The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	148265	195149	3691669	protease,transposase	uncultured_Mediterranean_phage(22.22%)	49	NA	NA
AUL21493.1|148265_148703_-|protease	ClpXP protease specificity-enhancing factor	protease	NA	NA	NA	NA
AUL21494.1|148711_149323_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUL21495.1|149475_150327_-	cytochrome c1	NA	NA	NA	NA	NA
AUL21496.1|150351_151740_-	cytochrome b	NA	NA	NA	NA	NA
AUL21497.1|151821_152463_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AUL21498.1|152611_153049_+	large-conductance mechanosensitive channel protein	NA	NA	NA	NA	NA
AUL21499.1|153106_153883_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AUL24514.1|153902_155033_+	2-alkenal reductase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	37.2	3.0e-11
AUL21500.1|155097_155883_-	twin arginine-targeting protein translocase TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	34.4	5.0e-29
AUL21501.1|155879_156377_-	twin arginine-targeting protein translocase TatB	NA	NA	NA	NA	NA
AUL21502.1|156425_156647_-	Sec-independent protein translocase TatA	NA	NA	NA	NA	NA
AUL21503.1|156662_157031_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
AUL21504.1|157038_157389_-	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
AUL21505.1|157385_157790_-	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
AUL21506.1|157791_158607_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
AUL21507.1|158603_159344_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
AUL21508.1|159410_160097_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
AUL21509.1|160115_160703_-	imidazoleglycerol-phosphate dehydratase	NA	NA	NA	NA	NA
AUL21510.1|160704_161799_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AUL21511.1|161795_163103_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
AUL21512.1|163128_163800_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
AUL21513.1|163796_165062_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUL21514.1|165061_165307_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
AUL21515.1|165310_166108_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AUL21516.1|166104_166914_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	2.8e-19
AUL21517.1|167050_167677_-	ABC transporter	NA	NA	NA	NA	NA
AUL21518.1|167702_168494_-	hypothetical protein	NA	NA	NA	NA	NA
AUL21519.1|168558_169047_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AUL21520.1|169059_169842_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL21521.1|169838_170675_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.7e-22
AUL21522.1|170856_171837_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL21523.1|171901_172537_-	hypothetical protein	NA	NA	NA	NA	NA
AUL21524.1|172737_174204_-	glutamate synthase	NA	NA	NA	NA	NA
AUL21525.1|174212_178952_-	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
AUL21526.1|179305_180526_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL21527.1|180641_181385_-	hypothetical protein	NA	NA	NA	NA	NA
AUL21528.1|181554_182661_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.1	1.4e-32
AUL21529.1|182671_183511_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AUL21530.1|183568_184258_+	hypothetical protein	NA	NA	NA	NA	NA
AUL21531.1|184354_184807_+	hypothetical protein	NA	NA	NA	NA	NA
AUL21532.1|184810_186031_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL21533.1|186254_187142_+	RNA polymerase factor sigma-32	NA	A0A248SJA5	Salicola_phage	38.5	2.1e-39
AUL21534.1|187456_188242_-	phosphodiesterase	NA	NA	NA	NA	NA
AUL21535.1|191084_191861_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AUL21536.1|192353_192614_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL21537.1|192652_193474_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL21538.1|193508_193778_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
AUL21539.1|193749_194100_+	bifunctional protein GlmU	NA	NA	NA	NA	NA
AUL21540.1|194198_195149_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	226939	263753	3691669	transposase	Leptospira_phage(40.0%)	32	NA	NA
AUL21565.1|226939_227200_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL21566.1|227292_227793_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL21567.1|228166_229387_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL21568.1|230041_231319_+	cytosine deaminase	NA	NA	NA	NA	NA
AUL21569.1|231373_231940_-	cysteine dioxygenase	NA	NA	NA	NA	NA
AUL21570.1|232025_233189_-	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUL21571.1|233357_233642_+	acylphosphatase	NA	NA	NA	NA	NA
AUL21572.1|233665_234304_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL21573.1|234425_235397_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL21574.1|236975_237746_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL21575.1|237957_238908_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL24521.1|238880_239384_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	49.7	3.4e-39
AUL21576.1|239460_240465_-	hypothetical protein	NA	NA	NA	NA	NA
AUL24522.1|240536_242105_-	acetolactate synthase large subunit	NA	G9E4W7	Ostreococcus_lucimarinus_virus	27.1	4.5e-05
AUL21577.1|242241_243291_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AUL21578.1|243293_244478_+	CoA transferase	NA	NA	NA	NA	NA
AUL21579.1|244506_245637_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL21580.1|245649_246792_+	carnitine dehydratase	NA	NA	NA	NA	NA
AUL21581.1|248601_249216_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL21582.1|249264_250167_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL21583.1|250293_250683_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUL21584.1|250684_251566_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
AUL21585.1|251594_252563_+	MFS transporter	NA	NA	NA	NA	NA
AUL21586.1|252771_253761_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL21587.1|255310_256090_+	oxidoreductase	NA	NA	NA	NA	NA
AUL24523.1|256120_257866_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AUL21588.1|257862_258765_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
AUL21589.1|259048_260257_+	ferredoxin reductase	NA	NA	NA	NA	NA
AUL21590.1|260438_260702_+	hypothetical protein	NA	NA	NA	NA	NA
AUL21591.1|260707_261187_+	DUF188 domain-containing protein	NA	NA	NA	NA	NA
AUL21592.1|261247_262357_-	porin	NA	NA	NA	NA	NA
AUL21593.1|262532_263753_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 3
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	587415	656249	3691669	transposase,tRNA	Staphylococcus_phage(21.43%)	59	NA	NA
AUL21868.1|587415_588279_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL21869.1|588362_589490_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
AUL21870.1|589498_590914_-	metallopeptidase	NA	A8ATH6	Listeria_phage	42.7	6.7e-16
AUL21871.1|591193_592423_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
AUL21872.1|592461_593118_+	phospholipid-binding protein	NA	NA	NA	NA	NA
AUL21873.1|593321_594572_+	serine hydroxymethyltransferase	NA	A0A219YCZ0	Aeromonas_phage	52.2	2.8e-98
AUL21874.1|594732_595218_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AUL21875.1|595222_596185_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL21876.1|596184_596745_-	hydrolase	NA	NA	NA	NA	NA
AUL21877.1|596780_598055_+	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	31.9	1.5e-38
AUL21878.1|598076_598718_+	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	36.1	7.2e-26
AUL21879.1|601005_602268_+	hypothetical protein	NA	NA	NA	NA	NA
AUL21880.1|602264_603785_+	SpoVR family protein	NA	NA	NA	NA	NA
AUL21881.1|603781_604618_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL21882.1|605855_606755_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL21883.1|607130_607787_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUL21884.1|607964_608372_-	alkylhydroperoxidase	NA	NA	NA	NA	NA
AUL21885.1|609686_610907_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL21886.1|610903_611374_+	MFS permease	NA	NA	NA	NA	NA
AUL21887.1|611383_611839_-	hypothetical protein	NA	NA	NA	NA	NA
AUL21888.1|612806_614375_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AUL21889.1|614597_615035_+	universal stress protein	NA	NA	NA	NA	NA
AUL21890.1|615046_615457_-	hypothetical protein	NA	NA	NA	NA	NA
AUL21891.1|615487_616261_-	NADH pyrophosphatase	NA	NA	NA	NA	NA
AUL21892.1|616488_618591_+	dehydrogenase	NA	NA	NA	NA	NA
AUL21893.1|619099_619948_+	two-component response regulator	NA	NA	NA	NA	NA
AUL21894.1|619967_620183_-	hypothetical protein	NA	NA	NA	NA	NA
AUL21895.1|620337_621234_+	hypothetical protein	NA	NA	NA	NA	NA
AUL21896.1|621337_622228_+	nicotinate-nucleotide diphosphorylase (carboxylating)	NA	NA	NA	NA	NA
AUL21897.1|622304_623273_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL21898.1|623273_623984_-	hypothetical protein	NA	NA	NA	NA	NA
AUL21899.1|624059_626153_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL21900.1|626182_626491_-	hypothetical protein	NA	NA	NA	NA	NA
AUL21901.1|626677_627463_-	enoyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
AUL21902.1|627521_628934_-	lytic transglycosylase	NA	A0A223LD43	Bacillus_phage	29.3	2.1e-06
AUL21903.1|628941_629751_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AUL21904.1|629768_630533_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL21905.1|630601_631063_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	51.5	4.5e-38
AUL21906.1|631187_632270_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUL21907.1|632285_632483_+	hypothetical protein	NA	NA	NA	NA	NA
AUL21908.1|632445_633666_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL21909.1|636675_637410_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	42.4	2.6e-40
AUL21910.1|637578_638799_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL21911.1|639173_640160_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AUL21912.1|640163_642887_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	6.6e-20
AUL21913.1|642887_644015_+	hypothetical protein	NA	NA	NA	NA	NA
AUL21914.1|644027_645440_+	RND transporter	NA	NA	NA	NA	NA
AUL21915.1|645614_646271_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL21916.1|646291_647338_+	glycosyltransferase	NA	F1C5B0	Cronobacter_phage	39.5	1.4e-58
AUL21917.1|647334_648924_+	dolichyl-phosphate-mannose--protein mannosyltransferase	NA	NA	NA	NA	NA
AUL21918.1|649078_650188_+	hypothetical protein	NA	NA	NA	NA	NA
AUL21919.1|650177_651074_-	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	33.1	6.5e-09
AUL21920.1|651120_651753_-	hypothetical protein	NA	NA	NA	NA	NA
AUL21921.1|651777_652662_-	EamA family transporter	NA	NA	NA	NA	NA
AUL21922.1|652789_654271_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL21923.1|654343_654688_+	TIGR01244 family protein	NA	NA	NA	NA	NA
AUL21924.1|654773_655238_+	universal stress protein	NA	NA	NA	NA	NA
AUL21925.1|655395_655656_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL21926.1|655748_656249_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	49.7	2.8e-41
>prophage 4
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	659557	724604	3691669	transposase,tRNA	Ralstonia_virus(42.86%)	58	NA	NA
AUL21929.1|659557_660508_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL21930.1|660540_660987_+|tRNA	cys-tRNA(pro)/cys-tRNA(cys) deacylase	tRNA	NA	NA	NA	NA
AUL21931.1|661035_661725_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
AUL21932.1|661812_662307_-	peptidoglycan-associated lipoprotein	NA	NA	NA	NA	NA
AUL21933.1|662338_663655_-	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
AUL21934.1|663671_664592_-	protein TolA	NA	NA	NA	NA	NA
AUL21935.1|664626_665088_-	protein TolR	NA	NA	NA	NA	NA
AUL21936.1|665087_665762_-	protein TolQ	NA	NA	NA	NA	NA
AUL21937.1|665764_666187_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUL21938.1|666240_667971_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	28.6	1.2e-11
AUL21939.1|668036_668606_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AUL21940.1|668586_669273_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL21941.1|669292_670798_+	sensor histidine kinase	NA	NA	NA	NA	NA
AUL21942.1|671026_671476_+	tripartite tricarboxylate transporter TctB	NA	NA	NA	NA	NA
AUL21943.1|671481_673002_+	hypothetical protein	NA	NA	NA	NA	NA
AUL21944.1|673055_674276_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL21945.1|674372_675302_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL21946.1|675460_676366_-	oxidoreductase	NA	NA	NA	NA	NA
AUL21947.1|676565_677786_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL21948.1|677841_679347_-	hypothetical protein	NA	NA	NA	NA	NA
AUL21949.1|679368_679824_-	tricarboxylate transporter	NA	NA	NA	NA	NA
AUL21950.1|680180_680753_+	hypothetical protein	NA	NA	NA	NA	NA
AUL21951.1|680752_681064_+	cell division protein ZapA	NA	NA	NA	NA	NA
AUL21952.1|681377_682139_+	hypothetical protein	NA	NA	NA	NA	NA
AUL21953.1|682107_682902_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AUL21954.1|683080_683416_+	cytochrome C	NA	NA	NA	NA	NA
AUL21955.1|683432_683990_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AUL21956.1|684051_685164_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
AUL21957.1|685304_685781_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL21958.1|692122_692317_+	hypothetical protein	NA	NA	NA	NA	NA
AUL21959.1|692444_692705_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL21960.1|692797_693298_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL21961.1|693535_693910_+	hypothetical protein	NA	NA	NA	NA	NA
AUL21962.1|694127_694406_-	DNA topoisomerase III	NA	NA	NA	NA	NA
AUL21963.1|694554_695748_+	peptidase M20	NA	NA	NA	NA	NA
AUL21964.1|695760_696819_+	dihydroorotase	NA	NA	NA	NA	NA
AUL21965.1|696856_698665_-	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	29.5	2.5e-44
AUL21966.1|699439_699868_+	cell division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
AUL21967.1|699876_700950_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	NA	NA	NA	NA
AUL21968.1|700949_701237_+	cell division protein FtsL	NA	NA	NA	NA	NA
AUL21969.1|701233_702967_+	cell division protein	NA	NA	NA	NA	NA
AUL21970.1|702963_705786_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
AUL21971.1|705775_706945_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AUL21972.1|706941_708474_+	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	NA	NA	NA	NA
AUL21973.1|708470_709664_+	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
AUL21974.1|709660_710734_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AUL21975.1|710730_712137_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
AUL21976.1|712133_713087_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AUL21977.1|713095_713920_+	cell division protein FtsQ	NA	NA	NA	NA	NA
AUL21978.1|713924_715151_+	cell division protein FtsA	NA	NA	NA	NA	NA
AUL21979.1|715346_716531_+	cell division protein FtsZ	NA	NA	NA	NA	NA
AUL21980.1|716770_717694_+	UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
AUL21981.1|717784_718000_+	hypothetical protein	NA	NA	NA	NA	NA
AUL21982.1|718036_718531_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
AUL21983.1|718573_719557_+	peptidase M23	NA	A0A292GJG6	Xanthomonas_phage	47.7	1.2e-27
AUL21984.1|719717_722453_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AUL21985.1|722454_723174_+	hypothetical protein	NA	NA	NA	NA	NA
AUL21986.1|723383_724604_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 5
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	800268	855180	3691669	transposase,holin	Ralstonia_virus(16.67%)	53	NA	NA
AUL22048.1|800268_802368_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AUL22049.1|802509_803349_-	branched chain amino acid aminotransferase	NA	NA	NA	NA	NA
AUL22050.1|804478_805366_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL22051.1|805456_805603_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL22052.1|805666_806671_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL22053.1|807577_807838_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL22054.1|808112_808748_-	endonuclease III	NA	NA	NA	NA	NA
AUL22055.1|808768_809407_-	ferredoxin	NA	NA	NA	NA	NA
AUL22056.1|809457_810684_-	esterase	NA	NA	NA	NA	NA
AUL22057.1|810820_811618_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AUL22058.1|811648_811972_-	ferredoxin	NA	NA	NA	NA	NA
AUL22059.1|812136_813312_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	32.5	4.2e-48
AUL22060.1|813350_813704_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22061.1|813734_814154_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22062.1|814246_815086_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22063.1|815282_817529_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AUL22064.1|817548_818862_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	41.0	1.5e-83
AUL22065.1|819027_820179_+	acetylornithine deacetylase (ArgE)	NA	NA	NA	NA	NA
AUL22066.1|820319_821519_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AUL22067.1|821515_822379_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AUL22068.1|822408_823287_+	acetyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
AUL22069.1|823495_824041_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22070.1|824211_824472_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL22071.1|825420_828552_-	ribonuclease E/G	NA	NA	NA	NA	NA
AUL22072.1|829131_830037_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AUL22073.1|830038_830695_+	HAD family hydrolase	NA	NA	NA	NA	NA
AUL22074.1|830812_831772_+	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AUL22075.1|831784_832411_+	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AUL22076.1|832391_833174_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	32.4	5.0e-13
AUL24546.1|833177_833888_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL22077.1|833884_834478_-	septum formation protein Maf	NA	NA	NA	NA	NA
AUL22078.1|834695_835343_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22079.1|835395_835578_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
AUL22080.1|835636_836701_+	phosphate acyltransferase	NA	NA	NA	NA	NA
AUL22081.1|836700_837687_+	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
AUL22082.1|837746_838682_+	[acyl-carrier-protein] S-malonyltransferase	NA	NA	NA	NA	NA
AUL22083.1|838684_839434_+	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.0	2.7e-16
AUL22084.1|839651_839891_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	48.5	1.6e-10
AUL22085.1|840062_841292_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AUL22086.1|841294_841726_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22087.1|841722_842322_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	26.9	2.6e-06
AUL22088.1|842334_842820_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22089.1|842819_843854_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AUL22090.1|843894_845397_+	serine peptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.2	1.1e-21
AUL22091.1|845481_846702_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	5.1e-182
AUL22092.1|846888_847839_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL22093.1|847906_849700_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.5	1.4e-23
AUL22094.1|849723_850608_+	S26 family signal peptidase	NA	NA	NA	NA	NA
AUL22095.1|850613_851369_+	ribonuclease III	NA	M4QNJ2	Ostreococcus_lucimarinus_virus	33.5	1.5e-19
AUL22096.1|851365_852256_+	GTPase Era	NA	NA	NA	NA	NA
AUL22097.1|852248_852836_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AUL22098.1|852858_853950_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.9	2.1e-17
AUL22099.1|853959_855180_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 6
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	864874	919437	3691669	transposase	Ralstonia_virus(28.57%)	52	NA	NA
AUL22108.1|864874_866095_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
AUL22109.1|866262_866598_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22110.1|866793_867459_-	hypothetical protein	NA	A0A0A8WF62	Clostridium_phage	34.5	1.6e-15
AUL22111.1|867704_869594_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	30.7	2.4e-61
AUL22112.1|869590_869998_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22113.1|870081_871308_+	MFS transporter	NA	NA	NA	NA	NA
AUL22114.1|871457_873437_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	43.6	6.1e-84
AUL22115.1|873502_874723_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL22116.1|875750_876764_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AUL22117.1|876785_877619_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL22118.1|877668_879315_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
AUL22119.1|879447_879894_+	thioesterase	NA	NA	NA	NA	NA
AUL22120.1|880008_880707_+	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUL22121.1|880719_881373_+	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUL22122.1|881573_882458_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL22123.1|882454_883435_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
AUL22124.1|883472_885353_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.8	2.0e-20
AUL22125.1|885427_886981_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
AUL22126.1|887054_887975_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
AUL22127.1|887982_888876_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
AUL22128.1|888965_890033_+	aminopeptidase	NA	NA	NA	NA	NA
AUL22129.1|890043_890862_+	aminopeptidase	NA	NA	NA	NA	NA
AUL22130.1|890876_892673_+	Xaa-Pro aminopeptidase	NA	A0A0P0I8D7	Acinetobacter_phage	49.7	1.3e-165
AUL22131.1|892916_894569_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.5	1.7e-156
AUL22132.1|894740_894944_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22133.1|894918_895023_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22134.1|895026_896313_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	63.4	5.5e-150
AUL22135.1|896386_896758_+	cell division protein FtsB	NA	NA	NA	NA	NA
AUL22136.1|896776_897406_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22137.1|897485_898406_-	Hsp33 family molecular chaperone	NA	NA	NA	NA	NA
AUL22138.1|898444_898966_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AUL22139.1|898988_900656_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	33.4	9.8e-67
AUL22140.1|900851_901691_-	UDP-2,3-diacylglucosamine hydrolase	NA	A0A218MKA7	uncultured_virus	48.1	1.9e-66
AUL22141.1|901772_902297_-	RDD family protein	NA	NA	NA	NA	NA
AUL22142.1|902619_903120_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL22143.1|903212_903473_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL22144.1|903516_904524_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.4e-147
AUL22145.1|904720_904906_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22146.1|905138_906773_-	RNA methyltransferase	NA	NA	NA	NA	NA
AUL24547.1|906797_907220_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22147.1|907279_908740_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AUL22148.1|908795_909986_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
AUL22149.1|910059_910953_-	methylisocitrate lyase	NA	NA	NA	NA	NA
AUL22150.1|911143_912133_-	malate dehydrogenase	NA	NA	NA	NA	NA
AUL22151.1|912466_913246_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL22152.1|913367_913781_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
AUL22153.1|913780_914164_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
AUL22154.1|914167_915946_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
AUL22155.1|915959_916676_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
AUL22156.1|916701_916962_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
AUL22157.1|916982_918284_+	citrate (Si)-synthase	NA	NA	NA	NA	NA
AUL22158.1|918432_919437_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
>prophage 7
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	929935	994304	3691669	transposase,tRNA	Ralstonia_virus(44.44%)	49	NA	NA
AUL22168.1|929935_931156_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
AUL22169.1|931286_933569_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
AUL22170.1|933742_936400_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AUL22171.1|936635_938681_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
AUL22172.1|939018_941889_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
AUL22173.1|941935_943126_+	dihydrolipoamide succinyltransferase	NA	NA	NA	NA	NA
AUL22174.1|943196_944624_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	1.6e-41
AUL22175.1|944701_945793_+	cell division protein ZapE	NA	NA	NA	NA	NA
AUL22176.1|945931_946453_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL22177.1|946449_947361_+	transmembrane sensor protein	NA	NA	NA	NA	NA
AUL22178.1|947454_949914_+	ligand-gated channel	NA	NA	NA	NA	NA
AUL22179.1|950146_950311_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22180.1|951921_952260_+	iron uptake protein	NA	NA	NA	NA	NA
AUL22181.1|952303_953626_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUL22182.1|953679_956067_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
AUL22183.1|956232_958281_+	helicase	NA	A0A127AW80	Bacillus_phage	28.0	3.2e-75
AUL22184.1|958346_959171_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AUL22185.1|959247_960207_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AUL22186.1|960194_960959_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22187.1|961084_962710_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
AUL22188.1|962759_963497_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL22189.1|963588_964149_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
AUL22190.1|964322_964862_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22191.1|964864_965197_+	periplasmic lipoprotein involved in iron transport	NA	NA	NA	NA	NA
AUL22192.1|965207_966053_+	FTR1 family iron permease	NA	NA	NA	NA	NA
AUL22193.1|966074_967454_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22194.1|967502_968414_+	phenazine biosynthesis protein PhzC/PhzF	NA	NA	NA	NA	NA
AUL22195.1|968580_968916_-	phospholipid-binding protein	NA	NA	NA	NA	NA
AUL22196.1|968965_970186_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL22197.1|970307_970472_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
AUL22198.1|970529_970730_-	general stress protein CsbD	NA	NA	NA	NA	NA
AUL22199.1|971034_971568_-	cytochrome B	NA	A0A0U2QLA7	Escherichia_phage	43.3	8.3e-12
AUL22200.1|977190_979467_+	ABC transporter	NA	W8CYL7	Bacillus_phage	31.3	6.6e-58
AUL22201.1|979463_979943_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22202.1|979939_981073_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL22203.1|981125_981929_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22204.1|981962_983171_+	lytic transglycosylase	NA	NA	NA	NA	NA
AUL22205.1|983252_983681_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22206.1|984013_985570_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
AUL22207.1|985606_985927_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22208.1|986062_986794_+	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL22209.1|986852_987377_+	DedA family protein	NA	NA	NA	NA	NA
AUL22210.1|987428_988868_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL22211.1|989834_990164_+	regulator	NA	NA	NA	NA	NA
AUL22212.1|990160_990667_+	toxin	NA	NA	NA	NA	NA
AUL24548.1|990888_991821_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	76.8	1.9e-136
AUL22213.1|991890_992151_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL22214.1|992189_993011_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL22215.1|993083_994304_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	1096085	1128247	3691669	protease,transposase	Ralstonia_virus(33.33%)	33	NA	NA
AUL22300.1|1096085_1097306_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL22301.1|1097393_1097984_+	EamA family transporter	NA	NA	NA	NA	NA
AUL22302.1|1097971_1098283_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22303.1|1098334_1099324_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AUL22304.1|1099444_1100326_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
AUL22305.1|1100499_1101354_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22306.1|1101385_1102234_+	sulfurtransferase	NA	NA	NA	NA	NA
AUL22307.1|1102361_1103582_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
AUL22308.1|1103600_1104167_-	phosphohydrolase	NA	NA	NA	NA	NA
AUL22309.1|1104364_1105516_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUL22310.1|1105654_1106659_-	hypothetical protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
AUL22311.1|1106815_1107787_-	MFS transporter	NA	NA	NA	NA	NA
AUL22312.1|1107865_1108654_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL22313.1|1108725_1108962_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AUL22314.1|1108970_1109882_+	geranyl transferase	NA	NA	NA	NA	NA
AUL22315.1|1109925_1111797_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUL22316.1|1111957_1112755_+	GTP cyclohydrolase	NA	NA	NA	NA	NA
AUL22317.1|1112986_1113361_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
AUL22318.1|1113437_1113761_+	primosomal replication protein N	NA	NA	NA	NA	NA
AUL22319.1|1113844_1114117_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
AUL22320.1|1114131_1114587_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AUL22321.1|1114708_1115545_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22322.1|1115541_1116915_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
AUL22323.1|1117229_1118180_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL22324.1|1119084_1120062_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
AUL22325.1|1120186_1121842_-	phosphate starvation-inducible protein PhoH	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
AUL22326.1|1121890_1122355_-	peroxiredoxin	NA	NA	NA	NA	NA
AUL22327.1|1122351_1122813_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22328.1|1123038_1124226_+	alanine transaminase	NA	NA	NA	NA	NA
AUL22329.1|1124222_1125527_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
AUL22330.1|1125523_1126933_+	threonine synthase	NA	NA	NA	NA	NA
AUL22331.1|1127126_1127387_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL22332.1|1127425_1128247_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
>prophage 9
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	1133899	1194681	3691669	protease,transposase,tRNA	Leptospira_phage(23.53%)	53	NA	NA
AUL22337.1|1133899_1135360_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AUL22338.1|1135622_1136696_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
AUL22339.1|1136780_1138001_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
AUL22340.1|1139758_1140580_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL22341.1|1140618_1140879_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL24554.1|1140906_1142352_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AUL22342.1|1142365_1143469_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
AUL22343.1|1143473_1144724_+	glycolate oxidase iron-sulfur subunit	NA	NA	NA	NA	NA
AUL22344.1|1144720_1146166_-	NAD synthetase	NA	NA	NA	NA	NA
AUL22345.1|1146162_1146477_-	NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AUL22346.1|1147778_1148999_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
AUL22347.1|1149098_1149965_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
AUL22348.1|1150025_1151006_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL22349.1|1151152_1152073_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
AUL22350.1|1152081_1153194_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUL22351.1|1153275_1154097_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22352.1|1154172_1154781_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUL24555.1|1154918_1156295_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
AUL22353.1|1156356_1156800_+	cytochrome C	NA	NA	NA	NA	NA
AUL24556.1|1156866_1157538_-	cytochrome B	NA	NA	NA	NA	NA
AUL22354.1|1157565_1157826_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL22355.1|1157864_1158686_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL22356.1|1158854_1159136_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22357.1|1159846_1160635_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22358.1|1160631_1161738_+	AI-2E family transporter	NA	NA	NA	NA	NA
AUL22359.1|1162412_1163771_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
AUL22360.1|1163885_1164083_-	gas vesicle protein	NA	NA	NA	NA	NA
AUL22361.1|1164100_1164922_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL22362.1|1164960_1165221_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL22363.1|1165314_1165869_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
AUL22364.1|1166456_1167773_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22365.1|1167785_1168799_-	dimethylhistidine N-methyltransferase	NA	NA	NA	NA	NA
AUL22366.1|1170376_1170676_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22367.1|1172036_1173695_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
AUL22368.1|1173843_1175064_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22369.1|1175181_1176465_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
AUL22370.1|1176468_1177410_-	transporter	NA	NA	NA	NA	NA
AUL22371.1|1177519_1177978_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL24557.1|1178358_1178979_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AUL22372.1|1179386_1181807_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
AUL22373.1|1181914_1182652_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AUL22374.1|1182698_1183943_+	hypothetical protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
AUL22375.1|1184265_1184538_+	DNA-binding protein HU	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
AUL22376.1|1185121_1185850_+	energy transducer TonB	NA	NA	NA	NA	NA
AUL22377.1|1185871_1186789_+	flagellar motor protein MotA	NA	NA	NA	NA	NA
AUL22378.1|1186788_1187298_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUL22379.1|1187414_1188086_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL22380.1|1188195_1189263_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
AUL22381.1|1189246_1191127_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	3.5e-65
AUL22382.1|1191263_1192451_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22383.1|1192751_1193537_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22384.1|1193560_1193821_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL22385.1|1193859_1194681_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
>prophage 10
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	1202708	1265122	3691669	protease,transposase,tRNA	Ralstonia_virus(28.57%)	55	NA	NA
AUL22393.1|1202708_1203929_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL22394.1|1204004_1204286_+	malate dehydrogenase	NA	NA	NA	NA	NA
AUL22395.1|1206117_1207113_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL22396.1|1207155_1207926_+	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
AUL22397.1|1208051_1208315_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUL22398.1|1208516_1208663_-	transmembrane sensor protein	NA	NA	NA	NA	NA
AUL22399.1|1208716_1209667_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL22400.1|1209748_1210228_-	transmembrane sensor protein	NA	NA	NA	NA	NA
AUL22401.1|1211121_1211382_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL22402.1|1211439_1212639_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
AUL22403.1|1212784_1213162_-	cytochrome c family protein	NA	NA	NA	NA	NA
AUL22404.1|1213185_1214967_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
AUL22405.1|1214975_1215713_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22406.1|1215997_1217557_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
AUL22407.1|1217616_1218375_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL22408.1|1218471_1219128_-	adenylate kinase	NA	NA	NA	NA	NA
AUL22409.1|1219281_1220046_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AUL22410.1|1220060_1220240_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22411.1|1220265_1221300_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AUL22412.1|1221296_1221710_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUL22413.1|1221706_1222291_-	flagellar motor protein MotA	NA	NA	NA	NA	NA
AUL22414.1|1222643_1224002_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
AUL22415.1|1224095_1224674_+	superoxide dismutase	NA	NA	NA	NA	NA
AUL22416.1|1224798_1225620_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL22417.1|1225658_1225919_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL24559.1|1225946_1227248_+	chloride channel protein-related protein	NA	NA	NA	NA	NA
AUL22418.1|1227351_1228557_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AUL22419.1|1228620_1229070_-	hypothetical protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
AUL22420.1|1229202_1229448_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
AUL22421.1|1229672_1229987_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
AUL22422.1|1230078_1230363_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22423.1|1230630_1235193_+	alpha-2-macroglobulin	NA	NA	NA	NA	NA
AUL22424.1|1235240_1237346_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
AUL22425.1|1237399_1239709_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
AUL22426.1|1241062_1242730_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AUL22427.1|1242732_1243398_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22428.1|1243530_1247337_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL22429.1|1247562_1248708_+	branched chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL22430.1|1248826_1249756_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL22431.1|1249752_1250829_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL22432.1|1250825_1251632_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
AUL22433.1|1251628_1252360_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
AUL22434.1|1252563_1252746_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22435.1|1252736_1253975_-	ammonia channel protein	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
AUL22436.1|1254022_1254361_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL22437.1|1254608_1255559_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL22438.1|1255877_1256060_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22439.1|1256125_1257346_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL22440.1|1257439_1258660_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL22441.1|1258719_1258983_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22442.1|1259104_1260604_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AUL22443.1|1261024_1261222_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AUL22444.1|1261237_1261597_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AUL22445.1|1261669_1262692_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
AUL22446.1|1262704_1265122_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 11
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	1274469	1320843	3691669	transposase,holin,tRNA	Ralstonia_virus(20.0%)	46	NA	NA
AUL22458.1|1274469_1276431_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	29.9	2.3e-27
AUL22459.1|1276559_1276808_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22460.1|1276937_1277216_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22461.1|1277309_1277762_+	hypothetical protein	NA	G1JW61	Mycobacterium_phage	36.3	8.9e-07
AUL22462.1|1277758_1278229_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUL22463.1|1278520_1279114_+	twin-arginine translocation pathway signal	NA	NA	NA	NA	NA
AUL22464.1|1279161_1279446_+	CsbD family protein	NA	NA	NA	NA	NA
AUL22465.1|1279502_1279685_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22466.1|1279836_1280040_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22467.1|1280134_1280377_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22468.1|1280524_1280737_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22469.1|1280864_1281947_+	N-acylglucosamine 2-epimerase	NA	NA	NA	NA	NA
AUL22470.1|1282037_1282253_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22471.1|1282259_1282625_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUL22472.1|1282678_1284478_-	metal ABC transporter permease	NA	W8CYL7	Bacillus_phage	28.4	8.7e-45
AUL22473.1|1284627_1285002_+	2,5-diketo-D-gluconic acid reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.5e-20
AUL22474.1|1285025_1285286_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL22475.1|1285324_1286146_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AUL22476.1|1286629_1287616_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUL22477.1|1287662_1287869_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22478.1|1287865_1289041_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22479.1|1289218_1289872_+	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	47.7	6.3e-54
AUL22480.1|1289866_1292389_-	penicillin-binding protein	NA	NA	NA	NA	NA
AUL22481.1|1292560_1294477_-	S9 family peptidase	NA	NA	NA	NA	NA
AUL22482.1|1294609_1295056_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22483.1|1295084_1295513_-	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
AUL22484.1|1296140_1297361_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
AUL22485.1|1298095_1298557_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	44.1	2.0e-17
AUL22486.1|1298695_1299922_+	nitric oxide dioxygenase	NA	NA	NA	NA	NA
AUL22487.1|1299943_1300381_+	BadM/Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AUL22488.1|1300503_1301751_+	D-amino acid dehydrogenase small subunit	NA	NA	NA	NA	NA
AUL22489.1|1301758_1302592_-	class III aminotransferase	NA	NA	NA	NA	NA
AUL22490.1|1302588_1303116_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL22491.1|1303205_1304426_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL22492.1|1304433_1306098_-	long-chain-fatty-acid--CoA ligase	NA	Q75ZG1	Hepacivirus	27.3	2.0e-40
AUL22493.1|1306105_1306615_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22494.1|1306611_1307226_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
AUL22495.1|1307226_1308420_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUL22496.1|1308429_1310814_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL22497.1|1310873_1312166_-	fatty acid transporter	NA	NA	NA	NA	NA
AUL22498.1|1312187_1314146_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUL22499.1|1314142_1315435_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUL22500.1|1315445_1317776_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL22501.1|1317801_1318470_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL22502.1|1318849_1319794_+	serine acetyltransferase	NA	NA	NA	NA	NA
AUL22503.1|1319892_1320843_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 12
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	1555692	1612826	3691669	transposase,tRNA	Leptospira_phage(15.79%)	45	NA	NA
AUL22713.1|1555692_1556181_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AUL22714.1|1556295_1557411_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
AUL22715.1|1558043_1559207_+	MFS transporter	NA	NA	NA	NA	NA
AUL22716.1|1559389_1562047_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22717.1|1562050_1565440_+	nuclease	NA	NA	NA	NA	NA
AUL22718.1|1565830_1567900_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.7	8.2e-47
AUL22719.1|1567938_1568265_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AUL22720.1|1568279_1568888_+	recombination protein RecR	NA	NA	NA	NA	NA
AUL22721.1|1570328_1571369_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL22722.1|1571361_1572171_+	mannosyltransferase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.5	1.1e-12
AUL22723.1|1572176_1572971_+	ABC transporter permease	NA	NA	NA	NA	NA
AUL24575.1|1573034_1573991_-	transaldolase	NA	M4SPL0	Cyanophage	30.7	3.6e-13
AUL22724.1|1574214_1575369_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.1	2.6e-50
AUL22725.1|1575379_1578619_+	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
AUL22726.1|1578683_1579580_+	aspartyl beta-hydroxylase	NA	H8ZJK8	Ostreococcus_tauri_virus	38.3	2.2e-36
AUL22727.1|1579647_1580409_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL22728.1|1580414_1581053_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AUL22729.1|1581045_1581954_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL22730.1|1583059_1584751_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL22731.1|1584818_1586141_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL22732.1|1586238_1586514_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22733.1|1586649_1587966_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	68.0	2.9e-154
AUL22734.1|1588166_1588595_+	transcriptional regulator	NA	A0A1X9I5R1	Streptococcus_phage	30.3	4.2e-06
AUL22735.1|1588660_1589881_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL22736.1|1590235_1590712_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AUL22737.1|1590970_1591579_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22738.1|1591597_1592269_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AUL22739.1|1592442_1594329_+	cell division protein FtsH	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
AUL22740.1|1594356_1595199_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
AUL22741.1|1595195_1596539_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
AUL22742.1|1596723_1597539_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL22743.1|1597604_1599086_-	exopolyphosphatase	NA	NA	NA	NA	NA
AUL22744.1|1599284_1601357_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
AUL22745.1|1601576_1602614_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
AUL22746.1|1602735_1604658_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22747.1|1604685_1605462_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
AUL22748.1|1606289_1606799_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22749.1|1607040_1607745_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	36.5	1.9e-27
AUL22750.1|1607876_1608647_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL24576.1|1608643_1609654_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL24577.1|1609712_1609973_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL24578.1|1610005_1610794_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.5	1.4e-44
AUL22751.1|1610961_1611222_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL22752.1|1611260_1612082_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AUL22753.1|1612136_1612826_+	hypothetical protein	NA	A0A1B0VBP7	Salmonella_phage	47.1	1.3e-49
>prophage 13
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	1630084	1677083	3691669	transposase,tRNA	Ralstonia_virus(20.0%)	47	NA	NA
AUL22771.1|1630084_1631305_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL22772.1|1631563_1632169_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22773.1|1632179_1633340_+	succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
AUL22774.1|1633361_1634243_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
AUL22775.1|1634539_1635238_+	hypothetical protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
AUL22776.1|1635379_1636102_+	hypothetical protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
AUL22777.1|1636220_1637159_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AUL22778.1|1637189_1637969_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AUL22779.1|1637955_1639179_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
AUL22780.1|1639183_1640731_+	protoheme IX synthesis protein	NA	NA	NA	NA	NA
AUL22781.1|1640766_1641300_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
AUL24580.1|1641543_1642239_+	5-carboxymethyl-2-hydroxymuconate isomerase	NA	NA	NA	NA	NA
AUL22782.1|1642253_1642385_+	entericidin	NA	NA	NA	NA	NA
AUL22783.1|1642432_1643557_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL22784.1|1643562_1645902_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
AUL22785.1|1645898_1646306_-	heat-shock protein Hsp20	NA	NA	NA	NA	NA
AUL22786.1|1646567_1646828_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22787.1|1647050_1648001_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL22788.1|1648050_1649259_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL22789.1|1649480_1650020_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL22790.1|1650244_1650649_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL22791.1|1650713_1651469_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
AUL22792.1|1651468_1652830_+	secretion protein	NA	NA	NA	NA	NA
AUL22793.1|1652826_1653450_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL22794.1|1653493_1653754_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL22795.1|1653792_1654614_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL22796.1|1654564_1655269_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL22797.1|1655265_1656021_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL24581.1|1656197_1656992_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL22798.1|1656988_1657426_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22799.1|1658110_1659079_-	homoserine kinase	NA	NA	NA	NA	NA
AUL24582.1|1659235_1660243_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AUL22800.1|1660300_1660759_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22801.1|1660832_1662179_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22802.1|1662196_1662568_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22803.1|1662567_1664037_+	hypothetical protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
AUL22804.1|1664192_1664918_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22805.1|1664931_1667646_-	histidine kinase	NA	NA	NA	NA	NA
AUL22806.1|1667897_1669262_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUL22807.1|1669301_1670360_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
AUL22808.1|1670387_1671206_+	peptidase M48	NA	NA	NA	NA	NA
AUL24583.1|1671243_1671522_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AUL22809.1|1672467_1672728_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL22810.1|1672785_1673085_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AUL22811.1|1673654_1675058_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AUL22812.1|1675070_1675721_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AUL22813.1|1675862_1677083_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 14
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	1681285	1801146	3691669	transposase,integrase,holin,tRNA	Leptospira_phage(16.67%)	116	1718700:1718759	1796179:1796517
AUL22817.1|1681285_1682101_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AUL24584.1|1682148_1683186_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL22818.1|1683237_1683897_+	N-(5'-phosphoribosyl)anthranilate isomerase	NA	NA	NA	NA	NA
AUL22819.1|1684536_1685412_-|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL22820.1|1685408_1685699_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL22821.1|1686463_1686724_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL22822.1|1687122_1687812_+	permease	NA	NA	NA	NA	NA
AUL22823.1|1687911_1688073_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22824.1|1688514_1688751_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22825.1|1688940_1689189_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22826.1|1689302_1690673_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AUL22827.1|1690673_1691414_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL22828.1|1691900_1693853_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
AUL22829.1|1693873_1694422_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.3	3.8e-12
AUL22830.1|1694587_1695544_+	glutathione synthase	NA	NA	NA	NA	NA
AUL24585.1|1695557_1695956_+	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
AUL24586.1|1696018_1696288_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AUL22831.1|1696316_1698092_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AUL22832.1|1698139_1698349_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22833.1|1698395_1698818_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AUL22834.1|1698937_1699915_+	ornithine cyclodeaminase	NA	NA	NA	NA	NA
AUL22835.1|1699983_1701147_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL22836.1|1701315_1702203_+	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
AUL22837.1|1702213_1702855_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
AUL22838.1|1702851_1703523_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
AUL22839.1|1703522_1704293_+	ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA	NA	G9BWD6	Planktothrix_phage	35.8	2.0e-27
AUL22840.1|1704343_1704793_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	Q2NP83	Xanthomonas_phage	62.8	2.3e-47
AUL22841.1|1704834_1705293_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22842.1|1705313_1705946_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22843.1|1706055_1706523_+	hydrolase	NA	NA	NA	NA	NA
AUL22844.1|1706544_1707087_+	hydrolase	NA	NA	NA	NA	NA
AUL22845.1|1707099_1707804_+	dipeptidase E	NA	NA	NA	NA	NA
AUL22846.1|1707822_1708293_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL22847.1|1708385_1709126_+	permease	NA	NA	NA	NA	NA
AUL22848.1|1709169_1709430_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL22849.1|1710305_1711517_-	phosphopantothenate synthase	NA	Q9HH70	Methanothermobacter_phage	30.4	2.2e-36
AUL22850.1|1711577_1712093_-	signal peptidase II	NA	NA	NA	NA	NA
AUL22851.1|1712095_1714957_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
AUL24587.1|1714946_1715912_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
AUL22852.1|1716668_1718144_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AUL22853.1|1718148_1718424_-	hypothetical protein	NA	NA	NA	NA	NA
1718700:1718759	attL	GTGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGC	NA	NA	NA	NA
AUL22854.1|1718760_1719021_+|transposase	transposase	transposase	NA	NA	NA	NA
1718700:1718759	attL	GTGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGC	NA	NA	NA	NA
AUL22855.1|1719059_1719881_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AUL22856.1|1720181_1721390_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
AUL22857.1|1721386_1723669_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
AUL22858.1|1723679_1726061_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL22859.1|1726324_1728232_-	ABC transporter	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
AUL22860.1|1728246_1729137_-	ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUL22861.1|1729143_1730277_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AUL22862.1|1730276_1731098_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AUL22863.1|1731122_1732313_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
AUL22864.1|1732614_1732896_+|integrase	integrase	integrase	NA	NA	NA	NA
AUL22865.1|1733061_1733382_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22866.1|1733421_1733688_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL24588.1|1733720_1734509_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.5	1.4e-44
AUL22867.1|1734704_1734965_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22868.1|1735043_1735304_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL22869.1|1735457_1736228_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
1734983:1735379	attR	GTGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGCAATGAAGAAACGATTTACGGAAGAGCAAATCATCGGCGTGCTCAAGGAAGCCGATGCAGGTGCCAAGCCCGCAGAGTTGTGCCGCAAGCACGGAATCTCCGAGGCAACGTACTACAACTGGAAGGCGAAGTTCGGTGGCATGACGGTGTCGGACGCTCAGAGGCTCAAGGAGCTGGAGCAGGAGAACAACAAGCTCAAGAAGCTGTTGGCCGAGTCGATGCTGGACAAGGCGGCGCTTCAGGATCTGCTAAGCCGAAAGTAGTCAGCCCGCAGGCCAAACGCGAGGCGGTCAGGACATTAATGACCGAGCGCAGCATGGGTGTTACCCGGGCCTGTG	NA	NA	NA	NA
AUL24589.1|1736224_1737235_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
1734983:1735379	attR	GTGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGCAATGAAGAAACGATTTACGGAAGAGCAAATCATCGGCGTGCTCAAGGAAGCCGATGCAGGTGCCAAGCCCGCAGAGTTGTGCCGCAAGCACGGAATCTCCGAGGCAACGTACTACAACTGGAAGGCGAAGTTCGGTGGCATGACGGTGTCGGACGCTCAGAGGCTCAAGGAGCTGGAGCAGGAGAACAACAAGCTCAAGAAGCTGTTGGCCGAGTCGATGCTGGACAAGGCGGCGCTTCAGGATCTGCTAAGCCGAAAGTAGTCAGCCCGCAGGCCAAACGCGAGGCGGTCAGGACATTAATGACCGAGCGCAGCATGGGTGTTACCCGGGCCTGTG	NA	NA	NA	NA
AUL24590.1|1737293_1738112_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.2e-54
AUL22870.1|1738574_1739360_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
AUL22871.1|1740219_1740480_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL22872.1|1740518_1741340_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL22873.1|1742405_1743410_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
AUL22874.1|1743485_1744298_+	nucleotide pyrophosphatase	NA	NA	NA	NA	NA
AUL22875.1|1744525_1746697_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AUL22876.1|1746750_1748070_-	MFS transporter	NA	NA	NA	NA	NA
AUL22877.1|1748158_1749379_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL22878.1|1749597_1750458_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL22879.1|1750454_1751678_-	MFS transporter	NA	NA	NA	NA	NA
AUL22880.1|1751976_1752474_+	osmotically inducible protein Y	NA	NA	NA	NA	NA
AUL22881.1|1752512_1753295_-	hydrolase	NA	NA	NA	NA	NA
AUL22882.1|1753320_1753539_-	SlyX protein	NA	NA	NA	NA	NA
AUL22883.1|1753613_1753883_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22884.1|1754102_1754567_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL22885.1|1754640_1754922_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUL24591.1|1755038_1756022_-|integrase	integrase	integrase	NA	NA	NA	NA
AUL22886.1|1756265_1757264_+	cointegrate resolution protein	NA	NA	NA	NA	NA
AUL22887.1|1757366_1757798_+	energy transducer TonB	NA	NA	NA	NA	NA
AUL22888.1|1757862_1758774_+	3-phosphoglycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	30.7	3.7e-20
AUL22889.1|1758906_1760988_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AUL22890.1|1761026_1761731_-	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AUL22891.1|1761823_1762708_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL22892.1|1762783_1763185_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22893.1|1763275_1763422_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
AUL22894.1|1763683_1764619_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL22895.1|1764700_1765354_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL22896.1|1765970_1766447_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL22897.1|1766471_1767266_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL22898.1|1767282_1768263_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL22899.1|1768435_1768648_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22900.1|1769061_1770837_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	3.5e-38
AUL22901.1|1770852_1772517_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
AUL22902.1|1772529_1775241_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AUL24592.1|1775786_1777541_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
AUL22903.1|1777537_1778164_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL22904.1|1778160_1779015_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.8	1.4e-29
AUL22905.1|1779134_1781189_+	oligopeptidase A	NA	NA	NA	NA	NA
AUL22906.1|1781298_1782249_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL22907.1|1782245_1782761_-	methyltransferase	NA	NA	NA	NA	NA
AUL22908.1|1783118_1783739_+	SCO family protein	NA	NA	NA	NA	NA
AUL22909.1|1783838_1784090_+	hypothetical protein	NA	NA	NA	NA	NA
AUL22910.1|1784177_1785656_-	multidrug transporter	NA	NA	NA	NA	NA
AUL22911.1|1785652_1788823_-	multidrug efflux RND transporter permease	NA	NA	NA	NA	NA
AUL22912.1|1788835_1790032_-	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUL22913.1|1790220_1791153_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL22914.1|1791220_1791952_-	pseudouridylate synthase	NA	NA	NA	NA	NA
AUL22915.1|1792017_1792653_+	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AUL22916.1|1792638_1793817_-	arabinose transporter	NA	NA	NA	NA	NA
AUL22917.1|1793977_1794526_-	hypothetical protein	NA	NA	NA	NA	NA
AUL22918.1|1794606_1794966_+	lysine transporter LysE	NA	NA	NA	NA	NA
AUL22919.1|1795013_1796234_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL22920.1|1796309_1797431_-	transporter	NA	NA	NA	NA	NA
AUL22921.1|1797468_1798182_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
AUL22922.1|1798192_1799413_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
AUL22923.1|1800195_1801146_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 15
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	1964342	2020746	3691669	transposase,integrase	Leptospira_phage(22.22%)	46	1959026:1959041	1988981:1988996
1959026:1959041	attL	GGCTGTTGCCGGCAAG	NA	NA	NA	NA
AUL23072.1|1964342_1964603_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL23073.1|1964626_1964821_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23074.1|1964820_1967028_-	outer membrane receptor protein	NA	NA	NA	NA	NA
AUL23075.1|1967300_1968098_+	enterobactin-dependent positive regulator	NA	NA	NA	NA	NA
AUL23076.1|1968143_1969199_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUL23077.1|1969233_1969428_-|integrase	integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	52.8	1.1e-06
AUL23078.1|1969424_1970306_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AUL23079.1|1970662_1971547_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23080.1|1971971_1974200_+	isocitrate dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AUL23081.1|1974484_1974949_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23082.1|1974955_1976473_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23083.1|1976521_1977274_-	polar amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	4.3e-30
AUL23084.1|1977281_1977935_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL23085.1|1977971_1978760_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL23086.1|1978877_1979459_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AUL23087.1|1979741_1980125_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23088.1|1980709_1981039_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23089.1|1982218_1982947_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.1	1.8e-09
AUL24601.1|1982943_1983708_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.3e-18
AUL23090.1|1983707_1985591_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL23091.1|1985603_1986809_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL23092.1|1988525_1989260_-	hypothetical protein	NA	NA	NA	NA	NA
1988981:1988996	attR	GGCTGTTGCCGGCAAG	NA	NA	NA	NA
AUL23093.1|1989436_1990228_+	hydratase	NA	NA	NA	NA	NA
AUL23094.1|1990250_1991795_-	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	42.9	8.8e-38
AUL23095.1|1992539_1993739_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AUL23096.1|1994175_1994799_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL23097.1|1994804_1998461_+	virulence sensor protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.0	6.5e-39
AUL23098.1|2000649_2002347_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23099.1|2002731_2002992_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL23100.1|2003030_2003852_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL23101.1|2003884_2004199_+	glutamate decarboxylase	NA	NA	NA	NA	NA
AUL23102.1|2004288_2005989_+	transporter	NA	NA	NA	NA	NA
AUL23103.1|2006068_2006446_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23104.1|2006582_2007308_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL23105.1|2007440_2008427_+	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL23106.1|2008429_2008903_+	TRAP transporter small permease protein	NA	NA	NA	NA	NA
AUL23107.1|2008907_2010191_+	C4-dicarboxylate ABC transporter permease	NA	NA	NA	NA	NA
AUL23108.1|2010187_2011078_+	CoA ester lyase	NA	NA	NA	NA	NA
AUL23109.1|2011074_2012772_+	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.7	4.0e-31
AUL23110.1|2014096_2015596_+	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
AUL23111.1|2015668_2016187_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23112.1|2016260_2017151_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AUL23113.1|2017208_2018462_+	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUL23114.1|2018496_2019261_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL23115.1|2019625_2020447_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AUL23116.1|2020485_2020746_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 16
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	2061006	2130802	3691669	transposase	Ralstonia_virus(17.65%)	54	NA	NA
AUL23150.1|2061006_2062227_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	2.7e-183
AUL24604.1|2062284_2063061_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AUL23151.1|2063363_2064410_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL23152.1|2064511_2066173_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AUL23153.1|2066177_2066954_+	ABC transporter	NA	G9BWD6	Planktothrix_phage	36.0	1.9e-25
AUL23154.1|2066967_2067873_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23155.1|2068934_2069759_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL23156.1|2069887_2071390_-	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
AUL23157.1|2071389_2072454_-	PAS domain-containing sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.6	2.5e-07
AUL23158.1|2072547_2073960_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
AUL23159.1|2074141_2075365_-	YggW family oxidoreductase	NA	NA	NA	NA	NA
AUL23160.1|2075370_2075994_-	non-canonical purine NTP pyrophosphatase, RdgB/HAM1 family	NA	NA	NA	NA	NA
AUL23161.1|2076183_2077974_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUL23162.1|2077893_2079633_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.7	2.2e-13
AUL23163.1|2079708_2080929_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	2.7e-183
AUL23164.1|2080944_2081859_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL23165.1|2081986_2083147_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL23166.1|2083152_2084511_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AUL23167.1|2084524_2084929_-	preprotein translocase subunit TatC	NA	NA	NA	NA	NA
AUL23168.1|2085016_2085769_-	ribonuclease PH	NA	NA	NA	NA	NA
AUL23169.1|2085886_2086819_+	YicC family protein	NA	NA	NA	NA	NA
AUL23170.1|2086901_2088209_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
AUL23171.1|2088280_2089771_-	AMP nucleosidase	NA	NA	NA	NA	NA
AUL23172.1|2090022_2090607_+	NlpC/P60 family protein 2	NA	A0A0A8WF62	Clostridium_phage	42.3	2.0e-22
AUL23173.1|2090643_2091414_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL23174.1|2091587_2092220_+	guanylate kinase	NA	A0A223FN12	Murmansk_poxvirus	34.0	7.8e-17
AUL23175.1|2092263_2092467_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AUL23176.1|2092490_2094788_+	guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	32.8	2.0e-06
AUL23177.1|2094890_2095619_-	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	9.6e-35
AUL23178.1|2095615_2096275_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AUL23179.1|2096357_2097110_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
AUL23180.1|2097524_2098337_+	peptidase C45	NA	NA	NA	NA	NA
AUL23181.1|2098333_2100013_-	filamentous hemagglutinin	NA	NA	NA	NA	NA
AUL23182.1|2100089_2101130_-	adhesin	NA	NA	NA	NA	NA
AUL23183.1|2101197_2103726_-	outer membrane fimbrial usher protein	NA	NA	NA	NA	NA
AUL23184.1|2103740_2104535_-	molecular chaperone	NA	NA	NA	NA	NA
AUL24605.1|2104643_2105087_-	fimbrial protein	NA	NA	NA	NA	NA
AUL23185.1|2105046_2106219_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.3	1.6e-148
AUL23186.1|2113419_2114370_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL23187.1|2114356_2116198_-	hypothetical protein	NA	A0A0R6PJK4	Moraxella_phage	29.1	6.6e-24
AUL23188.1|2116544_2117495_+	EamA family transporter	NA	NA	NA	NA	NA
AUL23189.1|2117491_2118172_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	40.3	5.8e-34
AUL23190.1|2118206_2118830_+	arylesterase	NA	NA	NA	NA	NA
AUL23191.1|2118811_2120767_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUL23192.1|2121038_2121788_+	glycerophosphodiester phosphodiesterase	NA	A0A1J0F961	Only_Syngen_Nebraska_virus	27.5	6.2e-13
AUL23193.1|2121799_2122672_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
AUL23194.1|2122682_2124095_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
AUL23195.1|2124204_2124933_-	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	56.0	7.3e-43
AUL23196.1|2125069_2125270_-	heavy metal transporter	NA	NA	NA	NA	NA
AUL23197.1|2125421_2127695_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.2	4.1e-92
AUL23198.1|2127691_2128087_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUL23199.1|2128083_2129610_-	23S rRNA (uracil(1939)-C(5))-methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	25.4	1.7e-28
AUL23200.1|2129681_2129942_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL23201.1|2129980_2130802_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
>prophage 17
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	2140582	2200903	3691669	protease,transposase,tRNA	Ralstonia_virus(21.43%)	60	NA	NA
AUL23214.1|2140582_2141620_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.7	5.6e-97
AUL23215.1|2141704_2142997_+	guanine permease	NA	A0A0R6PHV4	Moraxella_phage	36.7	2.9e-66
AUL23216.1|2143179_2144196_+	luciferase	NA	NA	NA	NA	NA
AUL23217.1|2144304_2144688_+	thioredoxin	NA	V9SJ74	Achromobacter_phage	26.8	1.2e-09
AUL24606.1|2144691_2145048_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23218.1|2145068_2145299_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23219.1|2145322_2146120_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL23220.1|2146124_2146892_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL23221.1|2146888_2147884_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL23222.1|2147933_2148698_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	6.3e-29
AUL23223.1|2148870_2150475_-	ABC-F family ATPase	NA	A0A1V0SKJ1	Klosneuvirus	28.9	7.7e-53
AUL23224.1|2150728_2151709_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AUL23225.1|2151705_2152194_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
AUL23226.1|2152186_2153035_-	hydrolase	NA	NA	NA	NA	NA
AUL23227.1|2153126_2153624_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23228.1|2153761_2154121_-	cation:proton antiporter	NA	NA	NA	NA	NA
AUL23229.1|2154117_2154399_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
AUL23230.1|2154398_2154881_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
AUL23231.1|2154882_2156511_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
AUL23232.1|2156507_2156852_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
AUL23233.1|2156853_2159796_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
AUL23234.1|2160241_2161213_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL24607.1|2161202_2162585_-	GTP-binding protein	NA	NA	NA	NA	NA
AUL23235.1|2162727_2163678_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL23236.1|2163637_2164879_-	GTP-binding protein	NA	NA	NA	NA	NA
AUL24608.1|2164875_2165997_-	DNA repair exonuclease	NA	NA	NA	NA	NA
AUL23237.1|2167488_2167956_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL23238.1|2168026_2168677_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23239.1|2168763_2169903_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23240.1|2170071_2171076_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
AUL23241.1|2171072_2172320_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUL23242.1|2172672_2173539_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
AUL23243.1|2173498_2175103_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL23244.1|2175114_2175801_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
AUL23245.1|2175797_2176838_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL23246.1|2176953_2177625_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL24609.1|2177645_2178614_+	secretion protein HlyD	NA	NA	NA	NA	NA
AUL23247.1|2178610_2179549_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
AUL23248.1|2179545_2180700_+	mannose-1-phosphate guanyltransferase	NA	NA	NA	NA	NA
AUL23249.1|2180708_2182160_+	ABC transporter permease	NA	NA	NA	NA	NA
AUL23250.1|2182190_2182673_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23251.1|2182674_2183568_+	hypothetical protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
AUL23252.1|2183564_2184008_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23253.1|2184020_2184398_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23254.1|2184537_2184936_+|protease	membrane-associated protease	protease	NA	NA	NA	NA
AUL23255.1|2185062_2185350_+|protease	CAAX protease family protein	protease	NA	NA	NA	NA
AUL23256.1|2185346_2185763_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUL23257.1|2185938_2186571_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
AUL23258.1|2186599_2187046_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
AUL23259.1|2187332_2188484_+	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUL23260.1|2188597_2189602_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
AUL23261.1|2189547_2190357_-	chemotaxis protein	NA	NA	NA	NA	NA
AUL23262.1|2190585_2191293_+	cell division protein	NA	NA	NA	NA	NA
AUL23263.1|2191225_2192677_+	DNA polymerase	NA	NA	NA	NA	NA
AUL23264.1|2192682_2195841_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
AUL23265.1|2195853_2196375_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
AUL23266.1|2196364_2197189_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AUL23267.1|2197185_2197785_-	ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
AUL23268.1|2197893_2199750_-	phosphoenolpyruvate carboxykinase	NA	NA	NA	NA	NA
AUL23269.1|2199898_2200903_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
>prophage 18
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	2283154	2341566	3691669	transposase,tRNA	Shigella_phage(22.22%)	50	NA	NA
AUL23346.1|2283154_2283415_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL23347.1|2283625_2284924_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUL23348.1|2284966_2285995_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUL23349.1|2286109_2286676_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
AUL23350.1|2286734_2287580_-	phosphatase	NA	NA	NA	NA	NA
AUL24615.1|2287637_2288513_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUL23351.1|2288764_2289379_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23352.1|2289388_2290609_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL23353.1|2290657_2291323_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23354.1|2291370_2292366_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23355.1|2295543_2296458_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL23356.1|2296607_2297573_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL23357.1|2297580_2297997_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUL23358.1|2297993_2298911_+	oxidoreductase	NA	NA	NA	NA	NA
AUL23359.1|2298922_2299342_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23360.1|2299250_2300639_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL24616.1|2300635_2300887_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23361.1|2301057_2302014_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL23362.1|2301996_2302209_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23363.1|2302258_2303032_+	MBL fold hydrolase	NA	NA	NA	NA	NA
AUL23364.1|2303028_2304162_+	malate dehydrogenase	NA	NA	NA	NA	NA
AUL23365.1|2304171_2305122_+	D-3-phosphoglycerate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	28.4	4.8e-18
AUL23366.1|2305153_2305954_+	aldolase	NA	NA	NA	NA	NA
AUL23367.1|2305968_2307123_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23368.1|2306950_2307826_-|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL23369.1|2307822_2308113_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL23370.1|2308225_2309194_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23371.1|2309190_2310111_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23372.1|2310207_2314686_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23373.1|2315064_2319399_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23374.1|2320037_2320601_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23375.1|2320612_2320858_-	RNA-binding protein	NA	NA	NA	NA	NA
AUL23376.1|2321013_2321523_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL23377.1|2321568_2322549_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL23378.1|2322760_2325112_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL24617.1|2325158_2325965_-	DNAase	NA	NA	NA	NA	NA
AUL23379.1|2325985_2326675_-	lipoprotein ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	3.1e-35
AUL23380.1|2326667_2327948_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL23381.1|2328045_2328984_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23382.1|2328965_2330672_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
AUL23383.1|2331905_2332655_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL23384.1|2332661_2334176_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
AUL23385.1|2334188_2334476_+	hypothetical protein	NA	NA	NA	NA	NA
AUL24618.1|2334496_2335384_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AUL23386.1|2335534_2336041_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL23387.1|2336037_2336994_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL23388.1|2337181_2338528_+	protein FpvAIII	NA	NA	NA	NA	NA
AUL23389.1|2339473_2340244_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL24619.1|2340240_2341251_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL23390.1|2341320_2341566_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 19
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	2357476	2383873	3691669	protease,transposase	Leptospira_phage(21.43%)	21	NA	NA
AUL23408.1|2357476_2358520_+	alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
AUL24620.1|2358516_2358618_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23409.1|2358709_2358970_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL23410.1|2359008_2359830_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL23411.1|2360079_2360733_+	repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
AUL23412.1|2360848_2362069_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL23413.1|2362119_2364549_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
AUL23414.1|2364714_2366013_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
AUL23415.1|2366117_2366771_-	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
AUL23416.1|2366773_2368084_-	trigger factor	NA	NA	NA	NA	NA
AUL23417.1|2368311_2368851_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
AUL23418.1|2369291_2370113_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL23419.1|2370151_2370412_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL23420.1|2370539_2370734_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23421.1|2376816_2377107_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL23422.1|2377103_2377979_+|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL23423.1|2378363_2379827_+	ribonuclease E/G	NA	NA	NA	NA	NA
AUL23424.1|2379959_2381510_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
AUL23425.1|2381821_2382643_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL23426.1|2382681_2382942_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL23427.1|2383018_2383873_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	77.8	7.3e-127
>prophage 20
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	2465870	2509697	3691669	protease,transposase,tRNA	Shigella_phage(40.0%)	35	NA	NA
AUL23496.1|2465870_2466518_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AUL23497.1|2466602_2467229_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AUL24625.1|2467293_2468139_+	hypothetical protein	NA	A0A1I9SA48	Rhodococcus_phage	35.1	2.4e-37
AUL23498.1|2468468_2469020_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23499.1|2469783_2470077_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23500.1|2470291_2470621_-	alkylhydroperoxidase	NA	NA	NA	NA	NA
AUL23501.1|2471204_2472665_+	cardiolipin synthase	NA	NA	NA	NA	NA
AUL23502.1|2472623_2472848_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23503.1|2473224_2474544_-	MFS transporter	NA	NA	NA	NA	NA
AUL23504.1|2474586_2475060_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23505.1|2475056_2476067_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23506.1|2476131_2477097_-	pyridoxal-5'-phosphate-dependent protein	NA	NA	NA	NA	NA
AUL23507.1|2477221_2477482_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL23508.1|2478325_2479201_-|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL23509.1|2479197_2479488_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL23510.1|2479757_2480675_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL23511.1|2482030_2483317_+	phospholipase	NA	NA	NA	NA	NA
AUL23512.1|2483410_2484010_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23513.1|2484234_2484756_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23514.1|2485021_2485576_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23515.1|2485595_2486957_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23516.1|2487309_2489889_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AUL23517.1|2489935_2491042_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AUL23518.1|2491188_2491698_+	dehydratase	NA	NA	NA	NA	NA
AUL23519.1|2491721_2492702_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUL24626.1|2492707_2494123_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AUL23520.1|2494119_2495292_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL23521.1|2495288_2496509_+	CoA transferase	NA	NA	NA	NA	NA
AUL23522.1|2496505_2497303_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL23523.1|2498111_2502791_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	28.4	1.1e-27
AUL23524.1|2505939_2506902_-	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL23525.1|2506898_2507417_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL23526.1|2507570_2507891_+	amidohydrolase	NA	NA	NA	NA	NA
AUL23527.1|2508576_2508837_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL23528.1|2508875_2509697_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.4	2.9e-56
>prophage 21
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	2548518	2649238	3691669	transposase,tRNA	Ralstonia_virus(15.79%)	97	NA	NA
AUL23563.1|2548518_2548779_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL23564.1|2549788_2550304_+	hypothetical protein	NA	T1SAR8	Salmonella_phage	44.6	3.9e-06
AUL23565.1|2550576_2550891_+	virulence factor	NA	NA	NA	NA	NA
AUL23566.1|2551078_2551315_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23567.1|2551605_2552961_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.5	2.1e-83
AUL24629.1|2553007_2554348_-	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	38.9	9.3e-76
AUL23568.1|2554449_2555082_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUL23569.1|2555081_2557451_-	cell division protein FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	2.2e-80
AUL23570.1|2557483_2558443_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	40.5	4.8e-58
AUL23571.1|2558429_2559122_+	DNA mismatch repair protein MutS	NA	NA	NA	NA	NA
AUL23572.1|2559118_2559451_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AUL23573.1|2559566_2560517_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL23574.1|2560513_2562580_-	cation acetate symporter	NA	NA	NA	NA	NA
AUL23575.1|2562579_2562852_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23576.1|2563546_2563636_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUL23577.1|2563635_2565420_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AUL23578.1|2565443_2567609_+	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.9	7.8e-24
AUL23579.1|2567619_2568219_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AUL23580.1|2570982_2571678_+	two-component system response regulator KdpE	NA	NA	NA	NA	NA
AUL23581.1|2571686_2572928_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23582.1|2573077_2574058_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23583.1|2574256_2575513_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	1.2e-11
AUL23584.1|2575715_2576141_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23585.1|2576191_2576554_-	cytochrome	NA	NA	NA	NA	NA
AUL24630.1|2577082_2577970_+	ATP-binding protein	NA	NA	NA	NA	NA
AUL23586.1|2579166_2579409_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUL23587.1|2579405_2579780_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23588.1|2580112_2582863_+	peptidase M16	NA	A0A2K9LA15	Tupanvirus	28.1	1.5e-19
AUL23589.1|2583031_2584177_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	60.8	4.0e-19
AUL23590.1|2584277_2586203_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.7	2.7e-145
AUL23591.1|2586291_2586666_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUL23592.1|2586687_2587218_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUL23593.1|2587331_2587565_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23594.1|2587651_2588743_-	ferrochelatase	NA	NA	NA	NA	NA
AUL23595.1|2588775_2589780_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AUL23596.1|2589889_2590789_+	NAD kinase	NA	NA	NA	NA	NA
AUL23597.1|2590810_2592466_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AUL24631.1|2592570_2593314_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	73.7	2.1e-101
AUL23598.1|2594143_2594404_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL23599.1|2595118_2595535_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
AUL24632.1|2595805_2596303_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23600.1|2596318_2597110_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AUL23601.1|2597167_2598154_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AUL24633.1|2598500_2599046_-|transposase	transposase	transposase	U5P429	Shigella_phage	66.3	2.2e-68
AUL23602.1|2599088_2599349_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL23603.1|2599441_2599942_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL23604.1|2600458_2601112_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
AUL24634.1|2601293_2602001_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL23605.1|2601997_2604613_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
AUL23606.1|2604669_2605854_+	putative methylaconitate Delta-isomerase PrpF	NA	NA	NA	NA	NA
AUL23607.1|2605914_2606523_+	lysine transporter LysE	NA	NA	NA	NA	NA
AUL23608.1|2606645_2607671_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUL23609.1|2607734_2608265_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL23610.1|2608144_2608486_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23611.1|2608482_2609190_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL23612.1|2609199_2610093_-	carboxyvinyl-carboxyphosphonate phosphorylmutase	NA	NA	NA	NA	NA
AUL23613.1|2610076_2610835_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL23614.1|2611126_2613802_+	aconitate hydratase 1	NA	NA	NA	NA	NA
AUL23615.1|2613818_2615180_+	dihydroorotase	NA	NA	NA	NA	NA
AUL23616.1|2615199_2615922_+	hydrolase	NA	NA	NA	NA	NA
AUL23617.1|2615926_2616925_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
AUL23618.1|2617345_2617654_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23619.1|2617701_2618274_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23620.1|2618251_2618656_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23621.1|2618774_2619692_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL23622.1|2619701_2620283_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AUL23623.1|2620279_2621032_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUL23624.1|2621074_2621794_+	arginyltransferase	NA	NA	NA	NA	NA
AUL23625.1|2621836_2622892_+	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AUL23626.1|2623001_2623844_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	77.8	4.5e-129
AUL23627.1|2623901_2624162_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL23628.1|2624200_2625022_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL23629.1|2625581_2626160_-	Phasin (PHA-granule associated protein)	NA	NA	NA	NA	NA
AUL23630.1|2626302_2627523_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL23631.1|2627827_2628805_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL23632.1|2628953_2629784_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL23633.1|2629897_2630713_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
AUL23634.1|2630735_2631590_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23635.1|2631588_2631972_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUL23636.1|2632078_2633452_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	1.8e-50
AUL23637.1|2633523_2634015_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23638.1|2634014_2634767_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23639.1|2635114_2635318_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23640.1|2635347_2635770_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AUL23641.1|2635781_2636879_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUL23642.1|2636891_2638409_-	peptidase	NA	NA	NA	NA	NA
AUL23643.1|2638482_2639322_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
AUL23644.1|2639343_2640201_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23645.1|2640273_2641392_-	porin	NA	NA	NA	NA	NA
AUL23646.1|2642022_2642844_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL23647.1|2642882_2643143_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL23648.1|2643186_2643816_-	calcium:sodium antiporter	NA	NA	NA	NA	NA
AUL23649.1|2643973_2645317_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AUL23650.1|2645325_2645709_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23651.1|2645868_2647020_+	monooxygenase	NA	NA	NA	NA	NA
AUL23652.1|2647118_2648069_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL23653.1|2648212_2649238_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
>prophage 22
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	2930400	3031219	3691669	transposase,tRNA	Ralstonia_virus(20.0%)	83	NA	NA
AUL23886.1|2930400_2931180_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AUL23887.1|2931202_2932150_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
AUL23888.1|2932151_2932352_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AUL23889.1|2932686_2932947_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL23890.1|2932985_2933807_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL23891.1|2934127_2934844_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
AUL23892.1|2934840_2935734_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL23893.1|2935897_2937118_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL23894.1|2937270_2938353_+	iron ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
AUL23895.1|2940032_2941016_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL23896.1|2941078_2942491_-	signal recognition particle protein	NA	NA	NA	NA	NA
AUL23897.1|2942608_2943451_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23898.1|2943729_2944338_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
AUL23899.1|2944353_2944974_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUL23900.1|2945039_2945750_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.6e-13
AUL23901.1|2945751_2946474_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
AUL23902.1|2946460_2946751_-	inner-membrane translocator	NA	NA	NA	NA	NA
AUL23903.1|2946826_2948047_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	2.1e-183
AUL24644.1|2948771_2949623_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL23904.1|2949674_2950928_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL23905.1|2951104_2951893_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23906.1|2952012_2952927_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL23907.1|2953059_2954952_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
AUL23908.1|2955137_2956517_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
AUL23909.1|2956961_2957258_+	site-specific recombinase	NA	NA	NA	NA	NA
AUL23910.1|2957301_2957562_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL23911.1|2957654_2958155_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL23912.1|2958168_2958393_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL23913.1|2961058_2961661_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AUL23914.1|2961794_2962253_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AUL23915.1|2962254_2962854_-	iron transport sensor protein	NA	NA	NA	NA	NA
AUL23916.1|2962862_2963672_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL23917.1|2963706_2964561_+	permease	NA	NA	NA	NA	NA
AUL23918.1|2964680_2965268_+	histidine utilization protein HutD	NA	NA	NA	NA	NA
AUL23919.1|2965264_2966644_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
AUL23920.1|2974966_2976307_+	8-amino-7-oxononanoate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
AUL23921.1|2976320_2977172_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
AUL23922.1|2977183_2978449_-	capsule biosynthesis protein CapA	NA	NA	NA	NA	NA
AUL23923.1|2978510_2980592_-	beta-3-deoxy-D-manno-oct-2-ulosonic acid transferase	NA	NA	NA	NA	NA
AUL23924.1|2981540_2981801_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL23925.1|2981893_2982394_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL23926.1|2982390_2983245_-	sulfatase	NA	NA	NA	NA	NA
AUL23927.1|2983237_2984032_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL23928.1|2984247_2985198_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL23929.1|2985296_2986247_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL23930.1|2986849_2987647_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL23931.1|2987686_2988340_-	DL-methionine transporter permease subunit	NA	NA	NA	NA	NA
AUL23932.1|2988320_2989385_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
AUL23933.1|2989548_2991774_-	glycosyl hydrolase	NA	NA	NA	NA	NA
AUL23934.1|2992019_2993864_-	FAD-dependent cmnm(5)s(2)U34 oxidoreductase	NA	NA	NA	NA	NA
AUL23935.1|2993980_2994853_+	inositol monophosphatase	NA	NA	NA	NA	NA
AUL23936.1|2994899_2996600_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
AUL23937.1|2996662_2997862_+	amidohydrolase	NA	NA	NA	NA	NA
AUL23938.1|2997872_2998751_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL23939.1|2998857_2999895_+	hypothetical protein	NA	NA	NA	NA	NA
AUL24645.1|2999975_3000380_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUL23940.1|3000391_3001849_+	magnesium transporter	NA	NA	NA	NA	NA
AUL23941.1|3002491_3003088_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AUL23942.1|3003248_3003707_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL23943.1|3004484_3005456_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23944.1|3005577_3005997_+	hypothetical protein	NA	NA	NA	NA	NA
AUL23945.1|3006872_3007133_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL23946.1|3007288_3008509_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL23947.1|3008570_3009458_-	HflC protein	NA	NA	NA	NA	NA
AUL23948.1|3009475_3010780_-	HflK protein	NA	NA	NA	NA	NA
AUL23949.1|3010745_3011852_-	GTPase HflX	NA	NA	NA	NA	NA
AUL23950.1|3011939_3012176_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
AUL23951.1|3012359_3013433_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AUL23952.1|3013429_3014785_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AUL23953.1|3014809_3015967_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AUL23954.1|3015972_3016611_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23955.1|3016614_3017910_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AUL23956.1|3017942_3019229_-	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase	NA	NA	NA	NA	NA
AUL23957.1|3019241_3019730_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL23958.1|3019726_3020875_-	23S rRNA (adenine(2503)-C(2))-methyltransferase	NA	NA	NA	NA	NA
AUL23959.1|3020904_3021330_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.9	2.4e-22
AUL23960.1|3021649_3024529_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	1.1e-137
AUL23961.1|3024582_3025803_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL23962.1|3025851_3026715_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AUL23963.1|3026714_3027308_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUL23964.1|3027599_3027860_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUL23965.1|3028359_3028611_-	hypothetical protein	NA	NA	NA	NA	NA
AUL23966.1|3028597_3031219_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.5	2.8e-84
>prophage 23
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	3090076	3145374	3691669	protease,transposase,tRNA	Ralstonia_virus(25.0%)	40	NA	NA
AUL24016.1|3090076_3091297_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL24017.1|3091338_3092595_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL24018.1|3092835_3093981_+	Bcr/CflA family drug resistance efflux transporter	NA	NA	NA	NA	NA
AUL24019.1|3094287_3094524_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AUL24020.1|3094604_3094772_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AUL24021.1|3094928_3096017_+	hypothetical protein	NA	NA	NA	NA	NA
AUL24022.1|3096042_3097263_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL24023.1|3099481_3099913_+	DNA-binding protein	NA	NA	NA	NA	NA
AUL24024.1|3100039_3100552_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUL24648.1|3100584_3101745_+	MFS transporter	NA	NA	NA	NA	NA
AUL24025.1|3101816_3104474_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	38.7	7.5e-170
AUL24026.1|3104485_3105163_+	hypothetical protein	NA	NA	NA	NA	NA
AUL24027.1|3105162_3106212_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AUL24028.1|3106235_3107495_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.2	1.9e-94
AUL24029.1|3107501_3107891_+	hypothetical protein	NA	NA	NA	NA	NA
AUL24030.1|3108042_3108327_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL24031.1|3108323_3108713_+	hypothetical protein	NA	NA	NA	NA	NA
AUL24649.1|3108725_3109889_-	secretion protein	NA	NA	NA	NA	NA
AUL24032.1|3109915_3111676_-|protease	protease/lipase ABC transporter ATP-binding protein	protease	F2Y2R6	Organic_Lake_phycodnavirus	28.5	3.5e-14
AUL24033.1|3111672_3112974_-	hypothetical protein	NA	NA	NA	NA	NA
AUL24034.1|3113211_3113472_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL24035.1|3113510_3114332_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL24036.1|3120732_3122250_-	propionyl-CoA--succinate CoA transferase	NA	NA	NA	NA	NA
AUL24037.1|3123484_3125875_+	mechanosensitive ion channel protein	NA	NA	NA	NA	NA
AUL24038.1|3125876_3126647_-	hypothetical protein	NA	NA	NA	NA	NA
AUL24039.1|3126643_3127522_-	EamA family transporter	NA	NA	NA	NA	NA
AUL24040.1|3127705_3127996_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AUL24650.1|3128011_3128554_-	DNA polymerase III subunit epsilon	NA	A0A0A7RWA3	Clostridium_phage	29.7	7.2e-11
AUL24041.1|3128777_3131369_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
AUL24042.1|3134033_3134636_+	hypothetical protein	NA	NA	NA	NA	NA
AUL24651.1|3134884_3137590_+	aconitate hydratase 1	NA	NA	NA	NA	NA
AUL24043.1|3137655_3138438_-	dioxygenase	NA	NA	NA	NA	NA
AUL24044.1|3138599_3139805_+	hypothetical protein	NA	NA	NA	NA	NA
AUL24045.1|3139811_3140900_+	hypothetical protein	NA	NA	NA	NA	NA
AUL24046.1|3141057_3141615_+	elongation factor P	NA	NA	NA	NA	NA
AUL24047.1|3141696_3142131_-	hypothetical protein	NA	NA	NA	NA	NA
AUL24048.1|3142204_3142909_-	hypothetical protein	NA	NA	NA	NA	NA
AUL24049.1|3143010_3144393_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUL24050.1|3144402_3144855_-	hypothetical protein	NA	NA	NA	NA	NA
AUL24051.1|3144873_3145374_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
>prophage 24
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	3344583	3411304	3691669	transposase,tRNA	Synechococcus_phage(12.5%)	60	NA	NA
AUL24221.1|3344583_3345495_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AUL24222.1|3345496_3347632_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUL24223.1|3347628_3348168_+	D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AUL24224.1|3348171_3348900_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUL24225.1|3348886_3349720_+	hypothetical protein	NA	NA	NA	NA	NA
AUL24226.1|3349724_3350651_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL24662.1|3350729_3352145_+	FAD-binding dehydrogenase	NA	NA	NA	NA	NA
AUL24227.1|3352131_3353214_+	tricarballylate utilization protein B	NA	NA	NA	NA	NA
AUL24228.1|3353327_3353723_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
AUL24229.1|3353728_3354262_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.6	7.5e-13
AUL24230.1|3356652_3357882_+	hypothetical protein	NA	NA	NA	NA	NA
AUL24231.1|3357882_3359325_-	pyruvate kinase	NA	NA	NA	NA	NA
AUL24232.1|3359420_3360563_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.0	3.2e-37
AUL24233.1|3360581_3361061_+	thioesterase	NA	NA	NA	NA	NA
AUL24234.1|3361089_3361878_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase	NA	NA	NA	NA	NA
AUL24235.1|3361891_3363430_-	molecular chaperone SurA	NA	NA	NA	NA	NA
AUL24236.1|3363426_3365835_-	LPS biosynthesis protein	NA	NA	NA	NA	NA
AUL24237.1|3365988_3367056_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AUL24238.1|3367055_3367736_+	mannose-1-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AUL24239.1|3367877_3368603_+	hypothetical protein	NA	NA	NA	NA	NA
AUL24240.1|3368611_3368935_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
AUL24241.1|3368988_3369636_-	hypothetical protein	NA	NA	NA	NA	NA
AUL24242.1|3369771_3370185_+	hypothetical protein	NA	NA	NA	NA	NA
AUL24243.1|3370270_3371320_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AUL24244.1|3371465_3372416_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL24245.1|3372454_3373162_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL24246.1|3373129_3373951_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL24247.1|3373989_3374250_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL24248.1|3374307_3375816_-	sulfite reductase	NA	NA	NA	NA	NA
AUL24249.1|3375972_3377496_-	hypothetical protein	NA	NA	NA	NA	NA
AUL24250.1|3377550_3378198_-	carbonate dehydratase	NA	NA	NA	NA	NA
AUL24251.1|3378340_3378682_-	hypothetical protein	NA	NA	NA	NA	NA
AUL24252.1|3378839_3379172_+	PsiF repeat family protein	NA	NA	NA	NA	NA
AUL24253.1|3379220_3380261_-	cyclase	NA	NA	NA	NA	NA
AUL24254.1|3380264_3381044_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AUL24255.1|3381079_3381376_-	hypothetical protein	NA	NA	NA	NA	NA
AUL24256.1|3381390_3381666_-	muconolactone delta-isomerase	NA	NA	NA	NA	NA
AUL24257.1|3381733_3382378_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUL24258.1|3382380_3382470_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUL24259.1|3382660_3383446_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL24260.1|3383483_3384209_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL24261.1|3384222_3385563_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
AUL24262.1|3385657_3386590_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL24263.1|3386818_3389590_-	peptidase S8	NA	NA	NA	NA	NA
AUL24264.1|3390029_3392876_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AUL24265.1|3393022_3393736_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	41.4	1.6e-47
AUL24266.1|3393748_3394291_-	GNAT family N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	45.8	1.1e-27
AUL24267.1|3394396_3395305_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.7	4.4e-05
AUL24268.1|3395396_3397253_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AUL24269.1|3397436_3398477_-	GntR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.2	4.3e-20
AUL24270.1|3398619_3399525_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AUL24271.1|3401212_3402163_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL24272.1|3402219_3402987_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
AUL24663.1|3403104_3403749_+	hypothetical protein	NA	NA	NA	NA	NA
AUL24273.1|3404012_3404309_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AUL24274.1|3404455_3405526_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AUL24275.1|3406221_3407076_+	hypothetical protein	NA	NA	NA	NA	NA
AUL24276.1|3407101_3408322_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL24664.1|3408639_3410571_+	hypothetical protein	NA	NA	NA	NA	NA
AUL24277.1|3411043_3411304_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
CP018891	Bordetella holmesii isolate F616 chromosome, complete genome	3691669	3605054	3653755	3691669	transposase,holin,tRNA	Catovirus(20.0%)	39	NA	NA
AUL24448.1|3605054_3606845_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.5	5.5e-07
AUL24449.1|3606886_3607522_-	hypothetical protein	NA	A0A2I7S9X1	Vibrio_phage	29.0	1.2e-12
AUL24450.1|3607524_3607839_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
AUL24451.1|3609389_3611012_-|holin	choline dehydrogenase	holin	A0A1V0S9J5	Catovirus	29.6	5.4e-46
AUL24452.1|3611182_3611287_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
AUL24453.1|3611279_3611990_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
AUL24454.1|3612264_3612753_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUL24455.1|3612894_3614094_+	2-aminoadipate aminotransferase	NA	NA	NA	NA	NA
AUL24456.1|3614169_3615093_+	4-hydroxybenzoate polyprenyltransferase	NA	NA	NA	NA	NA
AUL24457.1|3615427_3615808_+	hypothetical protein	NA	NA	NA	NA	NA
AUL24671.1|3615951_3616710_-	transcriptional regulator GlcC	NA	NA	NA	NA	NA
AUL24672.1|3616921_3619093_+	malate synthase G	NA	NA	NA	NA	NA
AUL24458.1|3619150_3620224_-	lipase	NA	G9BWD6	Planktothrix_phage	37.1	2.6e-28
AUL24459.1|3620216_3621986_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AUL24460.1|3622000_3623110_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL24461.1|3623225_3625715_-	signal protein	NA	NA	NA	NA	NA
AUL24462.1|3625701_3626373_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL24463.1|3626896_3627943_+	oxidoreductase	NA	NA	NA	NA	NA
AUL24464.1|3627951_3628521_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUL24465.1|3629618_3630701_+	UDP-N-acetylglucosamine 2-epimerase	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	33.2	1.1e-45
AUL24466.1|3630725_3631979_+	glycosyltransferase WbuB	NA	NA	NA	NA	NA
AUL24467.1|3631983_3633171_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	NA	NA	NA	NA
AUL24468.1|3633167_3633761_+	sugar transferase	NA	NA	NA	NA	NA
AUL24469.1|3634147_3636085_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	27.9	2.2e-25
AUL24470.1|3636218_3637169_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL24471.1|3637250_3637958_-	hypothetical protein	NA	NA	NA	NA	NA
AUL24472.1|3638021_3640658_+	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	26.3	8.0e-23
AUL24473.1|3640787_3642008_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.1e-181
AUL24474.1|3642086_3643142_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL24475.1|3643141_3643912_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL24476.1|3644479_3645280_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
AUL24477.1|3645368_3646796_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUL24478.1|3646890_3647391_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL24479.1|3647483_3647744_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL24673.1|3647809_3648508_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL24480.1|3650471_3650951_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL24481.1|3650938_3651865_-	bestrophin	NA	NA	NA	NA	NA
AUL24482.1|3651981_3652509_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
AUL24483.1|3652534_3653755_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
