NA
AUL28596.1|664683_665145_-	protein TolR	NA	NA	NA	NA	NA
AUL28597.1|665144_665819_-	protein TolQ	NA	NA	NA	NA	NA
AUL28598.1|665821_666244_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUL28599.1|666297_668028_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	28.6	1.2e-11
AUL28600.1|668093_668663_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AUL28601.1|668643_669330_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL28602.1|669349_670855_+	sensor histidine kinase	NA	NA	NA	NA	NA
AUL28603.1|671083_671533_+	tripartite tricarboxylate transporter TctB	NA	NA	NA	NA	NA
AUL28604.1|671538_673059_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28605.1|673112_674333_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL28606.1|674429_675359_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL28607.1|675517_676423_-	oxidoreductase	NA	NA	NA	NA	NA
AUL28608.1|676622_677843_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL28609.1|677898_679404_-	hypothetical protein	NA	NA	NA	NA	NA
AUL28610.1|679425_679881_-	tricarboxylate transporter	NA	NA	NA	NA	NA
AUL28611.1|680237_680810_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28612.1|680809_681121_+	cell division protein ZapA	NA	NA	NA	NA	NA
AUL28613.1|681434_682196_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28614.1|682164_682959_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AUL28615.1|683137_683473_+	cytochrome C	NA	NA	NA	NA	NA
AUL28616.1|683489_684047_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AUL28617.1|684108_685221_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
AUL28618.1|685361_685838_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL28619.1|692179_692374_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28620.1|692501_692762_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL28621.1|692854_693355_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL28622.1|693592_693967_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28623.1|694184_694463_-	DNA topoisomerase III	NA	NA	NA	NA	NA
AUL28624.1|694611_695805_+	peptidase M20	NA	NA	NA	NA	NA
AUL28625.1|695817_696876_+	dihydroorotase	NA	NA	NA	NA	NA
AUL28626.1|696913_698722_-	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	29.5	2.5e-44
AUL28627.1|699496_699925_+	cell division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
AUL28628.1|699933_701007_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	NA	NA	NA	NA
AUL28629.1|701006_701294_+	cell division protein FtsL	NA	NA	NA	NA	NA
AUL28630.1|701290_703024_+	cell division protein	NA	NA	NA	NA	NA
AUL28631.1|703020_705843_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
AUL28632.1|705832_707002_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AUL28633.1|706998_708531_+	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	NA	NA	NA	NA
AUL28634.1|708527_709721_+	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
AUL28635.1|709717_710791_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AUL28636.1|710787_712194_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
AUL28637.1|712190_713144_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AUL28638.1|713152_713977_+	cell division protein FtsQ	NA	NA	NA	NA	NA
AUL28639.1|713981_715208_+	cell division protein FtsA	NA	NA	NA	NA	NA
AUL28640.1|715403_716588_+	cell division protein FtsZ	NA	NA	NA	NA	NA
AUL28641.1|716827_717751_+	UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
AUL28642.1|717841_718057_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28643.1|718093_718588_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
AUL28644.1|718630_719614_+	peptidase M23	NA	A0A292GJG6	Xanthomonas_phage	47.7	1.2e-27
AUL28645.1|719774_722510_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AUL28646.1|722511_723231_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28647.1|723440_724661_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 5
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	799275	854187	3699930	transposase,holin	Ralstonia_virus(16.67%)	53	NA	NA
AUL28710.1|799275_801375_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AUL28711.1|801516_802356_-	branched chain amino acid aminotransferase	NA	NA	NA	NA	NA
AUL28712.1|803485_804373_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL28713.1|804463_804610_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL28714.1|804673_805678_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL28715.1|806584_806845_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL28716.1|807119_807755_-	endonuclease III	NA	NA	NA	NA	NA
AUL28717.1|807775_808414_-	ferredoxin	NA	NA	NA	NA	NA
AUL28718.1|808464_809691_-	esterase	NA	NA	NA	NA	NA
AUL28719.1|809827_810625_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AUL28720.1|810655_810979_-	ferredoxin	NA	NA	NA	NA	NA
AUL28721.1|811143_812319_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	32.5	4.2e-48
AUL28722.1|812357_812711_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28723.1|812741_813161_-	hypothetical protein	NA	NA	NA	NA	NA
AUL28724.1|813253_814093_-	hypothetical protein	NA	NA	NA	NA	NA
AUL28725.1|814289_816536_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AUL28726.1|816555_817869_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	41.0	1.5e-83
AUL28727.1|818034_819186_+	acetylornithine deacetylase (ArgE)	NA	NA	NA	NA	NA
AUL28728.1|819326_820526_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AUL28729.1|820522_821386_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AUL28730.1|821415_822294_+	acetyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
AUL28731.1|822502_823048_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28732.1|823218_823479_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL28733.1|824427_827559_-	ribonuclease E/G	NA	NA	NA	NA	NA
AUL28734.1|828138_829044_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AUL28735.1|829045_829702_+	HAD family hydrolase	NA	NA	NA	NA	NA
AUL28736.1|829819_830779_+	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AUL28737.1|830791_831418_+	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AUL28738.1|831398_832181_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	32.4	5.0e-13
AUL31220.1|832184_832895_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL28739.1|832891_833485_-	septum formation protein Maf	NA	NA	NA	NA	NA
AUL28740.1|833702_834350_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28741.1|834402_834585_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
AUL28742.1|834643_835708_+	phosphate acyltransferase	NA	NA	NA	NA	NA
AUL28743.1|835707_836694_+	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
AUL28744.1|836753_837689_+	[acyl-carrier-protein] S-malonyltransferase	NA	NA	NA	NA	NA
AUL28745.1|837691_838441_+	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.0	2.7e-16
AUL28746.1|838658_838898_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	48.5	1.6e-10
AUL28747.1|839069_840299_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AUL28748.1|840301_840733_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28749.1|840729_841329_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	26.9	2.6e-06
AUL28750.1|841341_841827_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28751.1|841826_842861_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AUL28752.1|842901_844404_+	serine peptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.2	1.1e-21
AUL28753.1|844488_845709_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL28754.1|845895_846846_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL28755.1|846913_848707_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.5	1.4e-23
AUL28756.1|848730_849615_+	S26 family signal peptidase	NA	NA	NA	NA	NA
AUL28757.1|849620_850376_+	ribonuclease III	NA	M4QNJ2	Ostreococcus_lucimarinus_virus	33.5	1.5e-19
AUL28758.1|850372_851263_+	GTPase Era	NA	NA	NA	NA	NA
AUL28759.1|851255_851843_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AUL28760.1|851865_852957_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.9	2.1e-17
AUL28761.1|852966_854187_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 6
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	863881	918444	3699930	transposase	Ralstonia_virus(28.57%)	52	NA	NA
AUL28770.1|863881_865102_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
AUL28771.1|865269_865605_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28772.1|865800_866466_-	hypothetical protein	NA	A0A0A8WF62	Clostridium_phage	34.5	1.6e-15
AUL28773.1|866711_868601_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	30.7	2.4e-61
AUL28774.1|868597_869005_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28775.1|869088_870315_+	MFS transporter	NA	NA	NA	NA	NA
AUL28776.1|870464_872444_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	43.6	6.1e-84
AUL28777.1|872509_873730_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL28778.1|874757_875771_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AUL28779.1|875792_876626_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL28780.1|876675_878322_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
AUL28781.1|878454_878901_+	thioesterase	NA	NA	NA	NA	NA
AUL28782.1|879015_879714_+	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUL28783.1|879726_880380_+	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUL28784.1|880580_881465_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL28785.1|881461_882442_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
AUL28786.1|882479_884360_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.8	2.0e-20
AUL28787.1|884434_885988_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
AUL28788.1|886061_886982_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
AUL28789.1|886989_887883_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
AUL28790.1|887972_889040_+	aminopeptidase	NA	NA	NA	NA	NA
AUL28791.1|889050_889869_+	aminopeptidase	NA	NA	NA	NA	NA
AUL28792.1|889883_891680_+	Xaa-Pro aminopeptidase	NA	A0A0P0I8D7	Acinetobacter_phage	49.7	1.3e-165
AUL28793.1|891923_893576_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.5	1.7e-156
AUL28794.1|893747_893951_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28795.1|893925_894030_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28796.1|894033_895320_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	63.4	5.5e-150
AUL28797.1|895393_895765_+	cell division protein FtsB	NA	NA	NA	NA	NA
AUL28798.1|895783_896413_-	hypothetical protein	NA	NA	NA	NA	NA
AUL28799.1|896492_897413_-	Hsp33 family molecular chaperone	NA	NA	NA	NA	NA
AUL28800.1|897451_897973_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AUL28801.1|897995_899663_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	33.4	9.8e-67
AUL28802.1|899858_900698_-	UDP-2,3-diacylglucosamine hydrolase	NA	A0A218MKA7	uncultured_virus	48.1	1.9e-66
AUL28803.1|900779_901304_-	RDD family protein	NA	NA	NA	NA	NA
AUL28804.1|901626_902127_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL28805.1|902219_902480_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL28806.1|902523_903531_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.4e-147
AUL28807.1|903727_903913_-	hypothetical protein	NA	NA	NA	NA	NA
AUL28808.1|904145_905780_-	RNA methyltransferase	NA	NA	NA	NA	NA
AUL31221.1|905804_906227_-	hypothetical protein	NA	NA	NA	NA	NA
AUL28809.1|906286_907747_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AUL28810.1|907802_908993_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
AUL28811.1|909066_909960_-	methylisocitrate lyase	NA	NA	NA	NA	NA
AUL28812.1|910150_911140_-	malate dehydrogenase	NA	NA	NA	NA	NA
AUL28813.1|911473_912253_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL28814.1|912374_912788_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
AUL28815.1|912787_913171_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
AUL28816.1|913174_914953_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
AUL28817.1|914966_915683_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
AUL28818.1|915708_915969_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
AUL28819.1|915989_917291_+	citrate (Si)-synthase	NA	NA	NA	NA	NA
AUL28820.1|917439_918444_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
>prophage 7
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	928942	993310	3699930	transposase,tRNA	Ralstonia_virus(44.44%)	49	NA	NA
AUL28830.1|928942_930163_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
AUL28831.1|930293_932576_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
AUL28832.1|932749_935407_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AUL28833.1|935642_937688_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
AUL28834.1|938025_940896_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
AUL28835.1|940942_942133_+	dihydrolipoamide succinyltransferase	NA	NA	NA	NA	NA
AUL28836.1|942203_943631_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	1.6e-41
AUL28837.1|943708_944800_+	cell division protein ZapE	NA	NA	NA	NA	NA
AUL28838.1|944938_945460_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL28839.1|945456_946368_+	transmembrane sensor protein	NA	NA	NA	NA	NA
AUL28840.1|946461_948921_+	ligand-gated channel	NA	NA	NA	NA	NA
AUL28841.1|949153_949318_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28842.1|950928_951267_+	iron uptake protein	NA	NA	NA	NA	NA
AUL28843.1|951310_952633_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUL28844.1|952686_955074_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
AUL28845.1|955239_957288_+	helicase	NA	A0A127AW80	Bacillus_phage	28.0	3.2e-75
AUL28846.1|957353_958178_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AUL28847.1|958254_959214_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AUL28848.1|959201_959966_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28849.1|960091_961717_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
AUL28850.1|961766_962504_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL28851.1|962595_963156_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
AUL28852.1|963328_963868_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28853.1|963870_964203_+	periplasmic lipoprotein involved in iron transport	NA	NA	NA	NA	NA
AUL28854.1|964213_965059_+	FTR1 family iron permease	NA	NA	NA	NA	NA
AUL28855.1|965080_966460_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28856.1|966508_967420_+	phenazine biosynthesis protein PhzC/PhzF	NA	NA	NA	NA	NA
AUL28857.1|967586_967922_-	phospholipid-binding protein	NA	NA	NA	NA	NA
AUL28858.1|967971_969192_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL28859.1|969313_969478_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
AUL28860.1|969535_969736_-	general stress protein CsbD	NA	NA	NA	NA	NA
AUL28861.1|970040_970574_-	cytochrome B	NA	A0A0U2QLA7	Escherichia_phage	43.3	8.3e-12
AUL28862.1|976196_978473_+	ABC transporter	NA	W8CYL7	Bacillus_phage	31.3	6.6e-58
AUL28863.1|978469_978949_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28864.1|978945_980079_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL28865.1|980131_980935_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28866.1|980968_982177_+	lytic transglycosylase	NA	NA	NA	NA	NA
AUL28867.1|982258_982687_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28868.1|983019_984576_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
AUL28869.1|984612_984933_-	hypothetical protein	NA	NA	NA	NA	NA
AUL28870.1|985068_985800_+	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL28871.1|985858_986383_+	DedA family protein	NA	NA	NA	NA	NA
AUL28872.1|986434_987874_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL28873.1|988840_989170_+	regulator	NA	NA	NA	NA	NA
AUL28874.1|989166_989673_+	toxin	NA	NA	NA	NA	NA
AUL31222.1|989894_990827_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	76.8	1.9e-136
AUL28875.1|990896_991157_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL28876.1|991195_992017_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL28877.1|992089_993310_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	1095093	1127255	3699930	transposase,protease	Ralstonia_virus(33.33%)	33	NA	NA
AUL28960.1|1095093_1096314_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL28961.1|1096401_1096992_+	EamA family transporter	NA	NA	NA	NA	NA
AUL28962.1|1096979_1097291_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28963.1|1097342_1098332_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AUL28964.1|1098452_1099334_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
AUL28965.1|1099507_1100362_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28966.1|1100393_1101242_+	sulfurtransferase	NA	NA	NA	NA	NA
AUL28967.1|1101369_1102590_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
AUL28968.1|1102608_1103175_-	phosphohydrolase	NA	NA	NA	NA	NA
AUL28969.1|1103372_1104524_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUL28970.1|1104662_1105667_-	hypothetical protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
AUL28971.1|1105823_1106795_-	MFS transporter	NA	NA	NA	NA	NA
AUL28972.1|1106873_1107662_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL28973.1|1107733_1107970_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AUL28974.1|1107978_1108890_+	geranyl transferase	NA	NA	NA	NA	NA
AUL28975.1|1108933_1110805_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUL28976.1|1110965_1111763_+	GTP cyclohydrolase	NA	NA	NA	NA	NA
AUL28977.1|1111994_1112369_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
AUL28978.1|1112445_1112769_+	primosomal replication protein N	NA	NA	NA	NA	NA
AUL28979.1|1112852_1113125_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
AUL28980.1|1113139_1113595_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AUL28981.1|1113716_1114553_+	hypothetical protein	NA	NA	NA	NA	NA
AUL28982.1|1114549_1115923_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
AUL28983.1|1116237_1117188_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL28984.1|1118092_1119070_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
AUL28985.1|1119194_1120850_-	phosphate starvation-inducible protein PhoH	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
AUL28986.1|1120898_1121363_-	peroxiredoxin	NA	NA	NA	NA	NA
AUL28987.1|1121359_1121821_-	hypothetical protein	NA	NA	NA	NA	NA
AUL28988.1|1122046_1123234_+	alanine transaminase	NA	NA	NA	NA	NA
AUL28989.1|1123230_1124535_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
AUL28990.1|1124531_1125941_+	threonine synthase	NA	NA	NA	NA	NA
AUL28991.1|1126134_1126395_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL28992.1|1126433_1127255_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
>prophage 9
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	1132907	1193689	3699930	transposase,protease,tRNA	Leptospira_phage(23.53%)	53	NA	NA
AUL28997.1|1132907_1134368_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AUL28998.1|1134630_1135704_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
AUL28999.1|1135788_1137009_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL29000.1|1138766_1139588_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL29001.1|1139626_1139887_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL31230.1|1139914_1141360_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AUL29002.1|1141373_1142477_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
AUL29003.1|1142481_1143732_+	glycolate oxidase iron-sulfur subunit	NA	NA	NA	NA	NA
AUL29004.1|1143728_1145174_-	NAD synthetase	NA	NA	NA	NA	NA
AUL29005.1|1145170_1145485_-	NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AUL29006.1|1146786_1148007_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
AUL29007.1|1148106_1148973_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
AUL29008.1|1149033_1150014_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL29009.1|1150160_1151081_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
AUL29010.1|1151089_1152202_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUL29011.1|1152283_1153105_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29012.1|1153180_1153789_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUL31231.1|1153926_1155303_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
AUL29013.1|1155364_1155808_+	cytochrome C	NA	NA	NA	NA	NA
AUL31232.1|1155874_1156546_-	cytochrome B	NA	NA	NA	NA	NA
AUL29014.1|1156573_1156834_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL29015.1|1156872_1157694_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL29016.1|1157862_1158144_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29017.1|1158854_1159643_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29018.1|1159639_1160746_+	AI-2E family transporter	NA	NA	NA	NA	NA
AUL29019.1|1161420_1162779_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
AUL29020.1|1162893_1163091_-	gas vesicle protein	NA	NA	NA	NA	NA
AUL29021.1|1163108_1163930_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL29022.1|1163968_1164229_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL29023.1|1164322_1164877_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
AUL31233.1|1165464_1166781_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29024.1|1166793_1167807_-	dimethylhistidine N-methyltransferase	NA	NA	NA	NA	NA
AUL31234.1|1169384_1169684_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29025.1|1171044_1172703_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
AUL29026.1|1172851_1174072_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29027.1|1174189_1175473_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
AUL29028.1|1175476_1176418_-	transporter	NA	NA	NA	NA	NA
AUL29029.1|1176527_1176986_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL31235.1|1177366_1177987_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AUL29030.1|1178394_1180815_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
AUL29031.1|1180922_1181660_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AUL29032.1|1181706_1182951_+	hypothetical protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
AUL29033.1|1183273_1183546_+	DNA-binding protein HU	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
AUL29034.1|1184129_1184858_+	energy transducer TonB	NA	NA	NA	NA	NA
AUL29035.1|1184879_1185797_+	flagellar motor protein MotA	NA	NA	NA	NA	NA
AUL29036.1|1185796_1186306_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUL29037.1|1186422_1187094_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL29038.1|1187203_1188271_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
AUL29039.1|1188254_1190135_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	3.5e-65
AUL29040.1|1190271_1191459_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29041.1|1191759_1192545_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29042.1|1192568_1192829_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL29043.1|1192867_1193689_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
>prophage 10
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	1201716	1319849	3699930	transposase,protease,holin,tRNA	Ralstonia_virus(21.43%)	114	NA	NA
AUL29051.1|1201716_1202937_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL29052.1|1203012_1203294_+	malate dehydrogenase	NA	NA	NA	NA	NA
AUL29053.1|1205125_1206121_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL29054.1|1206163_1206934_+	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
AUL29055.1|1207059_1207323_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUL29056.1|1207524_1207671_-	transmembrane sensor protein	NA	NA	NA	NA	NA
AUL29057.1|1207724_1208675_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL29058.1|1208756_1209236_-	transmembrane sensor protein	NA	NA	NA	NA	NA
AUL29059.1|1209267_1210089_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL29060.1|1210127_1210388_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL29061.1|1210445_1211645_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
AUL29062.1|1211790_1212168_-	cytochrome c family protein	NA	NA	NA	NA	NA
AUL29063.1|1212191_1213973_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
AUL29064.1|1213981_1214719_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29065.1|1215003_1216563_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
AUL29066.1|1216622_1217381_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL29067.1|1217477_1218134_-	adenylate kinase	NA	NA	NA	NA	NA
AUL29068.1|1218287_1219052_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AUL29069.1|1219066_1219246_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29070.1|1219271_1220306_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AUL29071.1|1220302_1220716_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUL29072.1|1220712_1221297_-	flagellar motor protein MotA	NA	NA	NA	NA	NA
AUL29073.1|1221649_1223008_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
AUL29074.1|1223101_1223680_+	superoxide dismutase	NA	NA	NA	NA	NA
AUL29075.1|1223804_1224626_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL29076.1|1224664_1224925_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL31237.1|1224952_1226254_+	chloride channel protein-related protein	NA	NA	NA	NA	NA
AUL29077.1|1226357_1227563_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AUL29078.1|1227626_1228076_-	hypothetical protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
AUL29079.1|1228208_1228454_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
AUL29080.1|1228678_1228993_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
AUL29081.1|1229084_1229369_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29082.1|1229636_1234199_+	alpha-2-macroglobulin	NA	NA	NA	NA	NA
AUL29083.1|1234246_1236352_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
AUL29084.1|1236405_1238715_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
AUL29085.1|1240068_1241736_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AUL29086.1|1241738_1242404_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29087.1|1242536_1246343_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL29088.1|1246568_1247714_+	branched chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL29089.1|1247832_1248762_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL29090.1|1248758_1249835_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL29091.1|1249831_1250638_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
AUL29092.1|1250634_1251366_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
AUL29093.1|1251569_1251752_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29094.1|1251742_1252981_-	ammonia channel protein	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
AUL29095.1|1253028_1253367_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL29096.1|1253614_1254565_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL29097.1|1254883_1255066_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29098.1|1255131_1256352_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL29099.1|1256445_1257666_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL29100.1|1257725_1257989_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29101.1|1258110_1259610_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AUL29102.1|1260030_1260228_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AUL29103.1|1260243_1260603_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AUL29104.1|1260675_1261698_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
AUL29105.1|1261710_1264128_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUL31238.1|1264145_1264487_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	43.3	1.3e-13
AUL29106.1|1264544_1264943_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL29107.1|1265165_1265732_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29108.1|1265762_1266491_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29109.1|1266872_1267127_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29110.1|1267413_1268157_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL29111.1|1268184_1269174_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUL29112.1|1269204_1270209_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL29113.1|1270241_1270577_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29114.1|1270573_1270771_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29115.1|1272089_1272299_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	57.1	8.6e-13
AUL29116.1|1272694_1273441_+	endonuclease	NA	H6X497	Enterobacteria_phage	31.2	7.3e-22
AUL29117.1|1273475_1275437_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	29.9	2.3e-27
AUL29118.1|1275565_1275814_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29119.1|1275943_1276222_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29120.1|1276315_1276768_+	hypothetical protein	NA	G1JW61	Mycobacterium_phage	36.3	8.9e-07
AUL29121.1|1276764_1277235_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUL29122.1|1277526_1278120_+	twin-arginine translocation pathway signal	NA	NA	NA	NA	NA
AUL29123.1|1278167_1278452_+	CsbD family protein	NA	NA	NA	NA	NA
AUL29124.1|1278508_1278691_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29125.1|1278842_1279046_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29126.1|1279140_1279383_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29127.1|1279530_1279743_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29128.1|1279870_1280953_+	N-acylglucosamine 2-epimerase	NA	NA	NA	NA	NA
AUL29129.1|1281043_1281259_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29130.1|1281265_1281631_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUL29131.1|1281684_1283484_-	metal ABC transporter permease	NA	W8CYL7	Bacillus_phage	28.4	8.7e-45
AUL29132.1|1283633_1284008_+	2,5-diketo-D-gluconic acid reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.5e-20
AUL29133.1|1284031_1284292_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL29134.1|1284330_1285152_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AUL29135.1|1285635_1286622_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUL29136.1|1286668_1286875_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29137.1|1286871_1288047_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29138.1|1288224_1288878_+	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	47.7	6.3e-54
AUL29139.1|1288872_1291395_-	penicillin-binding protein	NA	NA	NA	NA	NA
AUL29140.1|1291566_1293483_-	S9 family peptidase	NA	NA	NA	NA	NA
AUL29141.1|1293615_1294062_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29142.1|1294090_1294519_-	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
AUL29143.1|1295146_1296367_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
AUL29144.1|1297101_1297563_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	44.1	2.0e-17
AUL29145.1|1297701_1298928_+	nitric oxide dioxygenase	NA	NA	NA	NA	NA
AUL29146.1|1298949_1299387_+	BadM/Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AUL29147.1|1299509_1300757_+	D-amino acid dehydrogenase small subunit	NA	NA	NA	NA	NA
AUL29148.1|1300764_1301598_-	class III aminotransferase	NA	NA	NA	NA	NA
AUL29149.1|1301594_1302122_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL29150.1|1302211_1303432_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL29151.1|1303439_1305104_-	long-chain-fatty-acid--CoA ligase	NA	Q75ZG1	Hepacivirus	27.3	2.0e-40
AUL29152.1|1305111_1305621_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29153.1|1305617_1306232_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
AUL29154.1|1306232_1307426_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUL29155.1|1307435_1309820_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL29156.1|1309879_1311172_-	fatty acid transporter	NA	NA	NA	NA	NA
AUL29157.1|1311193_1313152_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUL29158.1|1313148_1314441_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUL29159.1|1314451_1316782_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL29160.1|1316807_1317476_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL29161.1|1317855_1318800_+	serine acetyltransferase	NA	NA	NA	NA	NA
AUL29162.1|1318898_1319849_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 11
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	1554697	1611831	3699930	transposase,tRNA	Leptospira_phage(15.79%)	45	NA	NA
AUL29371.1|1554697_1555186_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AUL29372.1|1555300_1556416_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
AUL29373.1|1557048_1558212_+	MFS transporter	NA	NA	NA	NA	NA
AUL29374.1|1558394_1561052_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29375.1|1561055_1564445_+	nuclease	NA	NA	NA	NA	NA
AUL29376.1|1564835_1566905_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.7	8.2e-47
AUL29377.1|1566943_1567270_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AUL29378.1|1567284_1567893_+	recombination protein RecR	NA	NA	NA	NA	NA
AUL29379.1|1569333_1570374_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL29380.1|1570366_1571176_+	mannosyltransferase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.5	1.1e-12
AUL29381.1|1571181_1571976_+	ABC transporter permease	NA	NA	NA	NA	NA
AUL31253.1|1572039_1572996_-	transaldolase	NA	M4SPL0	Cyanophage	30.7	3.6e-13
AUL29382.1|1573219_1574374_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.1	2.6e-50
AUL29383.1|1574384_1577624_+	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
AUL29384.1|1577688_1578585_+	aspartyl beta-hydroxylase	NA	H8ZJK8	Ostreococcus_tauri_virus	38.3	2.2e-36
AUL29385.1|1578652_1579414_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL29386.1|1579419_1580058_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AUL29387.1|1580050_1580959_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL29388.1|1582064_1583756_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL29389.1|1583823_1585146_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL29390.1|1585243_1585519_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29391.1|1585654_1586971_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	68.0	2.9e-154
AUL29392.1|1587171_1587600_+	transcriptional regulator	NA	A0A1X9I5R1	Streptococcus_phage	30.3	4.2e-06
AUL29393.1|1587665_1588886_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL29394.1|1589240_1589717_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AUL29395.1|1589975_1590584_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29396.1|1590602_1591274_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AUL29397.1|1591447_1593334_+	cell division protein FtsH	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
AUL29398.1|1593361_1594204_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
AUL29399.1|1594200_1595544_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
AUL29400.1|1595728_1596544_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL29401.1|1596609_1598091_-	exopolyphosphatase	NA	NA	NA	NA	NA
AUL29402.1|1598289_1600362_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
AUL29403.1|1600581_1601619_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
AUL29404.1|1601740_1603663_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29405.1|1603690_1604467_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
AUL29406.1|1605294_1605804_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29407.1|1606045_1606750_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	36.5	1.9e-27
AUL29408.1|1606881_1607652_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL31254.1|1607648_1608659_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL31255.1|1608717_1608978_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL31256.1|1609010_1609799_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.5	1.4e-44
AUL29409.1|1609966_1610227_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL29410.1|1610265_1611087_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AUL29411.1|1611141_1611831_+	hypothetical protein	NA	A0A1B0VBP7	Salmonella_phage	47.1	1.3e-49
>prophage 12
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	1629089	1676088	3699930	transposase,tRNA	Ralstonia_virus(20.0%)	47	NA	NA
AUL29429.1|1629089_1630310_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL29430.1|1630568_1631174_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29431.1|1631184_1632345_+	succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
AUL29432.1|1632366_1633248_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
AUL29433.1|1633544_1634243_+	hypothetical protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
AUL29434.1|1634384_1635107_+	hypothetical protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
AUL29435.1|1635225_1636164_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AUL29436.1|1636194_1636974_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AUL29437.1|1636960_1638184_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
AUL29438.1|1638188_1639736_+	protoheme IX synthesis protein	NA	NA	NA	NA	NA
AUL29439.1|1639771_1640305_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
AUL31258.1|1640548_1641244_+	5-carboxymethyl-2-hydroxymuconate isomerase	NA	NA	NA	NA	NA
AUL29440.1|1641258_1641390_+	entericidin	NA	NA	NA	NA	NA
AUL29441.1|1641437_1642562_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL29442.1|1642567_1644907_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
AUL29443.1|1644903_1645311_-	heat-shock protein Hsp20	NA	NA	NA	NA	NA
AUL29444.1|1645572_1645833_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29445.1|1646055_1647006_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL29446.1|1647055_1648264_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL29447.1|1648485_1649025_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL29448.1|1649249_1649654_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL29449.1|1649718_1650474_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
AUL29450.1|1650473_1651835_+	secretion protein	NA	NA	NA	NA	NA
AUL29451.1|1651831_1652455_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL29452.1|1652498_1652759_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL29453.1|1652797_1653619_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL29454.1|1653569_1654274_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL29455.1|1654270_1655026_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL31259.1|1655202_1655997_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL29456.1|1655993_1656431_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29457.1|1657115_1658084_-	homoserine kinase	NA	NA	NA	NA	NA
AUL29458.1|1658240_1659248_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AUL29459.1|1659305_1659764_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29460.1|1659837_1661184_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29461.1|1661201_1661573_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29462.1|1661572_1663042_+	hypothetical protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
AUL29463.1|1663197_1663923_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29464.1|1663936_1666651_-	histidine kinase	NA	NA	NA	NA	NA
AUL29465.1|1666902_1668267_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUL29466.1|1668306_1669365_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
AUL29467.1|1669392_1670211_+	peptidase M48	NA	NA	NA	NA	NA
AUL29468.1|1670248_1670527_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AUL29469.1|1671472_1671733_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL29470.1|1671790_1672090_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AUL29471.1|1672659_1674063_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AUL29472.1|1674075_1674726_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AUL29473.1|1674867_1676088_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 13
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	1680290	1800151	3699930	integrase,transposase,holin,tRNA	Leptospira_phage(16.67%)	116	1717705:1717764	1795184:1795522
AUL29477.1|1680290_1681106_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AUL31260.1|1681153_1682191_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL29478.1|1682242_1682902_+	N-(5'-phosphoribosyl)anthranilate isomerase	NA	NA	NA	NA	NA
AUL29479.1|1683541_1684417_-|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL29480.1|1684413_1684704_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL29481.1|1685468_1685729_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL29482.1|1686127_1686817_+	permease	NA	NA	NA	NA	NA
AUL29483.1|1686916_1687078_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29484.1|1687519_1687756_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29485.1|1687945_1688194_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29486.1|1688307_1689678_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AUL29487.1|1689678_1690419_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL29488.1|1690905_1692858_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
AUL29489.1|1692878_1693427_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.3	3.8e-12
AUL29490.1|1693592_1694549_+	glutathione synthase	NA	NA	NA	NA	NA
AUL31261.1|1694562_1694961_+	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
AUL31262.1|1695023_1695293_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AUL29491.1|1695321_1697097_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AUL29492.1|1697144_1697354_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29493.1|1697400_1697823_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AUL29494.1|1697942_1698920_+	ornithine cyclodeaminase	NA	NA	NA	NA	NA
AUL29495.1|1698988_1700152_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL29496.1|1700320_1701208_+	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
AUL29497.1|1701218_1701860_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
AUL29498.1|1701856_1702528_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
AUL29499.1|1702527_1703298_+	ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA	NA	G9BWD6	Planktothrix_phage	35.8	2.0e-27
AUL29500.1|1703348_1703798_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	Q2NP83	Xanthomonas_phage	62.8	2.3e-47
AUL29501.1|1703839_1704298_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29502.1|1704318_1704951_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29503.1|1705060_1705528_+	hydrolase	NA	NA	NA	NA	NA
AUL29504.1|1705549_1706092_+	hydrolase	NA	NA	NA	NA	NA
AUL29505.1|1706104_1706809_+	dipeptidase E	NA	NA	NA	NA	NA
AUL29506.1|1706827_1707298_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL29507.1|1707390_1708131_+	permease	NA	NA	NA	NA	NA
AUL29508.1|1708174_1708435_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL29509.1|1709310_1710522_-	phosphopantothenate synthase	NA	Q9HH70	Methanothermobacter_phage	30.4	2.2e-36
AUL29510.1|1710582_1711098_-	signal peptidase II	NA	NA	NA	NA	NA
AUL29511.1|1711100_1713962_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
AUL31263.1|1713951_1714917_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
AUL29512.1|1715673_1717149_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AUL29513.1|1717153_1717429_-	hypothetical protein	NA	NA	NA	NA	NA
1717705:1717764	attL	GTGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGC	NA	NA	NA	NA
AUL29514.1|1717765_1718026_+|transposase	transposase	transposase	NA	NA	NA	NA
1717705:1717764	attL	GTGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGC	NA	NA	NA	NA
AUL29515.1|1718064_1718886_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AUL29516.1|1719186_1720395_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
AUL29517.1|1720391_1722674_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
AUL29518.1|1722684_1725066_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL29519.1|1725329_1727237_-	ABC transporter	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
AUL29520.1|1727251_1728142_-	ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUL29521.1|1728148_1729282_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AUL29522.1|1729281_1730103_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AUL29523.1|1730127_1731318_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
AUL29524.1|1731619_1731901_+|integrase	integrase	integrase	NA	NA	NA	NA
AUL29525.1|1732066_1732387_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29526.1|1732426_1732693_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL31264.1|1732725_1733514_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.5	1.4e-44
AUL29527.1|1733709_1733970_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29528.1|1734048_1734309_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL29529.1|1734462_1735233_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
1733988:1734384	attR	GTGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGCAATGAAGAAACGATTTACGGAAGAGCAAATCATCGGCGTGCTCAAGGAAGCCGATGCAGGTGCCAAGCCCGCAGAGTTGTGCCGCAAGCACGGAATCTCCGAGGCAACGTACTACAACTGGAAGGCGAAGTTCGGTGGCATGACGGTGTCGGACGCTCAGAGGCTCAAGGAGCTGGAGCAGGAGAACAACAAGCTCAAGAAGCTGTTGGCCGAGTCGATGCTGGACAAGGCGGCGCTTCAGGATCTGCTAAGCCGAAAGTAGTCAGCCCGCAGGCCAAACGCGAGGCGGTCAGGACATTAATGACCGAGCGCAGCATGGGTGTTACCCGGGCCTGTG	NA	NA	NA	NA
AUL31265.1|1735229_1736240_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
1733988:1734384	attR	GTGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGCAATGAAGAAACGATTTACGGAAGAGCAAATCATCGGCGTGCTCAAGGAAGCCGATGCAGGTGCCAAGCCCGCAGAGTTGTGCCGCAAGCACGGAATCTCCGAGGCAACGTACTACAACTGGAAGGCGAAGTTCGGTGGCATGACGGTGTCGGACGCTCAGAGGCTCAAGGAGCTGGAGCAGGAGAACAACAAGCTCAAGAAGCTGTTGGCCGAGTCGATGCTGGACAAGGCGGCGCTTCAGGATCTGCTAAGCCGAAAGTAGTCAGCCCGCAGGCCAAACGCGAGGCGGTCAGGACATTAATGACCGAGCGCAGCATGGGTGTTACCCGGGCCTGTG	NA	NA	NA	NA
AUL31266.1|1736298_1737117_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.2e-54
AUL29530.1|1737579_1738365_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
AUL29531.1|1739224_1739485_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL29532.1|1739523_1740345_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL29533.1|1741410_1742415_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
AUL29534.1|1742490_1743303_+	nucleotide pyrophosphatase	NA	NA	NA	NA	NA
AUL29535.1|1743530_1745702_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AUL29536.1|1745755_1747075_-	MFS transporter	NA	NA	NA	NA	NA
AUL29537.1|1747163_1748384_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL29538.1|1748602_1749463_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL29539.1|1749459_1750683_-	MFS transporter	NA	NA	NA	NA	NA
AUL29540.1|1750981_1751479_+	osmotically inducible protein Y	NA	NA	NA	NA	NA
AUL29541.1|1751517_1752300_-	hydrolase	NA	NA	NA	NA	NA
AUL29542.1|1752325_1752544_-	SlyX protein	NA	NA	NA	NA	NA
AUL29543.1|1752618_1752888_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29544.1|1753107_1753572_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL29545.1|1753645_1753927_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUL31267.1|1754043_1755027_-|integrase	integrase	integrase	NA	NA	NA	NA
AUL29546.1|1755270_1756269_+	cointegrate resolution protein	NA	NA	NA	NA	NA
AUL29547.1|1756371_1756803_+	energy transducer TonB	NA	NA	NA	NA	NA
AUL29548.1|1756867_1757779_+	3-phosphoglycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	30.7	3.7e-20
AUL29549.1|1757911_1759993_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AUL29550.1|1760031_1760736_-	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AUL29551.1|1760828_1761713_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL29552.1|1761788_1762190_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29553.1|1762280_1762427_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
AUL29554.1|1762688_1763624_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL29555.1|1763705_1764359_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL29556.1|1764975_1765452_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL29557.1|1765476_1766271_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL29558.1|1766287_1767268_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL29559.1|1767440_1767653_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29560.1|1768066_1769842_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	3.5e-38
AUL29561.1|1769857_1771522_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
AUL29562.1|1771534_1774246_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AUL31268.1|1774791_1776546_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
AUL29563.1|1776542_1777169_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL29564.1|1777165_1778020_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.8	1.4e-29
AUL29565.1|1778139_1780194_+	oligopeptidase A	NA	NA	NA	NA	NA
AUL29566.1|1780303_1781254_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL29567.1|1781250_1781766_-	methyltransferase	NA	NA	NA	NA	NA
AUL29568.1|1782123_1782744_+	SCO family protein	NA	NA	NA	NA	NA
AUL29569.1|1782843_1783095_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29570.1|1783182_1784661_-	multidrug transporter	NA	NA	NA	NA	NA
AUL29571.1|1784657_1787828_-	multidrug efflux RND transporter permease	NA	NA	NA	NA	NA
AUL29572.1|1787840_1789037_-	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUL29573.1|1789225_1790158_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL29574.1|1790225_1790957_-	pseudouridylate synthase	NA	NA	NA	NA	NA
AUL29575.1|1791022_1791658_+	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AUL29576.1|1791643_1792822_-	arabinose transporter	NA	NA	NA	NA	NA
AUL29577.1|1792982_1793531_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29578.1|1793611_1793971_+	lysine transporter LysE	NA	NA	NA	NA	NA
AUL29579.1|1794018_1795239_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL29580.1|1795314_1796436_-	transporter	NA	NA	NA	NA	NA
AUL29581.1|1796473_1797187_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
AUL29582.1|1797197_1798418_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
AUL29583.1|1799200_1800151_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 14
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	1963347	2019957	3699930	integrase,transposase	Leptospira_phage(22.22%)	46	1958031:1958046	1988192:1988207
1958031:1958046	attL	GGCTGTTGCCGGCAAG	NA	NA	NA	NA
AUL29730.1|1963347_1963608_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL29731.1|1963631_1963826_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29732.1|1963825_1966033_-	outer membrane receptor protein	NA	NA	NA	NA	NA
AUL29733.1|1966305_1967103_+	enterobactin-dependent positive regulator	NA	NA	NA	NA	NA
AUL29734.1|1967148_1968204_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUL29735.1|1968238_1968433_-|integrase	integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	52.8	1.1e-06
AUL29736.1|1968429_1969371_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AUL29737.1|1969873_1970758_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29738.1|1971182_1973411_+	isocitrate dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AUL29739.1|1973695_1974160_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29740.1|1974166_1975684_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29741.1|1975732_1976485_-	polar amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	4.3e-30
AUL29742.1|1976492_1977146_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL29743.1|1977182_1977971_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL29744.1|1978088_1978670_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AUL29745.1|1978952_1979336_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29746.1|1979920_1980250_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29747.1|1981429_1982158_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.1	1.8e-09
AUL31279.1|1982154_1982919_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.3e-18
AUL29748.1|1982918_1984802_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL29749.1|1984814_1986020_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL29750.1|1987736_1988471_-	hypothetical protein	NA	NA	NA	NA	NA
1988192:1988207	attR	GGCTGTTGCCGGCAAG	NA	NA	NA	NA
AUL29751.1|1988647_1989439_+	hydratase	NA	NA	NA	NA	NA
AUL29752.1|1989461_1991006_-	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	42.9	8.8e-38
AUL29753.1|1991750_1992950_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AUL29754.1|1993386_1994010_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL29755.1|1994015_1997672_+	virulence sensor protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.0	6.5e-39
AUL29756.1|1999860_2001558_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29757.1|2001942_2002203_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL29758.1|2002241_2003063_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL29759.1|2003095_2003410_+	glutamate decarboxylase	NA	NA	NA	NA	NA
AUL29760.1|2003499_2005200_+	transporter	NA	NA	NA	NA	NA
AUL29761.1|2005279_2005657_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29762.1|2005793_2006519_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL29763.1|2006651_2007638_+	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL29764.1|2007640_2008114_+	TRAP transporter small permease protein	NA	NA	NA	NA	NA
AUL29765.1|2008118_2009402_+	C4-dicarboxylate ABC transporter permease	NA	NA	NA	NA	NA
AUL29766.1|2009398_2010289_+	CoA ester lyase	NA	NA	NA	NA	NA
AUL29767.1|2010285_2011983_+	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.7	4.0e-31
AUL29768.1|2013307_2014807_+	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
AUL29769.1|2014879_2015398_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29770.1|2015471_2016362_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AUL29771.1|2016419_2017673_+	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUL29772.1|2017707_2018472_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL29773.1|2018836_2019658_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AUL29774.1|2019696_2019957_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 15
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	2060217	2130013	3699930	transposase	Ralstonia_virus(17.65%)	54	NA	NA
AUL29807.1|2060217_2061438_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	2.7e-183
AUL31283.1|2061495_2062272_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AUL29808.1|2062574_2063621_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL29809.1|2063722_2065384_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AUL29810.1|2065388_2066165_+	ABC transporter	NA	G3M9Y6	Bacillus_virus	34.2	5.1e-26
AUL29811.1|2066178_2067084_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29812.1|2068145_2068970_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL29813.1|2069098_2070601_-	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
AUL29814.1|2070600_2071665_-	PAS domain-containing sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.6	2.5e-07
AUL29815.1|2071758_2073171_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
AUL29816.1|2073352_2074576_-	YggW family oxidoreductase	NA	NA	NA	NA	NA
AUL29817.1|2074581_2075205_-	non-canonical purine NTP pyrophosphatase, RdgB/HAM1 family	NA	NA	NA	NA	NA
AUL29818.1|2075394_2077185_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUL29819.1|2077104_2078766_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.7	2.1e-13
AUL29820.1|2078875_2079826_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL29821.1|2079968_2081189_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	2.7e-183
AUL29822.1|2081204_2082119_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL29823.1|2082246_2083407_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL29824.1|2083412_2084771_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AUL29825.1|2084784_2085189_-	preprotein translocase subunit TatC	NA	NA	NA	NA	NA
AUL29826.1|2085276_2086029_-	ribonuclease PH	NA	NA	NA	NA	NA
AUL29827.1|2086146_2087079_+	YicC family protein	NA	NA	NA	NA	NA
AUL29828.1|2087161_2088469_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
AUL29829.1|2088540_2090031_-	AMP nucleosidase	NA	NA	NA	NA	NA
AUL29830.1|2090282_2090867_+	NlpC/P60 family protein 2	NA	A0A0A8WF62	Clostridium_phage	42.3	2.0e-22
AUL29831.1|2090903_2091674_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL29832.1|2091847_2092480_+	guanylate kinase	NA	A0A223FN12	Murmansk_poxvirus	34.0	7.8e-17
AUL29833.1|2092523_2092727_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AUL29834.1|2092750_2095048_+	guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	32.8	2.0e-06
AUL29835.1|2095150_2095879_-	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	9.6e-35
AUL29836.1|2095875_2096535_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AUL29837.1|2096617_2097370_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
AUL29838.1|2097784_2098597_+	peptidase C45	NA	NA	NA	NA	NA
AUL31284.1|2098593_2100273_-	filamentous hemagglutinin	NA	NA	NA	NA	NA
AUL29839.1|2100349_2101390_-	adhesin	NA	NA	NA	NA	NA
AUL29840.1|2101457_2103986_-	outer membrane fimbrial usher protein	NA	NA	NA	NA	NA
AUL29841.1|2104000_2104795_-	molecular chaperone	NA	NA	NA	NA	NA
AUL31285.1|2104903_2105347_-	fimbrial protein	NA	NA	NA	NA	NA
AUL29842.1|2105306_2106479_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.3	1.6e-148
AUL29843.1|2106616_2115274_-	adhesin	NA	A0A0R6PJK4	Moraxella_phage	28.8	8.0e-19
AUL29844.1|2115755_2116706_+	EamA family transporter	NA	NA	NA	NA	NA
AUL29845.1|2116702_2117383_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	40.3	5.8e-34
AUL29846.1|2117417_2118041_+	arylesterase	NA	NA	NA	NA	NA
AUL29847.1|2118022_2119978_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUL29848.1|2120249_2120999_+	glycerophosphodiester phosphodiesterase	NA	A0A1J0F961	Only_Syngen_Nebraska_virus	27.5	6.2e-13
AUL29849.1|2121010_2121883_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
AUL29850.1|2121893_2123306_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
AUL29851.1|2123415_2124144_-	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	56.0	7.3e-43
AUL29852.1|2124280_2124481_-	heavy metal transporter	NA	NA	NA	NA	NA
AUL29853.1|2124632_2126906_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.2	4.1e-92
AUL29854.1|2126902_2127298_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUL29855.1|2127294_2128821_-	23S rRNA (uracil(1939)-C(5))-methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	25.4	1.7e-28
AUL29856.1|2128892_2129153_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL29857.1|2129191_2130013_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
>prophage 16
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	2139793	2200114	3699930	transposase,protease,tRNA	Ralstonia_virus(21.43%)	60	NA	NA
AUL29870.1|2139793_2140831_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.7	5.6e-97
AUL29871.1|2140915_2142208_+	guanine permease	NA	A0A0R6PHV4	Moraxella_phage	36.7	2.9e-66
AUL29872.1|2142390_2143407_+	luciferase	NA	NA	NA	NA	NA
AUL29873.1|2143515_2143899_+	thioredoxin	NA	V9SJ74	Achromobacter_phage	26.8	1.2e-09
AUL31286.1|2143902_2144259_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29874.1|2144279_2144510_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29875.1|2144533_2145331_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL29876.1|2145335_2146103_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL29877.1|2146099_2147095_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL29878.1|2147144_2147909_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	6.3e-29
AUL29879.1|2148081_2149686_-	ABC-F family ATPase	NA	A0A1V0SKJ1	Klosneuvirus	28.9	7.7e-53
AUL29880.1|2149939_2150920_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AUL29881.1|2150916_2151405_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
AUL29882.1|2151397_2152246_-	hydrolase	NA	NA	NA	NA	NA
AUL29883.1|2152337_2152835_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29884.1|2152972_2153332_-	cation:proton antiporter	NA	NA	NA	NA	NA
AUL29885.1|2153328_2153610_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
AUL29886.1|2153609_2154092_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
AUL29887.1|2154093_2155722_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
AUL29888.1|2155718_2156063_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
AUL29889.1|2156064_2159007_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
AUL29890.1|2159452_2160424_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL31287.1|2160413_2161796_-	GTP-binding protein	NA	NA	NA	NA	NA
AUL29891.1|2161938_2162889_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL29892.1|2162848_2164090_-	GTP-binding protein	NA	NA	NA	NA	NA
AUL29893.1|2164086_2165208_-	DNA repair exonuclease	NA	NA	NA	NA	NA
AUL29894.1|2166699_2167167_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL29895.1|2167237_2167888_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29896.1|2167974_2169114_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29897.1|2169282_2170287_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
AUL29898.1|2170283_2171531_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUL29899.1|2171883_2172750_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
AUL29900.1|2172709_2174314_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL29901.1|2174325_2175012_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
AUL29902.1|2175008_2176049_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL29903.1|2176164_2176836_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL31288.1|2176856_2177825_+	secretion protein HlyD	NA	NA	NA	NA	NA
AUL29904.1|2177821_2178760_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
AUL29905.1|2178756_2179911_+	mannose-1-phosphate guanyltransferase	NA	NA	NA	NA	NA
AUL29906.1|2179919_2181371_+	ABC transporter permease	NA	NA	NA	NA	NA
AUL29907.1|2181401_2181884_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29908.1|2181885_2182779_+	hypothetical protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
AUL29909.1|2182775_2183219_+	hypothetical protein	NA	NA	NA	NA	NA
AUL29910.1|2183231_2183609_-	hypothetical protein	NA	NA	NA	NA	NA
AUL29911.1|2183748_2184147_+|protease	membrane-associated protease	protease	NA	NA	NA	NA
AUL29912.1|2184273_2184561_+|protease	CAAX protease family protein	protease	NA	NA	NA	NA
AUL29913.1|2184557_2184974_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUL29914.1|2185149_2185782_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
AUL29915.1|2185810_2186257_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
AUL29916.1|2186543_2187695_+	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUL29917.1|2187808_2188813_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
AUL29918.1|2188758_2189568_-	chemotaxis protein	NA	NA	NA	NA	NA
AUL29919.1|2189796_2190504_+	cell division protein	NA	NA	NA	NA	NA
AUL29920.1|2190436_2191888_+	DNA polymerase	NA	NA	NA	NA	NA
AUL29921.1|2191893_2195052_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
AUL29922.1|2195064_2195586_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
AUL29923.1|2195575_2196400_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AUL29924.1|2196396_2196996_-	ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
AUL29925.1|2197104_2198961_-	phosphoenolpyruvate carboxykinase	NA	NA	NA	NA	NA
AUL29926.1|2199109_2200114_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
>prophage 17
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	2282366	2340778	3699930	transposase,tRNA	Shigella_phage(22.22%)	50	NA	NA
AUL30004.1|2282366_2282627_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL30005.1|2282837_2284136_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUL30006.1|2284178_2285207_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUL30007.1|2285321_2285888_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
AUL30008.1|2285946_2286792_-	phosphatase	NA	NA	NA	NA	NA
AUL31294.1|2286849_2287725_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUL30009.1|2287976_2288591_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30010.1|2288600_2289821_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL30011.1|2289869_2290535_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30012.1|2290582_2291578_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30013.1|2294755_2295670_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL30014.1|2295819_2296785_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL30015.1|2296792_2297209_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUL30016.1|2297205_2298123_+	oxidoreductase	NA	NA	NA	NA	NA
AUL30017.1|2298134_2298554_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30018.1|2298462_2299851_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL31295.1|2299847_2300099_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30019.1|2300269_2301226_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL30020.1|2301208_2301421_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30021.1|2301470_2302244_+	MBL fold hydrolase	NA	NA	NA	NA	NA
AUL30022.1|2302240_2303374_+	malate dehydrogenase	NA	NA	NA	NA	NA
AUL30023.1|2303383_2304334_+	D-3-phosphoglycerate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	28.4	4.8e-18
AUL30024.1|2304365_2305166_+	aldolase	NA	NA	NA	NA	NA
AUL30025.1|2305180_2306335_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30026.1|2306162_2307038_-|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL30027.1|2307034_2307325_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL30028.1|2307437_2308406_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30029.1|2308402_2309323_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30030.1|2309419_2313898_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30031.1|2314276_2318611_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30032.1|2319249_2319813_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30033.1|2319824_2320070_-	RNA-binding protein	NA	NA	NA	NA	NA
AUL30034.1|2320225_2320735_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL30035.1|2320780_2321761_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL30036.1|2321972_2324324_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL31296.1|2324370_2325177_-	DNAase	NA	NA	NA	NA	NA
AUL30037.1|2325197_2325887_-	lipoprotein ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	3.1e-35
AUL30038.1|2325879_2327160_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL30039.1|2327257_2328196_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30040.1|2328177_2329884_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
AUL30041.1|2331117_2331867_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL30042.1|2331873_2333388_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
AUL30043.1|2333400_2333688_+	hypothetical protein	NA	NA	NA	NA	NA
AUL31297.1|2333708_2334596_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AUL31298.1|2334746_2335253_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL30044.1|2335249_2336206_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL30045.1|2336393_2337740_+	protein FpvAIII	NA	NA	NA	NA	NA
AUL30046.1|2338685_2339456_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL31299.1|2339452_2340463_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL30047.1|2340532_2340778_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	2356688	2391871	3699930	transposase,protease	Leptospira_phage(20.0%)	34	NA	NA
AUL30065.1|2356688_2357732_+	alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
AUL31300.1|2357728_2357830_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30066.1|2357921_2358182_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL30067.1|2358220_2359042_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL30068.1|2359291_2359945_+	repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
AUL30069.1|2360060_2361281_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL30070.1|2361331_2363761_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
AUL30071.1|2363926_2365225_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
AUL30072.1|2365329_2365983_-	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
AUL30073.1|2365985_2367296_-	trigger factor	NA	NA	NA	NA	NA
AUL30074.1|2367523_2368063_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
AUL30075.1|2368547_2368808_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL31301.1|2369093_2370104_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL30076.1|2370100_2370871_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL30077.1|2370950_2371616_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	46.1	2.1e-49
AUL30078.1|2371583_2372075_-	SpoVR like family protein	NA	NA	NA	NA	NA
AUL30079.1|2372184_2372388_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
AUL30080.1|2372705_2373026_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30081.1|2373009_2373345_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30082.1|2373399_2373612_-	autotransporter	NA	NA	NA	NA	NA
AUL30083.1|2373687_2374026_+|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	50.0	3.7e-05
AUL31302.1|2374022_2374358_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL30084.1|2374420_2375992_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
AUL30085.1|2376785_2377097_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30086.1|2377289_2378111_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL30087.1|2378149_2378410_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL30088.1|2378537_2378732_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30089.1|2384814_2385105_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL30090.1|2385101_2385977_+|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL30091.1|2386361_2387825_+	ribonuclease E/G	NA	NA	NA	NA	NA
AUL30092.1|2387957_2389508_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
AUL30093.1|2389819_2390641_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL30094.1|2390679_2390940_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL30095.1|2391016_2391871_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	77.8	7.3e-127
>prophage 19
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	2473868	2517696	3699930	transposase,protease,tRNA	Shigella_phage(40.0%)	35	NA	NA
AUL30166.1|2473868_2474516_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AUL30167.1|2474600_2475227_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AUL31305.1|2475291_2476137_+	hypothetical protein	NA	A0A1I9SA48	Rhodococcus_phage	35.1	2.4e-37
AUL30168.1|2476466_2477018_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30169.1|2477781_2478075_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30170.1|2478289_2478619_-	alkylhydroperoxidase	NA	NA	NA	NA	NA
AUL30171.1|2479202_2480663_+	cardiolipin synthase	NA	NA	NA	NA	NA
AUL30172.1|2480621_2480846_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30173.1|2481222_2482542_-	MFS transporter	NA	NA	NA	NA	NA
AUL30174.1|2482584_2483058_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30175.1|2483054_2484065_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30176.1|2484129_2485095_-	pyridoxal-5'-phosphate-dependent protein	NA	NA	NA	NA	NA
AUL30177.1|2485219_2485480_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL30178.1|2486323_2487199_-|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL30179.1|2487195_2487486_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL30180.1|2487755_2488673_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL30181.1|2490028_2491315_+	phospholipase	NA	NA	NA	NA	NA
AUL30182.1|2491408_2492008_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30183.1|2492232_2492754_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30184.1|2493019_2493574_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30185.1|2493593_2494955_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30186.1|2495307_2497887_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AUL30187.1|2497933_2499040_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AUL30188.1|2499186_2499696_+	dehydratase	NA	NA	NA	NA	NA
AUL30189.1|2499719_2500700_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUL31306.1|2500705_2502121_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AUL30190.1|2502117_2503290_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL30191.1|2503286_2504507_+	CoA transferase	NA	NA	NA	NA	NA
AUL30192.1|2504503_2505301_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL30193.1|2506109_2510789_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	28.4	1.1e-27
AUL30194.1|2513937_2514900_-	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL30195.1|2514896_2515415_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL30196.1|2515569_2515890_+	amidohydrolase	NA	NA	NA	NA	NA
AUL30197.1|2516575_2516836_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL30198.1|2516874_2517696_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.4	2.9e-56
>prophage 20
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	2556517	2657237	3699930	transposase,tRNA	Ralstonia_virus(15.79%)	97	NA	NA
AUL30234.1|2556517_2556778_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL30235.1|2557787_2558303_+	hypothetical protein	NA	T1SAR8	Salmonella_phage	44.6	3.9e-06
AUL30236.1|2558575_2558890_+	virulence factor	NA	NA	NA	NA	NA
AUL30237.1|2559077_2559314_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30238.1|2559604_2560960_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.5	2.1e-83
AUL31308.1|2561006_2562347_-	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	38.9	9.3e-76
AUL30239.1|2562448_2563081_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUL30240.1|2563080_2565450_-	cell division protein FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	2.2e-80
AUL30241.1|2565482_2566442_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	40.5	4.8e-58
AUL30242.1|2566428_2567121_+	DNA mismatch repair protein MutS	NA	NA	NA	NA	NA
AUL30243.1|2567117_2567450_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AUL30244.1|2567565_2568516_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL30245.1|2568512_2570579_-	cation acetate symporter	NA	NA	NA	NA	NA
AUL30246.1|2570578_2570851_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30247.1|2571545_2571635_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUL30248.1|2571634_2573419_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AUL30249.1|2573442_2575608_+	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.9	7.8e-24
AUL30250.1|2575618_2576218_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AUL30251.1|2578981_2579677_+	two-component system response regulator KdpE	NA	NA	NA	NA	NA
AUL30252.1|2579685_2580927_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30253.1|2581076_2582057_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30254.1|2582255_2583512_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	1.2e-11
AUL30255.1|2583714_2584140_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30256.1|2584190_2584553_-	cytochrome	NA	NA	NA	NA	NA
AUL31309.1|2585081_2585969_+	ATP-binding protein	NA	NA	NA	NA	NA
AUL30257.1|2587165_2587408_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUL30258.1|2587404_2587779_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30259.1|2588111_2590862_+	peptidase M16	NA	A0A2K9LA15	Tupanvirus	28.1	1.5e-19
AUL30260.1|2591030_2592176_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	60.8	4.0e-19
AUL30261.1|2592276_2594202_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.7	2.7e-145
AUL30262.1|2594290_2594665_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUL30263.1|2594686_2595217_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUL30264.1|2595330_2595564_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30265.1|2595650_2596742_-	ferrochelatase	NA	NA	NA	NA	NA
AUL30266.1|2596774_2597779_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AUL30267.1|2597888_2598788_+	NAD kinase	NA	NA	NA	NA	NA
AUL30268.1|2598809_2600465_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AUL31310.1|2600569_2601313_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	73.7	2.1e-101
AUL30269.1|2602142_2602403_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL30270.1|2603117_2603534_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
AUL31311.1|2603804_2604302_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30271.1|2604317_2605109_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AUL30272.1|2605166_2606153_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AUL31312.1|2606499_2607045_-|transposase	transposase	transposase	U5P429	Shigella_phage	66.3	2.2e-68
AUL30273.1|2607087_2607348_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL30274.1|2607440_2607941_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL30275.1|2608457_2609111_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
AUL31313.1|2609292_2610000_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL30276.1|2609996_2612612_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
AUL30277.1|2612668_2613853_+	putative methylaconitate Delta-isomerase PrpF	NA	NA	NA	NA	NA
AUL30278.1|2613913_2614522_+	lysine transporter LysE	NA	NA	NA	NA	NA
AUL30279.1|2614644_2615670_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUL30280.1|2615733_2616264_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL30281.1|2616143_2616485_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30282.1|2616481_2617189_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL30283.1|2617198_2618092_-	carboxyvinyl-carboxyphosphonate phosphorylmutase	NA	NA	NA	NA	NA
AUL30284.1|2618075_2618834_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL30285.1|2619125_2621801_+	aconitate hydratase 1	NA	NA	NA	NA	NA
AUL30286.1|2621817_2623179_+	dihydroorotase	NA	NA	NA	NA	NA
AUL30287.1|2623198_2623921_+	hydrolase	NA	NA	NA	NA	NA
AUL30288.1|2623925_2624924_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
AUL30289.1|2625344_2625653_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30290.1|2625700_2626273_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30291.1|2626250_2626655_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30292.1|2626773_2627691_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL30293.1|2627700_2628282_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AUL30294.1|2628278_2629031_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUL30295.1|2629073_2629793_+	arginyltransferase	NA	NA	NA	NA	NA
AUL30296.1|2629835_2630891_+	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AUL30297.1|2631000_2631843_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	77.8	4.5e-129
AUL30298.1|2631900_2632161_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL30299.1|2632199_2633021_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL30300.1|2633580_2634159_-	Phasin (PHA-granule associated protein)	NA	NA	NA	NA	NA
AUL30301.1|2634301_2635522_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL30302.1|2635826_2636804_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL30303.1|2636952_2637783_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL30304.1|2637896_2638712_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
AUL30305.1|2638734_2639589_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30306.1|2639587_2639971_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUL30307.1|2640077_2641451_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	1.8e-50
AUL30308.1|2641522_2642014_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30309.1|2642013_2642766_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30310.1|2643113_2643317_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30311.1|2643346_2643769_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AUL30312.1|2643780_2644878_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUL30313.1|2644890_2646408_-	peptidase	NA	NA	NA	NA	NA
AUL30314.1|2646481_2647321_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
AUL30315.1|2647342_2648200_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30316.1|2648272_2649391_-	porin	NA	NA	NA	NA	NA
AUL30317.1|2650021_2650843_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL30318.1|2650881_2651142_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL30319.1|2651185_2651815_-	calcium:sodium antiporter	NA	NA	NA	NA	NA
AUL30320.1|2651972_2653316_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AUL30321.1|2653324_2653708_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30322.1|2653867_2655019_+	monooxygenase	NA	NA	NA	NA	NA
AUL30323.1|2655117_2656068_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL30324.1|2656211_2657237_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
>prophage 21
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	2938660	3039478	3699930	transposase,tRNA	Ralstonia_virus(20.0%)	83	NA	NA
AUL30560.1|2938660_2939440_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AUL30561.1|2939462_2940410_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
AUL30562.1|2940411_2940612_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AUL30563.1|2940946_2941207_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL30564.1|2941245_2942067_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL30565.1|2942387_2943104_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
AUL30566.1|2943100_2943994_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL30567.1|2944157_2945378_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL30568.1|2945530_2946613_+	iron ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
AUL30569.1|2948292_2949276_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL30570.1|2949338_2950751_-	signal recognition particle protein	NA	NA	NA	NA	NA
AUL30571.1|2950868_2951711_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30572.1|2951989_2952598_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
AUL30573.1|2952613_2953234_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUL30574.1|2953299_2954010_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.6e-13
AUL30575.1|2954011_2954734_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
AUL30576.1|2954720_2955011_-	inner-membrane translocator	NA	NA	NA	NA	NA
AUL30577.1|2955086_2956307_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	2.1e-183
AUL31321.1|2957031_2957883_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL30578.1|2957934_2959188_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL30579.1|2959364_2960153_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30580.1|2960272_2961187_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL30581.1|2961319_2963212_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
AUL30582.1|2963397_2964777_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
AUL30583.1|2965221_2965518_+	site-specific recombinase	NA	NA	NA	NA	NA
AUL30584.1|2965561_2965822_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL30585.1|2965914_2966415_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL30586.1|2966428_2966653_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL30587.1|2969318_2969921_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AUL30588.1|2970054_2970513_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AUL30589.1|2970514_2971114_-	iron transport sensor protein	NA	NA	NA	NA	NA
AUL30590.1|2971122_2971932_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL30591.1|2971966_2972821_+	permease	NA	NA	NA	NA	NA
AUL30592.1|2972940_2973528_+	histidine utilization protein HutD	NA	NA	NA	NA	NA
AUL30593.1|2973524_2974904_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
AUL30594.1|2983225_2984566_+	8-amino-7-oxononanoate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
AUL30595.1|2984579_2985431_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
AUL30596.1|2985442_2986708_-	capsule biosynthesis protein CapA	NA	NA	NA	NA	NA
AUL30597.1|2986769_2988851_-	beta-3-deoxy-D-manno-oct-2-ulosonic acid transferase	NA	NA	NA	NA	NA
AUL30598.1|2989799_2990060_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL30599.1|2990152_2990653_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL30600.1|2990649_2991504_-	sulfatase	NA	NA	NA	NA	NA
AUL30601.1|2991496_2992291_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL30602.1|2992506_2993457_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL30603.1|2993555_2994506_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL30604.1|2995108_2995906_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL30605.1|2995945_2996599_-	DL-methionine transporter permease subunit	NA	NA	NA	NA	NA
AUL30606.1|2996579_2997644_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
AUL30607.1|2997807_3000033_-	glycosyl hydrolase	NA	NA	NA	NA	NA
AUL30608.1|3000278_3002123_-	FAD-dependent cmnm(5)s(2)U34 oxidoreductase	NA	NA	NA	NA	NA
AUL30609.1|3002239_3003112_+	inositol monophosphatase	NA	NA	NA	NA	NA
AUL30610.1|3003158_3004859_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
AUL30611.1|3004921_3006121_+	amidohydrolase	NA	NA	NA	NA	NA
AUL30612.1|3006131_3007010_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL30613.1|3007116_3008154_+	hypothetical protein	NA	NA	NA	NA	NA
AUL31322.1|3008234_3008639_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUL30614.1|3008650_3010108_+	magnesium transporter	NA	NA	NA	NA	NA
AUL30615.1|3010750_3011347_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AUL30616.1|3011507_3011966_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL30617.1|3012743_3013715_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30618.1|3013836_3014256_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30619.1|3015131_3015392_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL30620.1|3015547_3016768_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL30621.1|3016829_3017717_-	HflC protein	NA	NA	NA	NA	NA
AUL30622.1|3017734_3019039_-	HflK protein	NA	NA	NA	NA	NA
AUL30623.1|3019004_3020111_-	GTPase HflX	NA	NA	NA	NA	NA
AUL30624.1|3020198_3020435_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
AUL30625.1|3020618_3021692_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AUL30626.1|3021688_3023044_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AUL30627.1|3023068_3024226_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AUL30628.1|3024231_3024870_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30629.1|3024873_3026169_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AUL30630.1|3026201_3027488_-	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase	NA	NA	NA	NA	NA
AUL30631.1|3027500_3027989_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL30632.1|3027985_3029134_-	23S rRNA (adenine(2503)-C(2))-methyltransferase	NA	NA	NA	NA	NA
AUL30633.1|3029163_3029589_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.9	2.4e-22
AUL30634.1|3029908_3032788_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	1.1e-137
AUL30635.1|3032841_3034062_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL30636.1|3034110_3034974_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AUL30637.1|3034973_3035567_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUL30638.1|3035858_3036119_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUL30639.1|3036618_3036870_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30640.1|3036856_3039478_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.5	2.8e-84
>prophage 22
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	3098335	3153634	3699930	transposase,protease,tRNA	Ralstonia_virus(25.0%)	39	NA	NA
AUL30690.1|3098335_3099556_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL31325.1|3099597_3100854_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL30691.1|3101094_3102240_+	Bcr/CflA family drug resistance efflux transporter	NA	NA	NA	NA	NA
AUL30692.1|3102546_3102783_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AUL30693.1|3102863_3103031_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AUL30694.1|3103187_3104276_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30695.1|3104301_3105522_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL30696.1|3107740_3108172_+	DNA-binding protein	NA	NA	NA	NA	NA
AUL30697.1|3108298_3108811_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUL31326.1|3108843_3110004_+	MFS transporter	NA	NA	NA	NA	NA
AUL30698.1|3110075_3112733_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	38.7	7.5e-170
AUL30699.1|3112744_3113422_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30700.1|3113421_3114471_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AUL30701.1|3114494_3115754_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.2	1.9e-94
AUL30702.1|3115760_3116150_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30703.1|3116301_3116586_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL30704.1|3116582_3116972_+	hypothetical protein	NA	NA	NA	NA	NA
AUL31327.1|3116984_3118148_-	secretion protein	NA	NA	NA	NA	NA
AUL30705.1|3118174_3119935_-|protease	protease/lipase ABC transporter ATP-binding protein	protease	F2Y2R6	Organic_Lake_phycodnavirus	28.5	3.5e-14
AUL30706.1|3119931_3121233_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30707.1|3121470_3121731_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL30708.1|3121769_3122591_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL30709.1|3128991_3130509_-	propionyl-CoA--succinate CoA transferase	NA	NA	NA	NA	NA
AUL30710.1|3131743_3134134_+	mechanosensitive ion channel protein	NA	NA	NA	NA	NA
AUL30711.1|3134135_3134906_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30712.1|3134902_3135781_-	EamA family transporter	NA	NA	NA	NA	NA
AUL30713.1|3135964_3136255_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AUL31328.1|3136270_3136813_-	DNA polymerase III subunit epsilon	NA	A0A0A7RWA3	Clostridium_phage	29.7	7.2e-11
AUL30714.1|3137036_3139628_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
AUL30715.1|3142292_3142895_+	hypothetical protein	NA	NA	NA	NA	NA
AUL31329.1|3143143_3145849_+	aconitate hydratase 1	NA	NA	NA	NA	NA
AUL30716.1|3145914_3146697_-	dioxygenase	NA	NA	NA	NA	NA
AUL30717.1|3146858_3148064_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30718.1|3148070_3149159_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30719.1|3149316_3149874_+	elongation factor P	NA	NA	NA	NA	NA
AUL30720.1|3149955_3150390_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30721.1|3151270_3152653_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUL30722.1|3152662_3153115_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30723.1|3153133_3153634_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
>prophage 23
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	3353755	3419563	3699930	transposase,tRNA	Synechococcus_phage(12.5%)	60	NA	NA
AUL30893.1|3353755_3355891_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUL30894.1|3355887_3356427_+	D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AUL30895.1|3356430_3357159_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUL30896.1|3357145_3357979_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30897.1|3357983_3358910_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL31340.1|3358988_3360404_+	FAD-binding dehydrogenase	NA	NA	NA	NA	NA
AUL30898.1|3360390_3361473_+	tricarballylate utilization protein B	NA	NA	NA	NA	NA
AUL30899.1|3361586_3361982_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
AUL30900.1|3361987_3362521_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.6	7.5e-13
AUL30901.1|3364911_3366141_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30902.1|3366141_3367584_-	pyruvate kinase	NA	NA	NA	NA	NA
AUL30903.1|3367679_3368822_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.0	3.2e-37
AUL30904.1|3368840_3369320_+	thioesterase	NA	NA	NA	NA	NA
AUL30905.1|3369348_3370137_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase	NA	NA	NA	NA	NA
AUL30906.1|3370150_3371689_-	molecular chaperone SurA	NA	NA	NA	NA	NA
AUL30907.1|3371685_3374094_-	LPS biosynthesis protein	NA	NA	NA	NA	NA
AUL30908.1|3374247_3375315_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AUL30909.1|3375314_3375995_+	mannose-1-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AUL30910.1|3376136_3376862_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30911.1|3376870_3377194_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
AUL30912.1|3377247_3377895_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30913.1|3378030_3378444_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30914.1|3378529_3379579_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AUL30915.1|3379724_3380675_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL30916.1|3380713_3381421_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL30917.1|3381388_3382210_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL30918.1|3382248_3382509_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL30919.1|3382566_3384075_-	sulfite reductase	NA	NA	NA	NA	NA
AUL30920.1|3384231_3385755_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30921.1|3385809_3386457_-	carbonate dehydratase	NA	NA	NA	NA	NA
AUL30922.1|3386599_3386941_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30923.1|3387098_3387431_+	PsiF repeat family protein	NA	NA	NA	NA	NA
AUL30924.1|3387479_3388520_-	cyclase	NA	NA	NA	NA	NA
AUL30925.1|3388523_3389303_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AUL30926.1|3389338_3389635_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30927.1|3389649_3389925_-	muconolactone delta-isomerase	NA	NA	NA	NA	NA
AUL30928.1|3389992_3390637_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUL30929.1|3390639_3390729_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUL30930.1|3390919_3391705_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL30931.1|3391742_3392468_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL30932.1|3392481_3393822_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
AUL30933.1|3393916_3394849_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL30934.1|3395077_3397849_-	peptidase S8	NA	NA	NA	NA	NA
AUL30935.1|3398288_3401135_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AUL30936.1|3401281_3401995_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	41.4	1.6e-47
AUL30937.1|3402007_3402550_-	GNAT family N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	45.8	1.1e-27
AUL30938.1|3402655_3403564_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.7	4.4e-05
AUL30939.1|3403655_3405512_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AUL30940.1|3405695_3406736_-	GntR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.2	4.3e-20
AUL30941.1|3406878_3407784_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AUL30942.1|3409471_3410422_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL30943.1|3410478_3411246_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
AUL30944.1|3411363_3412008_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30945.1|3412271_3412568_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AUL30946.1|3412714_3413785_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AUL30947.1|3414017_3414212_-	hypothetical protein	NA	NA	NA	NA	NA
AUL30948.1|3414480_3415335_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30949.1|3415360_3416581_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL31341.1|3416898_3418830_+	hypothetical protein	NA	NA	NA	NA	NA
AUL30950.1|3419302_3419563_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
CP018893	Bordetella holmesii isolate F621 chromosome, complete genome	3699930	3613315	3662016	3699930	transposase,holin,tRNA	Catovirus(20.0%)	39	NA	NA
AUL31121.1|3613315_3615106_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.5	5.5e-07
AUL31122.1|3615147_3615783_-	hypothetical protein	NA	A0A2I7S9X1	Vibrio_phage	29.0	1.2e-12
AUL31123.1|3615785_3616100_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
AUL31124.1|3617650_3619273_-|holin	choline dehydrogenase	holin	A0A1V0S9J5	Catovirus	29.6	5.4e-46
AUL31125.1|3619443_3619548_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
AUL31126.1|3619540_3620251_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
AUL31127.1|3620525_3621014_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUL31128.1|3621155_3622355_+	2-aminoadipate aminotransferase	NA	NA	NA	NA	NA
AUL31129.1|3622430_3623354_+	4-hydroxybenzoate polyprenyltransferase	NA	NA	NA	NA	NA
AUL31130.1|3623688_3624069_+	hypothetical protein	NA	NA	NA	NA	NA
AUL31347.1|3624212_3624971_-	transcriptional regulator GlcC	NA	NA	NA	NA	NA
AUL31348.1|3625182_3627354_+	malate synthase G	NA	NA	NA	NA	NA
AUL31131.1|3627411_3628485_-	lipase	NA	G9BWD6	Planktothrix_phage	37.1	2.6e-28
AUL31132.1|3628477_3630247_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AUL31133.1|3630261_3631371_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL31134.1|3631486_3633976_-	signal protein	NA	NA	NA	NA	NA
AUL31135.1|3633962_3634634_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL31136.1|3635157_3636204_+	oxidoreductase	NA	NA	NA	NA	NA
AUL31137.1|3636212_3636782_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUL31138.1|3637879_3638962_+	UDP-N-acetylglucosamine 2-epimerase	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	33.2	1.1e-45
AUL31139.1|3638986_3640240_+	glycosyltransferase WbuB	NA	NA	NA	NA	NA
AUL31140.1|3640244_3641432_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	NA	NA	NA	NA
AUL31141.1|3641428_3642022_+	sugar transferase	NA	NA	NA	NA	NA
AUL31142.1|3642408_3644346_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	27.9	2.2e-25
AUL31143.1|3644479_3645430_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL31144.1|3645511_3646219_-	hypothetical protein	NA	NA	NA	NA	NA
AUL31145.1|3646282_3648919_+	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	26.3	8.0e-23
AUL31146.1|3649048_3650269_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.1e-181
AUL31147.1|3650347_3651403_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL31148.1|3651402_3652173_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL31149.1|3652740_3653541_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
AUL31150.1|3653629_3655057_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUL31151.1|3655151_3655652_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL31152.1|3655744_3656005_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL31349.1|3656070_3656769_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL31153.1|3658732_3659212_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL31154.1|3659199_3660126_-	bestrophin	NA	NA	NA	NA	NA
AUL31155.1|3660242_3660770_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
AUL31156.1|3660795_3662016_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
