The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP018890	Bordetella holmesii isolate F613 chromosome, complete genome	3680984	148531	195415	3680984	transposase,protease	uncultured_Mediterranean_phage(22.22%)	49	NA	NA
AUL18179.1|148531_148969_-|protease	ClpXP protease specificity-enhancing factor	protease	NA	NA	NA	NA
AUL18180.1|148977_149589_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUL18181.1|149741_150593_-	cytochrome c1	NA	NA	NA	NA	NA
AUL18182.1|150617_152006_-	cytochrome b	NA	NA	NA	NA	NA
AUL18183.1|152087_152729_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AUL18184.1|152877_153315_+	large-conductance mechanosensitive channel protein	NA	NA	NA	NA	NA
AUL18185.1|153372_154149_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AUL18186.1|154168_155299_+	2-alkenal reductase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	37.2	3.0e-11
AUL18187.1|155363_156149_-	twin arginine-targeting protein translocase TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	34.4	5.0e-29
AUL18188.1|156145_156643_-	twin arginine-targeting protein translocase TatB	NA	NA	NA	NA	NA
AUL18189.1|156691_156913_-	Sec-independent protein translocase TatA	NA	NA	NA	NA	NA
AUL18190.1|156928_157297_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
AUL18191.1|157304_157655_-	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
AUL18192.1|157651_158056_-	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
AUL18193.1|158057_158873_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
AUL18194.1|158869_159610_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
AUL18195.1|159676_160363_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
AUL18196.1|160381_160969_-	imidazoleglycerol-phosphate dehydratase	NA	NA	NA	NA	NA
AUL18197.1|160970_162065_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AUL18198.1|162061_163369_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
AUL18199.1|163394_164066_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
AUL18200.1|164062_165328_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUL18201.1|165327_165573_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
AUL18202.1|165576_166374_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AUL18203.1|166370_167180_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	2.8e-19
AUL18204.1|167316_167943_-	ABC transporter	NA	NA	NA	NA	NA
AUL18205.1|167968_168760_-	hypothetical protein	NA	NA	NA	NA	NA
AUL18206.1|168824_169313_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AUL18207.1|169325_170108_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL18208.1|170104_170941_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.7e-22
AUL18209.1|171122_172103_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL18210.1|172167_172803_-	hypothetical protein	NA	NA	NA	NA	NA
AUL18211.1|173003_174470_-	glutamate synthase	NA	NA	NA	NA	NA
AUL18212.1|174478_179218_-	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
AUL18213.1|179571_180792_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL18214.1|180907_181651_-	hypothetical protein	NA	NA	NA	NA	NA
AUL18215.1|181820_182927_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.4	8.0e-33
AUL18216.1|182937_183777_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AUL18217.1|183834_184524_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18218.1|184620_185073_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18219.1|185076_186297_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL18220.1|186520_187408_+	RNA polymerase factor sigma-32	NA	A0A248SJA5	Salicola_phage	38.5	2.1e-39
AUL18221.1|187722_188508_-	phosphodiesterase	NA	NA	NA	NA	NA
AUL18222.1|191350_192127_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AUL18223.1|192619_192880_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL18224.1|192918_193740_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL18225.1|193774_194044_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
AUL18226.1|194015_194366_+	bifunctional protein GlmU	NA	NA	NA	NA	NA
AUL18227.1|194464_195415_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP018890	Bordetella holmesii isolate F613 chromosome, complete genome	3680984	227205	264019	3680984	transposase	Leptospira_phage(40.0%)	32	NA	NA
AUL18251.1|227205_227466_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL18252.1|227558_228059_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL18253.1|228432_229653_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL18254.1|230307_231585_+	cytosine deaminase	NA	NA	NA	NA	NA
AUL18255.1|231639_232206_-	cysteine dioxygenase	NA	NA	NA	NA	NA
AUL18256.1|232291_233455_-	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUL18257.1|233623_233908_+	acylphosphatase	NA	NA	NA	NA	NA
AUL18258.1|233931_234570_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL18259.1|234691_235663_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL18260.1|237241_238012_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL18261.1|238223_239174_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL21182.1|239146_239650_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	49.7	3.4e-39
AUL18262.1|239726_240731_-	hypothetical protein	NA	NA	NA	NA	NA
AUL18263.1|240802_242371_-	acetolactate synthase large subunit	NA	G9E4W7	Ostreococcus_lucimarinus_virus	27.1	4.5e-05
AUL18264.1|242507_243557_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AUL18265.1|243559_244744_+	CoA transferase	NA	NA	NA	NA	NA
AUL18266.1|244772_245903_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL18267.1|245915_247058_+	carnitine dehydratase	NA	NA	NA	NA	NA
AUL18268.1|248867_249482_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL18269.1|249530_250433_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL18270.1|250559_250949_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUL18271.1|250950_251832_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
AUL18272.1|251860_252829_+	MFS transporter	NA	NA	NA	NA	NA
AUL18273.1|253037_254027_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL18274.1|255576_256356_+	oxidoreductase	NA	NA	NA	NA	NA
AUL21183.1|256386_258132_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AUL18275.1|258128_259031_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
AUL18276.1|259314_260523_+	ferredoxin reductase	NA	NA	NA	NA	NA
AUL18277.1|260704_260968_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18278.1|260973_261453_+	DUF188 domain-containing protein	NA	NA	NA	NA	NA
AUL18279.1|261513_262623_-	porin	NA	NA	NA	NA	NA
AUL18280.1|262798_264019_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 3
CP018890	Bordetella holmesii isolate F613 chromosome, complete genome	3680984	584586	653420	3680984	tRNA,transposase	Staphylococcus_phage(21.43%)	59	NA	NA
AUL18551.1|584586_585537_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL18552.1|585533_586661_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
AUL18553.1|586669_588085_-	metallopeptidase	NA	A8ATH6	Listeria_phage	42.7	6.7e-16
AUL18554.1|588364_589594_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
AUL18555.1|589632_590289_+	phospholipid-binding protein	NA	NA	NA	NA	NA
AUL18556.1|590492_591743_+	serine hydroxymethyltransferase	NA	A0A219YCZ0	Aeromonas_phage	52.2	2.8e-98
AUL18557.1|591903_592389_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AUL18558.1|592393_593356_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL18559.1|593355_593916_-	hydrolase	NA	NA	NA	NA	NA
AUL18560.1|593951_595226_+	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	31.9	1.5e-38
AUL18561.1|595247_595889_+	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	36.1	7.2e-26
AUL18562.1|598176_599439_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18563.1|599435_600956_+	SpoVR family protein	NA	NA	NA	NA	NA
AUL18564.1|600952_601789_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL18565.1|603026_603926_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL18566.1|604301_604958_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUL18567.1|605135_605543_-	alkylhydroperoxidase	NA	NA	NA	NA	NA
AUL18568.1|606857_608078_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	9.3e-184
AUL18569.1|608074_608545_+	MFS permease	NA	NA	NA	NA	NA
AUL18570.1|608554_609010_-	hypothetical protein	NA	NA	NA	NA	NA
AUL18571.1|609977_611546_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AUL18572.1|611768_612206_+	universal stress protein	NA	NA	NA	NA	NA
AUL18573.1|612217_612628_-	hypothetical protein	NA	NA	NA	NA	NA
AUL18574.1|612658_613432_-	NADH pyrophosphatase	NA	NA	NA	NA	NA
AUL18575.1|613659_615762_+	dehydrogenase	NA	NA	NA	NA	NA
AUL18576.1|616270_617119_+	two-component response regulator	NA	NA	NA	NA	NA
AUL18577.1|617138_617354_-	hypothetical protein	NA	NA	NA	NA	NA
AUL18578.1|617508_618405_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18579.1|618508_619399_+	nicotinate-nucleotide diphosphorylase (carboxylating)	NA	NA	NA	NA	NA
AUL18580.1|619475_620444_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL18581.1|620444_621155_-	hypothetical protein	NA	NA	NA	NA	NA
AUL18582.1|621230_623324_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL18583.1|623353_623662_-	hypothetical protein	NA	NA	NA	NA	NA
AUL18584.1|623848_624634_-	enoyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
AUL18585.1|624692_626105_-	lytic transglycosylase	NA	A0A223LD43	Bacillus_phage	29.3	2.1e-06
AUL18586.1|626112_626922_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AUL18587.1|626939_627704_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL18588.1|627772_628234_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	51.5	4.5e-38
AUL18589.1|628358_629441_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUL18590.1|629456_629654_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18591.1|629616_630837_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL18592.1|633846_634581_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	42.4	2.6e-40
AUL18593.1|634749_635970_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL18594.1|636344_637331_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AUL18595.1|637334_640058_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	6.6e-20
AUL18596.1|640058_641186_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18597.1|641198_642611_+	RND transporter	NA	NA	NA	NA	NA
AUL18598.1|642785_643442_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL18599.1|643462_644509_+	glycosyltransferase	NA	F1C5B0	Cronobacter_phage	39.5	1.4e-58
AUL18600.1|644505_646095_+	dolichyl-phosphate-mannose--protein mannosyltransferase	NA	NA	NA	NA	NA
AUL18601.1|646249_647359_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18602.1|647348_648245_-	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	33.1	6.5e-09
AUL18603.1|648291_648924_-	hypothetical protein	NA	NA	NA	NA	NA
AUL18604.1|648948_649833_-	EamA family transporter	NA	NA	NA	NA	NA
AUL18605.1|649960_651442_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL18606.1|651514_651859_+	TIGR01244 family protein	NA	NA	NA	NA	NA
AUL18607.1|651944_652409_+	universal stress protein	NA	NA	NA	NA	NA
AUL18608.1|652566_652827_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL18609.1|652919_653420_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	49.7	2.8e-41
>prophage 4
CP018890	Bordetella holmesii isolate F613 chromosome, complete genome	3680984	656728	721774	3680984	tRNA,transposase	Ralstonia_virus(42.86%)	58	NA	NA
AUL18612.1|656728_657679_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL18613.1|657711_658158_+|tRNA	cys-tRNA(pro)/cys-tRNA(cys) deacylase	tRNA	NA	NA	NA	NA
AUL18614.1|658206_658896_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
AUL18615.1|658983_659478_-	peptidoglycan-associated lipoprotein	NA	NA	NA	NA	NA
AUL18616.1|659509_660826_-	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
AUL18617.1|660842_661763_-	protein TolA	NA	NA	NA	NA	NA
AUL18618.1|661797_662259_-	protein TolR	NA	NA	NA	NA	NA
AUL18619.1|662258_662933_-	protein TolQ	NA	NA	NA	NA	NA
AUL18620.1|662935_663358_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUL18621.1|663411_665142_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	28.6	1.2e-11
AUL18622.1|665207_665777_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AUL18623.1|665757_666444_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL18624.1|666463_667969_+	sensor histidine kinase	NA	NA	NA	NA	NA
AUL18625.1|668197_668647_+	tripartite tricarboxylate transporter TctB	NA	NA	NA	NA	NA
AUL18626.1|668652_670173_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18627.1|670226_671447_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL18628.1|671543_672473_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL18629.1|672631_673537_-	oxidoreductase	NA	NA	NA	NA	NA
AUL18630.1|673736_674957_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
AUL18631.1|675012_676518_-	hypothetical protein	NA	NA	NA	NA	NA
AUL18632.1|676539_676995_-	tricarboxylate transporter	NA	NA	NA	NA	NA
AUL18633.1|677351_677924_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18634.1|677923_678235_+	cell division protein ZapA	NA	NA	NA	NA	NA
AUL18635.1|678548_679310_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18636.1|679278_680073_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AUL18637.1|680251_680587_+	cytochrome C	NA	NA	NA	NA	NA
AUL18638.1|680603_681161_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AUL18639.1|681222_682335_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
AUL18640.1|682475_682952_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL18641.1|689292_689487_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18642.1|689614_689875_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL18643.1|689967_690468_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL18644.1|690705_691080_+	hypothetical protein	NA	NA	NA	NA	NA
AUL21203.1|691297_691576_-	DNA topoisomerase III	NA	NA	NA	NA	NA
AUL18645.1|691724_692918_+	peptidase M20	NA	NA	NA	NA	NA
AUL18646.1|692930_693989_+	dihydroorotase	NA	NA	NA	NA	NA
AUL18647.1|694026_695835_-	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	29.5	2.5e-44
AUL18648.1|696609_697038_+	cell division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
AUL18649.1|697046_698120_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	NA	NA	NA	NA
AUL18650.1|698119_698407_+	cell division protein FtsL	NA	NA	NA	NA	NA
AUL18651.1|698403_700137_+	cell division protein	NA	NA	NA	NA	NA
AUL18652.1|700133_702956_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
AUL18653.1|702945_704115_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AUL18654.1|704111_705644_+	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	NA	NA	NA	NA
AUL18655.1|705640_706834_+	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
AUL18656.1|706830_707904_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AUL18657.1|707900_709307_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
AUL18658.1|709303_710257_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AUL18659.1|710265_711090_+	cell division protein FtsQ	NA	NA	NA	NA	NA
AUL18660.1|711094_712321_+	cell division protein FtsA	NA	NA	NA	NA	NA
AUL18661.1|712516_713701_+	cell division protein FtsZ	NA	NA	NA	NA	NA
AUL18662.1|713940_714864_+	UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
AUL18663.1|714954_715170_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18664.1|715206_715701_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
AUL18665.1|715743_716727_+	peptidase M23	NA	A0A292GJG6	Xanthomonas_phage	47.7	1.2e-27
AUL18666.1|716887_719623_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AUL18667.1|719624_720344_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18668.1|720553_721774_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 5
CP018890	Bordetella holmesii isolate F613 chromosome, complete genome	3680984	796652	844221	3680984	transposase,holin	Leptospira_phage(11.11%)	47	NA	NA
AUL18728.1|796652_798752_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AUL18729.1|798893_799733_-	branched chain amino acid aminotransferase	NA	NA	NA	NA	NA
AUL18730.1|800862_801750_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL18731.1|801840_801975_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL18732.1|802050_803055_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL18733.1|803099_803921_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL18734.1|803959_804220_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL18735.1|804494_805130_-	endonuclease III	NA	NA	NA	NA	NA
AUL18736.1|805150_805789_-	ferredoxin	NA	NA	NA	NA	NA
AUL18737.1|805839_807066_-	esterase	NA	NA	NA	NA	NA
AUL18738.1|807202_808000_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AUL18739.1|808030_808354_-	ferredoxin	NA	NA	NA	NA	NA
AUL18740.1|808518_809694_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	32.5	4.2e-48
AUL18741.1|809732_810086_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18742.1|810116_810536_-	hypothetical protein	NA	NA	NA	NA	NA
AUL18743.1|810628_811468_-	hypothetical protein	NA	NA	NA	NA	NA
AUL18744.1|811664_813911_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AUL18745.1|813930_815244_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	41.0	1.5e-83
AUL18746.1|815409_816561_+	acetylornithine deacetylase (ArgE)	NA	NA	NA	NA	NA
AUL18747.1|816701_817901_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AUL18748.1|817897_818761_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AUL18749.1|818790_819669_+	acetyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
AUL18750.1|819877_820423_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18751.1|820593_820854_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL18752.1|821802_824934_-	ribonuclease E/G	NA	NA	NA	NA	NA
AUL18753.1|825513_826419_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AUL18754.1|826420_827077_+	HAD family hydrolase	NA	NA	NA	NA	NA
AUL18755.1|827194_828154_+	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AUL18756.1|828166_828793_+	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AUL18757.1|828773_829556_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	32.4	5.0e-13
AUL21209.1|829559_830270_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL18758.1|830266_830860_-	septum formation protein Maf	NA	NA	NA	NA	NA
AUL18759.1|831077_831725_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18760.1|831777_831960_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
AUL18761.1|832018_833083_+	phosphate acyltransferase	NA	NA	NA	NA	NA
AUL18762.1|833082_834069_+	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
AUL18763.1|834128_835064_+	[acyl-carrier-protein] S-malonyltransferase	NA	NA	NA	NA	NA
AUL18764.1|835066_835816_+	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.0	2.7e-16
AUL18765.1|836033_836273_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	48.5	1.6e-10
AUL18766.1|836444_837674_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AUL18767.1|837676_838108_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18768.1|838104_838704_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	26.9	2.6e-06
AUL18769.1|838716_839202_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18770.1|839201_840236_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AUL18771.1|840276_841779_+	serine peptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.2	1.1e-21
AUL18772.1|841863_843084_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	5.1e-182
AUL18773.1|843270_844221_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
CP018890	Bordetella holmesii isolate F613 chromosome, complete genome	3680984	849359	902107	3680984	transposase	Ralstonia_virus(26.67%)	47	NA	NA
AUL18779.1|849359_850181_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL18780.1|850219_850480_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL18781.1|851542_852763_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL18782.1|853171_853882_-	hypothetical protein	NA	NA	NA	NA	NA
AUL18783.1|853974_854223_-	hypothetical protein	NA	NA	NA	NA	NA
AUL18784.1|854241_854679_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AUL18785.1|854696_856211_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.9	7.3e-53
AUL18786.1|856265_857375_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AUL18787.1|858464_859682_+	ABC transporter permease	NA	NA	NA	NA	NA
AUL18788.1|859745_861230_+	methylmalonate-semialdehyde dehydrogenase (acylating)	NA	NA	NA	NA	NA
AUL18789.1|861386_862331_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL18790.1|862457_863678_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL18791.1|863845_864181_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18792.1|864376_865042_-	hypothetical protein	NA	A0A0A8WF62	Clostridium_phage	34.5	1.6e-15
AUL18793.1|865287_867177_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	30.7	2.4e-61
AUL18794.1|867173_867581_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18795.1|867664_868891_+	MFS transporter	NA	NA	NA	NA	NA
AUL18796.1|869040_871020_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	43.6	6.1e-84
AUL18797.1|871085_872306_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL18798.1|873333_874347_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AUL18799.1|874368_875202_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL18800.1|875251_876898_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
AUL18801.1|877030_877477_+	thioesterase	NA	NA	NA	NA	NA
AUL18802.1|877591_878290_+	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUL18803.1|878302_878956_+	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUL18804.1|879156_880041_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL18805.1|880037_881018_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
AUL18806.1|881055_882936_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.8	2.0e-20
AUL18807.1|883010_884564_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
AUL18808.1|884637_885558_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
AUL18809.1|885565_886459_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
AUL18810.1|886548_887616_+	aminopeptidase	NA	NA	NA	NA	NA
AUL18811.1|887626_888445_+	aminopeptidase	NA	NA	NA	NA	NA
AUL18812.1|888459_890256_+	Xaa-Pro aminopeptidase	NA	A0A0P0I8D7	Acinetobacter_phage	49.7	1.3e-165
AUL18813.1|890499_892152_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.5	1.7e-156
AUL18814.1|892323_892527_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18815.1|892501_892606_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18816.1|892609_893896_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	63.4	5.5e-150
AUL18817.1|893969_894341_+	cell division protein FtsB	NA	NA	NA	NA	NA
AUL18818.1|894359_894989_-	hypothetical protein	NA	NA	NA	NA	NA
AUL18819.1|895068_895989_-	Hsp33 family molecular chaperone	NA	NA	NA	NA	NA
AUL18820.1|896027_896549_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AUL18821.1|896571_898239_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	33.4	9.8e-67
AUL18822.1|898434_899274_-	UDP-2,3-diacylglucosamine hydrolase	NA	A0A218MKA7	uncultured_virus	48.1	1.9e-66
AUL18823.1|899355_899880_-	RDD family protein	NA	NA	NA	NA	NA
AUL18824.1|900795_901056_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL18825.1|901099_902107_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.8	1.3e-146
>prophage 7
CP018890	Bordetella holmesii isolate F613 chromosome, complete genome	3680984	1092785	1190023	3680984	tRNA,transposase,protease	Ralstonia_virus(16.67%)	91	NA	NA
AUL18975.1|1092785_1094006_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL18976.1|1094093_1094684_+	EamA family transporter	NA	NA	NA	NA	NA
AUL18977.1|1094671_1094983_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18978.1|1095034_1096024_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AUL18979.1|1096144_1097026_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
AUL18980.1|1097199_1098054_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18981.1|1098085_1098934_+	sulfurtransferase	NA	NA	NA	NA	NA
AUL18982.1|1099061_1100282_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL18983.1|1100300_1100867_-	phosphohydrolase	NA	NA	NA	NA	NA
AUL18984.1|1101064_1102216_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUL18985.1|1102354_1103359_-	hypothetical protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
AUL18986.1|1103515_1104487_-	MFS transporter	NA	NA	NA	NA	NA
AUL18987.1|1104565_1105354_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL18988.1|1105425_1105662_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AUL18989.1|1105670_1106582_+	geranyl transferase	NA	NA	NA	NA	NA
AUL18990.1|1106625_1108497_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AUL18991.1|1108657_1109455_+	GTP cyclohydrolase	NA	NA	NA	NA	NA
AUL18992.1|1109686_1110061_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
AUL18993.1|1110137_1110461_+	primosomal replication protein N	NA	NA	NA	NA	NA
AUL18994.1|1110544_1110817_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
AUL18995.1|1110831_1111287_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AUL18996.1|1111408_1112245_+	hypothetical protein	NA	NA	NA	NA	NA
AUL18997.1|1112241_1113615_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
AUL18998.1|1113691_1114648_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
AUL18999.1|1114735_1115713_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
AUL19000.1|1115837_1117493_-	phosphate starvation-inducible protein PhoH	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
AUL19001.1|1117541_1118006_-	peroxiredoxin	NA	NA	NA	NA	NA
AUL19002.1|1118002_1118464_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19003.1|1118689_1119877_+	alanine transaminase	NA	NA	NA	NA	NA
AUL19004.1|1119873_1121178_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
AUL19005.1|1121174_1122584_+	threonine synthase	NA	NA	NA	NA	NA
AUL19006.1|1122777_1123038_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL19007.1|1123076_1123898_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL19008.1|1124032_1125052_-	fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
AUL19009.1|1125060_1127766_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
AUL19010.1|1127905_1128559_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19011.1|1128621_1128984_-	DNA-binding protein	NA	NA	NA	NA	NA
AUL19012.1|1129550_1131011_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AUL19013.1|1131273_1132347_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
AUL19014.1|1132431_1133652_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
AUL19015.1|1135409_1136231_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL19016.1|1136269_1136530_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL21219.1|1136557_1138003_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AUL19017.1|1138016_1139120_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
AUL19018.1|1139124_1140375_+	glycolate oxidase iron-sulfur subunit	NA	NA	NA	NA	NA
AUL19019.1|1140371_1141817_-	NAD synthetase	NA	NA	NA	NA	NA
AUL19020.1|1141813_1142128_-	NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AUL19021.1|1142129_1143248_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AUL19022.1|1143430_1144651_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL19023.1|1144750_1145617_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
AUL19024.1|1145677_1146658_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL19025.1|1146804_1147725_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
AUL19026.1|1147733_1148846_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUL19027.1|1148927_1149749_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19028.1|1149824_1150433_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUL21220.1|1150570_1151947_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
AUL19029.1|1152008_1152452_+	cytochrome C	NA	NA	NA	NA	NA
AUL21221.1|1152518_1153190_-	cytochrome B	NA	NA	NA	NA	NA
AUL19030.1|1153217_1153478_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL19031.1|1154197_1154479_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19032.1|1155189_1155978_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19033.1|1155974_1157081_+	AI-2E family transporter	NA	NA	NA	NA	NA
AUL19034.1|1157755_1159114_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
AUL19035.1|1159228_1159426_-	gas vesicle protein	NA	NA	NA	NA	NA
AUL19036.1|1159443_1160265_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL19037.1|1160303_1160564_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL19038.1|1160657_1161212_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
AUL21222.1|1161799_1163116_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19039.1|1163128_1164142_-	dimethylhistidine N-methyltransferase	NA	NA	NA	NA	NA
AUL19040.1|1164688_1165639_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL19041.1|1165718_1166018_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19042.1|1167378_1169037_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
AUL19043.1|1169185_1170406_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19044.1|1170523_1171807_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
AUL19045.1|1171810_1172752_-	transporter	NA	NA	NA	NA	NA
AUL19046.1|1172861_1173320_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL21223.1|1173700_1174321_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AUL19047.1|1174728_1177149_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
AUL19048.1|1177256_1177994_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AUL19049.1|1178040_1179285_+	hypothetical protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
AUL19050.1|1179607_1179880_+	DNA-binding protein HU	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
AUL19051.1|1180463_1181192_+	energy transducer TonB	NA	NA	NA	NA	NA
AUL19052.1|1181213_1182131_+	flagellar motor protein MotA	NA	NA	NA	NA	NA
AUL19053.1|1182130_1182640_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUL19054.1|1182756_1183428_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL19055.1|1183537_1184605_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
AUL19056.1|1184588_1186469_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	3.5e-65
AUL19057.1|1186605_1187793_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19058.1|1188093_1188879_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19059.1|1188902_1189163_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL19060.1|1189201_1190023_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
>prophage 8
CP018890	Bordetella holmesii isolate F613 chromosome, complete genome	3680984	1198050	1259148	3680984	tRNA,transposase,protease	Ralstonia_virus(21.43%)	55	NA	NA
AUL19068.1|1198050_1199271_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL19069.1|1199346_1199628_+	malate dehydrogenase	NA	NA	NA	NA	NA
AUL19070.1|1201459_1202455_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL19071.1|1202497_1203268_+	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
AUL19072.1|1203393_1203657_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUL19073.1|1203858_1204005_-	transmembrane sensor protein	NA	NA	NA	NA	NA
AUL19074.1|1204058_1205009_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL19075.1|1205090_1205570_-	transmembrane sensor protein	NA	NA	NA	NA	NA
AUL19076.1|1205601_1206423_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL19077.1|1206461_1206722_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL19078.1|1206779_1207979_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
AUL19079.1|1208124_1208502_-	cytochrome c family protein	NA	NA	NA	NA	NA
AUL19080.1|1208525_1210307_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
AUL19081.1|1210315_1211053_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19082.1|1211337_1212897_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
AUL19083.1|1212956_1213715_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL19084.1|1213811_1214468_-	adenylate kinase	NA	NA	NA	NA	NA
AUL19085.1|1214621_1215386_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AUL19086.1|1215400_1215580_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19087.1|1215605_1216640_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AUL19088.1|1216636_1217050_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUL19089.1|1217046_1217631_-	flagellar motor protein MotA	NA	NA	NA	NA	NA
AUL19090.1|1217983_1219342_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
AUL19091.1|1219435_1220014_+	superoxide dismutase	NA	NA	NA	NA	NA
AUL19092.1|1220138_1220960_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL19093.1|1220998_1221259_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL21225.1|1221286_1222588_+	chloride channel protein-related protein	NA	NA	NA	NA	NA
AUL19094.1|1222691_1223897_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AUL19095.1|1223960_1224410_-	hypothetical protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
AUL19096.1|1224542_1224788_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
AUL19097.1|1225012_1225327_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
AUL19098.1|1225418_1225703_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19099.1|1225970_1230533_+	alpha-2-macroglobulin	NA	NA	NA	NA	NA
AUL19100.1|1230580_1232686_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
AUL19101.1|1232739_1235049_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
AUL19102.1|1236402_1238070_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AUL19103.1|1238072_1238738_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19104.1|1238870_1242677_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL19105.1|1242902_1244048_+	branched chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL19106.1|1244166_1245096_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL19107.1|1245092_1246169_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL19108.1|1246165_1246972_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
AUL19109.1|1246968_1247700_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
AUL19110.1|1247903_1248086_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19111.1|1248076_1249315_-	ammonia channel protein	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
AUL19112.1|1249362_1249701_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL19113.1|1249948_1250899_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL19114.1|1251217_1251400_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19115.1|1251465_1252686_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AUL19116.1|1252745_1253009_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19117.1|1253130_1254630_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AUL19118.1|1255050_1255248_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AUL19119.1|1255263_1255623_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AUL19120.1|1255695_1256718_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
AUL19121.1|1256730_1259148_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 9
CP018890	Bordetella holmesii isolate F613 chromosome, complete genome	3680984	1268495	1309011	3680984	tRNA,transposase,holin	Ralstonia_virus(25.0%)	36	NA	NA
AUL19134.1|1268495_1270457_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	29.9	2.3e-27
AUL19135.1|1270585_1270834_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19136.1|1270963_1271242_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19137.1|1271335_1271788_+	hypothetical protein	NA	G1JW61	Mycobacterium_phage	36.3	8.9e-07
AUL19138.1|1271784_1272255_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUL19139.1|1272546_1273137_+	twin-arginine translocation pathway signal	NA	NA	NA	NA	NA
AUL19140.1|1273194_1273455_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL19141.1|1273493_1274315_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL19142.1|1274798_1275785_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUL19143.1|1275831_1276038_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19144.1|1276034_1277210_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19145.1|1277387_1278041_+	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	47.7	6.3e-54
AUL19146.1|1278035_1280558_-	penicillin-binding protein	NA	NA	NA	NA	NA
AUL19147.1|1280729_1282646_-	S9 family peptidase	NA	NA	NA	NA	NA
AUL19148.1|1282778_1283225_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19149.1|1283253_1283682_-	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
AUL19150.1|1284309_1285530_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL19151.1|1286263_1286725_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	44.1	2.0e-17
AUL19152.1|1286863_1288090_+	nitric oxide dioxygenase	NA	NA	NA	NA	NA
AUL19153.1|1288111_1288549_+	BadM/Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AUL19154.1|1288671_1289919_+	D-amino acid dehydrogenase small subunit	NA	NA	NA	NA	NA
AUL19155.1|1289926_1290760_-	class III aminotransferase	NA	NA	NA	NA	NA
AUL19156.1|1290756_1291284_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL19157.1|1291373_1292594_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL19158.1|1292601_1294266_-	long-chain-fatty-acid--CoA ligase	NA	Q75ZG1	Hepacivirus	27.3	2.7e-40
AUL19159.1|1294273_1294783_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19160.1|1294779_1295394_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
AUL19161.1|1295394_1296588_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUL19162.1|1296597_1298982_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL19163.1|1299041_1300334_-	fatty acid transporter	NA	NA	NA	NA	NA
AUL19164.1|1300355_1302314_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUL19165.1|1302310_1303603_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUL19166.1|1303613_1305944_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL19167.1|1305969_1306638_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL19168.1|1307017_1307962_+	serine acetyltransferase	NA	NA	NA	NA	NA
AUL19169.1|1308060_1309011_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 10
CP018890	Bordetella holmesii isolate F613 chromosome, complete genome	3680984	1543833	1600967	3680984	tRNA,transposase	Leptospira_phage(15.79%)	45	NA	NA
AUL19376.1|1543833_1544322_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AUL19377.1|1544436_1545552_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
AUL21242.1|1546184_1547348_+	MFS transporter	NA	NA	NA	NA	NA
AUL19378.1|1547530_1550188_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19379.1|1550191_1553581_+	nuclease	NA	NA	NA	NA	NA
AUL19380.1|1553971_1556041_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.7	1.1e-46
AUL19381.1|1556079_1556406_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AUL19382.1|1556420_1557029_+	recombination protein RecR	NA	NA	NA	NA	NA
AUL19383.1|1558469_1559510_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL19384.1|1559502_1560312_+	mannosyltransferase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.5	1.1e-12
AUL19385.1|1560317_1561112_+	ABC transporter permease	NA	NA	NA	NA	NA
AUL21243.1|1561175_1562132_-	transaldolase	NA	M4SPL0	Cyanophage	30.7	3.6e-13
AUL19386.1|1562355_1563510_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.1	2.6e-50
AUL19387.1|1563520_1566760_+	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
AUL19388.1|1566824_1567721_+	aspartyl beta-hydroxylase	NA	H8ZJK8	Ostreococcus_tauri_virus	38.3	2.2e-36
AUL19389.1|1567788_1568550_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL19390.1|1568555_1569194_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AUL19391.1|1569186_1570095_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL19392.1|1571200_1572892_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL19393.1|1572959_1574282_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL19394.1|1574379_1574655_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19395.1|1574790_1576107_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	68.0	2.9e-154
AUL19396.1|1576307_1576736_+	transcriptional regulator	NA	A0A1X9I5R1	Streptococcus_phage	30.3	4.2e-06
AUL19397.1|1576801_1578022_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL19398.1|1578376_1578853_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AUL19399.1|1579111_1579720_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19400.1|1579738_1580410_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AUL19401.1|1580583_1582470_+	cell division protein FtsH	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
AUL19402.1|1582497_1583340_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
AUL19403.1|1583336_1584680_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
AUL19404.1|1584864_1585680_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL19405.1|1585745_1587227_-	exopolyphosphatase	NA	NA	NA	NA	NA
AUL19406.1|1587425_1589498_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
AUL19407.1|1589717_1590755_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
AUL19408.1|1590876_1592799_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19409.1|1592826_1593603_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
AUL19410.1|1594430_1594940_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19411.1|1595181_1595886_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	36.5	1.9e-27
AUL19412.1|1596017_1596788_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL21244.1|1596784_1597795_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL21245.1|1597853_1598114_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL21246.1|1598146_1598935_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.5	1.4e-44
AUL19413.1|1599102_1599363_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL19414.1|1599401_1600223_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL19415.1|1600277_1600967_+	hypothetical protein	NA	A0A1B0VBP7	Salmonella_phage	47.1	1.3e-49
>prophage 11
CP018890	Bordetella holmesii isolate F613 chromosome, complete genome	3680984	1618225	1665224	3680984	tRNA,transposase	Ralstonia_virus(20.0%)	47	NA	NA
AUL19433.1|1618225_1619446_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL19434.1|1619704_1620310_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19435.1|1620320_1621481_+	succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
AUL19436.1|1621502_1622384_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
AUL19437.1|1622680_1623379_+	hypothetical protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
AUL19438.1|1623520_1624243_+	hypothetical protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
AUL19439.1|1624361_1625300_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AUL19440.1|1625330_1626110_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AUL19441.1|1626096_1627320_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
AUL19442.1|1627324_1628872_+	protoheme IX synthesis protein	NA	NA	NA	NA	NA
AUL19443.1|1628907_1629441_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
AUL21248.1|1629684_1630380_+	5-carboxymethyl-2-hydroxymuconate isomerase	NA	NA	NA	NA	NA
AUL19444.1|1630394_1630526_+	entericidin	NA	NA	NA	NA	NA
AUL19445.1|1630573_1631698_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL19446.1|1631703_1634043_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
AUL19447.1|1634039_1634447_-	heat-shock protein Hsp20	NA	NA	NA	NA	NA
AUL19448.1|1634708_1634969_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19449.1|1635191_1636142_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL19450.1|1636191_1637400_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL19451.1|1637621_1638161_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL19452.1|1638385_1638790_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL19453.1|1638854_1639610_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
AUL19454.1|1639609_1640971_+	secretion protein	NA	NA	NA	NA	NA
AUL19455.1|1640967_1641591_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL19456.1|1641634_1641895_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL19457.1|1641933_1642755_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL19458.1|1642705_1643410_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL19459.1|1643406_1644162_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL21249.1|1644338_1645133_+	pilus assembly protein	NA	NA	NA	NA	NA
AUL19460.1|1645129_1645567_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19461.1|1646251_1647220_-	homoserine kinase	NA	NA	NA	NA	NA
AUL19462.1|1647376_1648384_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AUL19463.1|1648441_1648900_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19464.1|1648973_1650320_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19465.1|1650337_1650709_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19466.1|1650708_1652178_+	hypothetical protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
AUL19467.1|1652333_1653059_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19468.1|1653072_1655787_-	histidine kinase	NA	NA	NA	NA	NA
AUL19469.1|1656038_1657403_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUL19470.1|1657442_1658501_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
AUL19471.1|1658528_1659347_+	peptidase M48	NA	NA	NA	NA	NA
AUL21250.1|1659384_1659663_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AUL19472.1|1660608_1660869_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL19473.1|1660926_1661226_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AUL19474.1|1661795_1663199_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AUL19475.1|1663211_1663862_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AUL19476.1|1664003_1665224_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 12
CP018890	Bordetella holmesii isolate F613 chromosome, complete genome	3680984	1669426	1789292	3680984	holin,tRNA,transposase,integrase	Ralstonia_virus(18.18%)	113	1706841:1706900	1783076:1784384
AUL19480.1|1669426_1670242_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AUL21251.1|1670289_1671327_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL19481.1|1671378_1672038_+	N-(5'-phosphoribosyl)anthranilate isomerase	NA	NA	NA	NA	NA
AUL19482.1|1672677_1673553_-|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL19483.1|1673549_1673840_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL19484.1|1674604_1674865_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL19485.1|1675263_1675953_+	permease	NA	NA	NA	NA	NA
AUL19486.1|1676052_1676214_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19487.1|1676655_1676892_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19488.1|1677081_1677330_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19489.1|1677443_1678814_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AUL19490.1|1678814_1679555_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL19491.1|1680041_1681994_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.1	2.4e-125
AUL19492.1|1682014_1682563_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.3	3.8e-12
AUL19493.1|1682728_1683685_+	glutathione synthase	NA	NA	NA	NA	NA
AUL21252.1|1683698_1684097_+	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
AUL21253.1|1684159_1684429_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AUL19494.1|1684457_1686233_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AUL19495.1|1686280_1686490_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19496.1|1686536_1686959_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AUL19497.1|1687078_1688056_+	ornithine cyclodeaminase	NA	NA	NA	NA	NA
AUL19498.1|1689456_1690344_+	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
AUL19499.1|1690354_1690996_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
AUL19500.1|1690992_1691664_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
AUL19501.1|1691663_1692434_+	ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA	NA	G9BWD6	Planktothrix_phage	35.8	2.0e-27
AUL19502.1|1692484_1692934_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	Q2NP83	Xanthomonas_phage	62.8	2.3e-47
AUL19503.1|1692975_1693434_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19504.1|1693454_1694087_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19505.1|1694196_1694664_+	hydrolase	NA	NA	NA	NA	NA
AUL19506.1|1694685_1695228_+	hydrolase	NA	NA	NA	NA	NA
AUL19507.1|1695240_1695945_+	dipeptidase E	NA	NA	NA	NA	NA
AUL19508.1|1695963_1696434_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL19509.1|1696526_1697267_+	permease	NA	NA	NA	NA	NA
AUL19510.1|1697310_1697571_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL19511.1|1698446_1699658_-	phosphopantothenate synthase	NA	Q9HH70	Methanothermobacter_phage	30.4	2.9e-36
AUL19512.1|1699718_1700234_-	signal peptidase II	NA	NA	NA	NA	NA
AUL19513.1|1700236_1703098_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
AUL21254.1|1703087_1704053_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
AUL19514.1|1704809_1706285_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AUL21255.1|1706289_1706565_-	hypothetical protein	NA	NA	NA	NA	NA
1706841:1706900	attL	GTGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGC	NA	NA	NA	NA
AUL19515.1|1706901_1707162_+|transposase	transposase	transposase	NA	NA	NA	NA
1706841:1706900	attL	GTGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGC	NA	NA	NA	NA
AUL19516.1|1708324_1709533_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
AUL19517.1|1709529_1711812_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
AUL19518.1|1711822_1714204_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUL19519.1|1716390_1717281_-	ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUL19520.1|1717287_1718421_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AUL19521.1|1718420_1719242_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AUL19522.1|1719266_1720457_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
AUL19523.1|1720758_1721040_+|integrase	integrase	integrase	NA	NA	NA	NA
AUL21256.1|1721205_1721526_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19524.1|1721565_1721832_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL21257.1|1721864_1722653_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.5	1.4e-44
AUL19525.1|1722848_1723109_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19526.1|1723187_1723448_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL19527.1|1723601_1724372_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
1723127:1723523	attR	GTGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGCAATGAAGAAACGATTTACGGAAGAGCAAATCATCGGCGTGCTCAAGGAAGCCGATGCAGGTGCCAAGCCCGCAGAGTTGTGCCGCAAGCACGGAATCTCCGAGGCAACGTACTACAACTGGAAGGCGAAGTTCGGTGGCATGACGGTGTCGGACGCTCAGAGGCTCAAGGAGCTGGAGCAGGAGAACAACAAGCTCAAGAAGCTGTTGGCCGAGTCGATGCTGGACAAGGCGGCGCTTCAGGATCTGCTAAGCCGAAAGTAGTCAGCCCGCAGGCCAAACGCGAGGCGGTCAGGACATTAATGACCGAGCGCAGCATGGGTGTTACCCGGGCCTGTG	NA	NA	NA	NA
AUL21258.1|1724368_1725379_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
1723127:1723523	attR	GTGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGCAATGAAGAAACGATTTACGGAAGAGCAAATCATCGGCGTGCTCAAGGAAGCCGATGCAGGTGCCAAGCCCGCAGAGTTGTGCCGCAAGCACGGAATCTCCGAGGCAACGTACTACAACTGGAAGGCGAAGTTCGGTGGCATGACGGTGTCGGACGCTCAGAGGCTCAAGGAGCTGGAGCAGGAGAACAACAAGCTCAAGAAGCTGTTGGCCGAGTCGATGCTGGACAAGGCGGCGCTTCAGGATCTGCTAAGCCGAAAGTAGTCAGCCCGCAGGCCAAACGCGAGGCGGTCAGGACATTAATGACCGAGCGCAGCATGGGTGTTACCCGGGCCTGTG	NA	NA	NA	NA
AUL21259.1|1725437_1726256_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.2e-54
AUL19528.1|1726718_1727504_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
AUL19529.1|1728363_1728624_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL19530.1|1728662_1729484_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL19531.1|1730549_1731554_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
AUL19532.1|1731629_1732442_+	nucleotide pyrophosphatase	NA	NA	NA	NA	NA
AUL19533.1|1732669_1734841_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AUL19534.1|1734894_1736214_-	MFS transporter	NA	NA	NA	NA	NA
AUL19535.1|1736302_1737523_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL19536.1|1737741_1738602_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL19537.1|1738598_1739822_-	MFS transporter	NA	NA	NA	NA	NA
AUL19538.1|1740120_1740618_+	osmotically inducible protein Y	NA	NA	NA	NA	NA
AUL19539.1|1740656_1741439_-	hydrolase	NA	NA	NA	NA	NA
AUL19540.1|1741464_1741683_-	SlyX protein	NA	NA	NA	NA	NA
AUL19541.1|1741757_1742027_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19542.1|1742246_1742711_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL19543.1|1742784_1743066_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUL21260.1|1743182_1744166_-|integrase	integrase	integrase	NA	NA	NA	NA
AUL19544.1|1744409_1745408_+	cointegrate resolution protein	NA	NA	NA	NA	NA
AUL19545.1|1745510_1745942_+	energy transducer TonB	NA	NA	NA	NA	NA
AUL19546.1|1746006_1746918_+	3-phosphoglycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	30.7	3.7e-20
AUL19547.1|1747050_1749132_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AUL19548.1|1749170_1749875_-	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AUL19549.1|1749967_1750852_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL19550.1|1750927_1751329_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19551.1|1751419_1751566_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
AUL19552.1|1751827_1752763_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL19553.1|1752844_1753498_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL19554.1|1754114_1754591_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL19555.1|1754615_1755410_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL19556.1|1755426_1756407_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL19557.1|1756579_1756792_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19558.1|1757205_1758981_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	3.5e-38
AUL19559.1|1758996_1760661_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
AUL19560.1|1760673_1763385_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AUL21261.1|1763930_1765685_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
AUL19561.1|1765681_1766308_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL19562.1|1766304_1767159_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.8	1.1e-29
AUL19563.1|1767278_1769333_+	oligopeptidase A	NA	NA	NA	NA	NA
AUL19564.1|1769442_1770393_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL19565.1|1770389_1770905_-	methyltransferase	NA	NA	NA	NA	NA
AUL19566.1|1771262_1771883_+	SCO family protein	NA	NA	NA	NA	NA
AUL19567.1|1771982_1772234_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19568.1|1772321_1773800_-	multidrug transporter	NA	NA	NA	NA	NA
AUL19569.1|1773796_1776967_-	multidrug efflux RND transporter permease	NA	NA	NA	NA	NA
AUL19570.1|1776979_1778176_-	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUL19571.1|1778364_1779297_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL19572.1|1779365_1780097_-	pseudouridylate synthase	NA	NA	NA	NA	NA
AUL19573.1|1780162_1780798_+	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AUL19574.1|1780783_1781962_-	arabinose transporter	NA	NA	NA	NA	NA
AUL19575.1|1782122_1782671_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19576.1|1782751_1783111_+	lysine transporter LysE	NA	NA	NA	NA	NA
AUL19577.1|1783159_1784380_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL19578.1|1784455_1785577_-	transporter	NA	NA	NA	NA	NA
AUL19579.1|1785614_1786328_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
AUL19580.1|1786338_1787559_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
AUL19581.1|1788341_1789292_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 13
CP018890	Bordetella holmesii isolate F613 chromosome, complete genome	3680984	1952482	2009843	3680984	transposase,integrase	Leptospira_phage(22.22%)	50	1947165:1947180	1978376:1978391
1947165:1947180	attL	GGCTGTTGCCGGCAAG	NA	NA	NA	NA
AUL19729.1|1952482_1952743_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL19730.1|1952766_1952961_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19731.1|1952960_1955168_-	outer membrane receptor protein	NA	NA	NA	NA	NA
AUL19732.1|1955440_1956238_+	enterobactin-dependent positive regulator	NA	NA	NA	NA	NA
AUL19733.1|1956283_1957339_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUL19734.1|1957373_1957568_-|integrase	integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	52.8	1.1e-06
AUL19735.1|1957564_1958506_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AUL19736.1|1959008_1959893_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19737.1|1960317_1962546_+	isocitrate dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AUL19738.1|1962830_1963295_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19739.1|1963301_1964819_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19740.1|1964867_1965620_-	polar amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	4.3e-30
AUL19741.1|1965627_1966281_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL19742.1|1966317_1967106_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL19743.1|1967223_1967805_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AUL19744.1|1968087_1968471_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19745.1|1969055_1969385_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19746.1|1970564_1971293_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.1	1.8e-09
AUL21271.1|1971289_1972054_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.3e-18
AUL19747.1|1972053_1973937_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL21272.1|1973949_1975155_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL19748.1|1975222_1976077_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19749.1|1976092_1976380_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19750.1|1976525_1977476_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL19751.1|1977435_1977837_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19752.1|1977920_1978655_-	hypothetical protein	NA	NA	NA	NA	NA
1978376:1978391	attR	GGCTGTTGCCGGCAAG	NA	NA	NA	NA
AUL19753.1|1978831_1979623_+	hydratase	NA	NA	NA	NA	NA
AUL19754.1|1979645_1981190_-	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	42.9	5.2e-38
AUL19755.1|1981934_1983134_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AUL19756.1|1983570_1983852_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19757.1|1983781_1984195_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19758.1|1984200_1987857_+	virulence sensor protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.0	6.5e-39
AUL19759.1|1990045_1991743_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19760.1|1992127_1992388_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL19761.1|1992426_1993248_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL19762.1|1993280_1993595_+	glutamate decarboxylase	NA	NA	NA	NA	NA
AUL19763.1|1993684_1995385_+	transporter	NA	NA	NA	NA	NA
AUL19764.1|1995464_1995842_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19765.1|1995978_1996704_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL19766.1|1996836_1997823_+	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL19767.1|1997825_1998299_+	TRAP transporter small permease protein	NA	NA	NA	NA	NA
AUL19768.1|1998303_1999587_+	C4-dicarboxylate ABC transporter permease	NA	NA	NA	NA	NA
AUL19769.1|1999583_2000474_+	CoA ester lyase	NA	NA	NA	NA	NA
AUL19770.1|2000470_2002168_+	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.7	4.0e-31
AUL19771.1|2003492_2004992_+	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
AUL19772.1|2005064_2005583_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19773.1|2005656_2006547_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AUL19774.1|2006604_2007858_+	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUL19775.1|2007892_2008657_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL19776.1|2009021_2009843_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
>prophage 14
CP018890	Bordetella holmesii isolate F613 chromosome, complete genome	3680984	2118068	2173737	3680984	tRNA,transposase,protease	uncultured_Mediterranean_phage(14.29%)	60	NA	NA
AUL19857.1|2118068_2118329_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL19858.1|2118367_2119189_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL19859.1|2119232_2119985_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19860.1|2120276_2120699_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19861.1|2120968_2121748_-	3'-5' exonuclease	NA	NA	NA	NA	NA
AUL19862.1|2121744_2122608_-	peptidase	NA	A0A292GJG6	Xanthomonas_phage	40.5	8.5e-14
AUL19863.1|2122625_2123423_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.5	9.8e-33
AUL19864.1|2123407_2124166_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.3	1.9e-70
AUL19865.1|2124330_2124969_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUL19866.1|2124965_2125544_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19867.1|2125555_2126089_-	carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUL19868.1|2126093_2127053_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL19869.1|2127083_2127866_-	amidohydrolase	NA	NA	NA	NA	NA
AUL19870.1|2127975_2128968_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL19871.1|2128969_2130007_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.7	5.6e-97
AUL19872.1|2130091_2131384_+	guanine permease	NA	A0A0R6PHV4	Moraxella_phage	36.7	2.9e-66
AUL19873.1|2131566_2132583_+	luciferase	NA	NA	NA	NA	NA
AUL19874.1|2132691_2133075_+	thioredoxin	NA	V9SJ74	Achromobacter_phage	26.8	1.2e-09
AUL21279.1|2133078_2133435_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19875.1|2133455_2133686_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19876.1|2133709_2134507_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL19877.1|2134511_2135279_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL19878.1|2135275_2136271_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL19879.1|2136320_2137085_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	6.3e-29
AUL19880.1|2137257_2138862_-	ABC-F family ATPase	NA	A0A1V0SKJ1	Klosneuvirus	28.9	7.7e-53
AUL19881.1|2139115_2140096_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AUL19882.1|2140092_2140581_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
AUL19883.1|2140573_2141422_-	hydrolase	NA	NA	NA	NA	NA
AUL19884.1|2141513_2142011_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19885.1|2142148_2142508_-	cation:proton antiporter	NA	NA	NA	NA	NA
AUL19886.1|2142504_2142786_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
AUL19887.1|2142785_2143268_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
AUL19888.1|2143269_2144898_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
AUL19889.1|2144894_2145239_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
AUL19890.1|2145240_2148183_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
AUL19891.1|2148628_2149600_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL21280.1|2149589_2150972_-	GTP-binding protein	NA	NA	NA	NA	NA
AUL19892.1|2151114_2152065_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL19893.1|2152024_2153266_-	GTP-binding protein	NA	NA	NA	NA	NA
AUL19894.1|2153262_2154384_-	DNA repair exonuclease	NA	NA	NA	NA	NA
AUL19895.1|2155875_2156343_+	transcriptional regulator	NA	NA	NA	NA	NA
AUL19896.1|2156413_2157064_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19897.1|2157150_2158290_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19898.1|2158458_2159463_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
AUL19899.1|2159459_2160707_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUL19900.1|2161059_2161926_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
AUL19901.1|2161885_2163490_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL19902.1|2163501_2164188_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
AUL19903.1|2164184_2165225_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AUL19904.1|2165340_2166012_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL21281.1|2166032_2167001_+	secretion protein HlyD	NA	NA	NA	NA	NA
AUL19905.1|2166997_2167936_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
AUL19906.1|2167932_2169087_+	mannose-1-phosphate guanyltransferase	NA	NA	NA	NA	NA
AUL19907.1|2169095_2170547_+	ABC transporter permease	NA	NA	NA	NA	NA
AUL19908.1|2170577_2171060_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19909.1|2171061_2171955_+	hypothetical protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
AUL19910.1|2171951_2172395_+	hypothetical protein	NA	NA	NA	NA	NA
AUL19911.1|2172407_2172785_-	hypothetical protein	NA	NA	NA	NA	NA
AUL19912.1|2172924_2173323_+|protease	membrane-associated protease	protease	NA	NA	NA	NA
AUL19913.1|2173449_2173737_+|protease	CAAX protease family protein	protease	NA	NA	NA	NA
>prophage 15
CP018890	Bordetella holmesii isolate F613 chromosome, complete genome	3680984	2255394	2297547	3680984	transposase	Planktothrix_phage(25.0%)	41	NA	NA
AUL19996.1|2255394_2255655_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL19997.1|2256584_2257310_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUL19998.1|2257306_2258305_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	3.6e-16
AUL21284.1|2258310_2259312_+	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	1.8e-15
AUL19999.1|2259342_2260911_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL20000.1|2260910_2262218_+	palmitoyl-CoA hydrolase	NA	NA	NA	NA	NA
AUL20001.1|2262214_2262721_+	CMD domain protein	NA	NA	NA	NA	NA
AUL20002.1|2262717_2263305_+	alkylhydroperoxidase	NA	NA	NA	NA	NA
AUL20003.1|2263392_2264226_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL20004.1|2264395_2264677_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20005.1|2264686_2265262_-	peptidase	NA	NA	NA	NA	NA
AUL20006.1|2265269_2266742_-	peptidase M20	NA	NA	NA	NA	NA
AUL21285.1|2266898_2270948_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	68.4	2.2e-160
AUL20007.1|2271328_2271715_+	TRAP C4-dicarboxylate transporter	NA	NA	NA	NA	NA
AUL20008.1|2271728_2272550_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL20009.1|2272588_2272849_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL20010.1|2273059_2274358_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUL20011.1|2274400_2275429_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUL20012.1|2275543_2276110_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
AUL20013.1|2276168_2277014_-	phosphatase	NA	NA	NA	NA	NA
AUL21286.1|2277071_2277947_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUL20014.1|2278198_2278813_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20015.1|2278822_2280043_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL20016.1|2280091_2280757_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20017.1|2280804_2281800_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20018.1|2284977_2285892_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL20019.1|2286041_2287007_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL20020.1|2287014_2287431_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUL20021.1|2287427_2288345_+	oxidoreductase	NA	NA	NA	NA	NA
AUL20022.1|2288356_2288776_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20023.1|2288684_2290073_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUL21287.1|2290069_2290321_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20024.1|2290491_2291448_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL20025.1|2291430_2291643_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20026.1|2291692_2292466_+	MBL fold hydrolase	NA	NA	NA	NA	NA
AUL20027.1|2292462_2293596_+	malate dehydrogenase	NA	NA	NA	NA	NA
AUL20028.1|2293605_2294556_+	D-3-phosphoglycerate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	28.4	4.8e-18
AUL20029.1|2294587_2295388_+	aldolase	NA	NA	NA	NA	NA
AUL20030.1|2295402_2296557_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20031.1|2296384_2297260_-|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL20032.1|2297256_2297547_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
>prophage 16
CP018890	Bordetella holmesii isolate F613 chromosome, complete genome	3680984	2322095	2432925	3680984	tRNA,transposase,protease	Escherichia_phage(12.5%)	103	NA	NA
AUL20047.1|2322095_2323610_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
AUL20048.1|2323622_2323910_+	hypothetical protein	NA	NA	NA	NA	NA
AUL21289.1|2323930_2324818_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AUL20049.1|2324968_2325475_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL20050.1|2325471_2326428_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL20051.1|2326615_2327962_+	protein FpvAIII	NA	NA	NA	NA	NA
AUL20052.1|2328907_2329678_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL21290.1|2329674_2330685_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL20053.1|2330754_2331000_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL20054.1|2330999_2331446_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20055.1|2331501_2331696_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AUL20056.1|2331697_2332039_-	ferredoxin, 2Fe-2S type, ISC system	NA	NA	NA	NA	NA
AUL20057.1|2332048_2333911_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
AUL20058.1|2333950_2334457_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
AUL20059.1|2334460_2334784_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
AUL20060.1|2334785_2335190_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
AUL20061.1|2335226_2336438_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
AUL20062.1|2336459_2337008_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
AUL20063.1|2337232_2337724_-	protein tyrosine phosphatase	NA	NA	NA	NA	NA
AUL20064.1|2337939_2339970_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AUL20065.1|2340044_2341247_+	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AUL20066.1|2341789_2342725_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL20067.1|2343758_2344040_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20068.1|2344126_2344300_+	osmotically inducible protein OsmC	NA	NA	NA	NA	NA
AUL20069.1|2344411_2344756_+	alkylhydroperoxidase	NA	NA	NA	NA	NA
AUL20070.1|2344827_2345496_+	anti-sigma factor	NA	NA	NA	NA	NA
AUL20071.1|2346911_2347955_+	alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
AUL21291.1|2347951_2348053_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20072.1|2348144_2348405_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL20073.1|2348443_2349265_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL20074.1|2349514_2350168_+	repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
AUL20075.1|2350283_2351504_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL20076.1|2351554_2353984_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
AUL20077.1|2354149_2355448_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
AUL20078.1|2355552_2356206_-	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
AUL20079.1|2356208_2357519_-	trigger factor	NA	NA	NA	NA	NA
AUL20080.1|2357746_2358286_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	5.6e-24
AUL20081.1|2358770_2359031_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL21292.1|2359316_2360327_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AUL20082.1|2360323_2361094_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AUL20083.1|2361173_2361839_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	46.1	2.1e-49
AUL20084.1|2361806_2362298_-	SpoVR like family protein	NA	NA	NA	NA	NA
AUL20085.1|2362407_2362611_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
AUL20086.1|2362928_2363249_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20087.1|2363232_2363568_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20088.1|2363622_2363835_-	autotransporter	NA	NA	NA	NA	NA
AUL21294.1|2363910_2364249_+|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	50.0	3.7e-05
AUL21293.1|2364245_2364581_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL20089.1|2364643_2366215_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
AUL20090.1|2367008_2367320_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20091.1|2367512_2368013_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL20092.1|2368105_2368366_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL20093.1|2368493_2368688_-	hypothetical protein	NA	NA	NA	NA	NA
AUL21295.1|2374769_2375060_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL20094.1|2375056_2375932_+|transposase	transposase	transposase	U5P429	Shigella_phage	60.9	1.8e-96
AUL20095.1|2376316_2377780_+	ribonuclease E/G	NA	NA	NA	NA	NA
AUL20096.1|2377912_2379463_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
AUL20097.1|2379774_2380596_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL20098.1|2380634_2380895_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL20099.1|2380971_2381826_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	77.8	7.3e-127
AUL20100.1|2382008_2382866_+	EamA family transporter	NA	NA	NA	NA	NA
AUL20101.1|2382918_2383416_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUL20102.1|2383536_2384952_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20103.1|2384961_2386146_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AUL20104.1|2386142_2387741_+	MFS transporter	NA	NA	NA	NA	NA
AUL20105.1|2387836_2388955_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
AUL20106.1|2388923_2389169_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20107.1|2389579_2389765_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20108.1|2389920_2390832_+	EamA family transporter	NA	NA	NA	NA	NA
AUL20109.1|2390953_2391796_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
AUL20110.1|2391998_2393372_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AUL20111.1|2393681_2395193_-	ATP-binding protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
AUL20112.1|2395345_2396077_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20113.1|2396183_2397485_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AUL20114.1|2397492_2398401_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AUL20115.1|2398397_2398991_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
AUL20116.1|2399034_2399448_+	ribosome silencing factor	NA	NA	NA	NA	NA
AUL20117.1|2399444_2399915_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AUL20118.1|2399921_2400527_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AUL20119.1|2402328_2404113_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AUL20120.1|2404109_2405495_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUL20121.1|2405480_2406443_-	serine dehydratase	NA	NA	NA	NA	NA
AUL20122.1|2406512_2407142_-	DNA-binding protein	NA	NA	NA	NA	NA
AUL20123.1|2407179_2408388_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20124.1|2408509_2409079_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL20125.1|2409210_2410764_+	methyltransferase	NA	NA	NA	NA	NA
AUL20126.1|2411067_2412288_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL20127.1|2412695_2413598_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL20128.1|2413594_2414464_+	manganese/iron transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
AUL20129.1|2414460_2415312_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20130.1|2415308_2416133_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20131.1|2417904_2418165_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL20132.1|2418975_2421336_+	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
AUL20133.1|2421352_2422015_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUL20134.1|2423376_2424327_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL20135.1|2424344_2425157_+	hypothetical protein	NA	A0A1B0VCF0	Salmonella_phage	56.3	3.3e-76
AUL20136.1|2425172_2426579_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	28.2	1.5e-20
AUL20137.1|2426680_2427151_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20138.1|2427402_2428662_-	aspartate kinase	NA	NA	NA	NA	NA
AUL20139.1|2428746_2429796_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AUL20140.1|2429813_2430779_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
AUL20141.1|2430812_2431457_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AUL20142.1|2431467_2432925_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	30.0	7.5e-39
>prophage 17
CP018890	Bordetella holmesii isolate F613 chromosome, complete genome	3680984	2464872	2508738	3680984	tRNA,transposase,protease	Shigella_phage(40.0%)	35	NA	NA
AUL20171.1|2464872_2465520_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AUL20172.1|2465604_2466231_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AUL21298.1|2466295_2467141_+	hypothetical protein	NA	A0A1I9SA48	Rhodococcus_phage	35.1	2.4e-37
AUL20173.1|2467470_2468022_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20174.1|2468785_2469079_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20175.1|2469293_2469623_-	alkylhydroperoxidase	NA	NA	NA	NA	NA
AUL20176.1|2470206_2471667_+	cardiolipin synthase	NA	NA	NA	NA	NA
AUL20177.1|2471625_2471850_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20178.1|2472226_2473546_-	MFS transporter	NA	NA	NA	NA	NA
AUL20179.1|2473588_2474062_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20180.1|2474058_2475069_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20181.1|2475133_2476099_-	pyridoxal-5'-phosphate-dependent protein	NA	NA	NA	NA	NA
AUL20182.1|2476223_2476484_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL20183.1|2477327_2478203_-|transposase	transposase	transposase	U5P429	Shigella_phage	61.3	6.2e-97
AUL20184.1|2478199_2478490_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.7	1.4e-16
AUL20185.1|2478759_2479677_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL20186.1|2481032_2482319_+	phospholipase	NA	NA	NA	NA	NA
AUL20187.1|2482412_2483012_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20188.1|2483236_2483758_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20189.1|2484023_2484578_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20190.1|2484597_2485959_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20191.1|2486311_2488891_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AUL20192.1|2488937_2490044_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AUL20193.1|2490190_2490700_+	dehydratase	NA	NA	NA	NA	NA
AUL20194.1|2490723_2491704_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUL21299.1|2491709_2493125_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AUL20195.1|2493121_2494294_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL20196.1|2494290_2495511_+	CoA transferase	NA	NA	NA	NA	NA
AUL20197.1|2495507_2496305_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL20198.1|2497153_2501833_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	28.4	1.1e-27
AUL20199.1|2504981_2505944_-	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUL20200.1|2505940_2506459_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUL20201.1|2506611_2506932_+	amidohydrolase	NA	NA	NA	NA	NA
AUL20202.1|2507617_2507878_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL20203.1|2507916_2508738_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.4	2.9e-56
>prophage 18
CP018890	Bordetella holmesii isolate F613 chromosome, complete genome	3680984	2547558	2648291	3680984	tRNA,transposase	Leptospira_phage(17.65%)	95	NA	NA
AUL20238.1|2547558_2547819_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL20239.1|2548828_2549344_+	hypothetical protein	NA	T1SAR8	Salmonella_phage	44.6	3.9e-06
AUL20240.1|2549616_2549931_+	virulence factor	NA	NA	NA	NA	NA
AUL20241.1|2550118_2550355_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20242.1|2550645_2552001_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.5	2.1e-83
AUL21302.1|2552047_2553388_-	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	38.9	9.3e-76
AUL20243.1|2553489_2554122_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUL20244.1|2554121_2556491_-	cell division protein FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	2.2e-80
AUL20245.1|2556523_2557483_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	40.2	2.4e-57
AUL20246.1|2557469_2558162_+	DNA mismatch repair protein MutS	NA	NA	NA	NA	NA
AUL20247.1|2558158_2558491_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AUL20248.1|2558606_2559557_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL20249.1|2559553_2561620_-	cation acetate symporter	NA	NA	NA	NA	NA
AUL20250.1|2561619_2561892_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20251.1|2562586_2562676_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUL20252.1|2562675_2564460_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AUL20253.1|2564483_2566649_+	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.9	7.8e-24
AUL20254.1|2566659_2567259_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AUL20255.1|2570022_2570718_+	two-component system response regulator KdpE	NA	NA	NA	NA	NA
AUL20256.1|2570726_2571968_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20257.1|2572117_2573098_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20258.1|2573296_2574553_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	1.2e-11
AUL20259.1|2574755_2575181_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20260.1|2575231_2575594_-	cytochrome	NA	NA	NA	NA	NA
AUL21303.1|2576122_2577010_+	ATP-binding protein	NA	NA	NA	NA	NA
AUL20261.1|2578206_2578425_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUL20262.1|2578445_2578820_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20263.1|2579152_2581903_+	peptidase M16	NA	A0A2K9LA15	Tupanvirus	28.1	1.5e-19
AUL20264.1|2582071_2583229_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	60.8	4.0e-19
AUL20265.1|2583329_2585255_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.8	4.6e-145
AUL20266.1|2585343_2585718_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUL20267.1|2585739_2586270_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUL20268.1|2586383_2586617_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20269.1|2586703_2587795_-	ferrochelatase	NA	NA	NA	NA	NA
AUL20270.1|2587827_2588832_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AUL20271.1|2588941_2589841_+	NAD kinase	NA	NA	NA	NA	NA
AUL20272.1|2589862_2591518_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AUL20273.1|2592333_2593155_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.4	2.9e-56
AUL20274.1|2593193_2593454_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL20275.1|2594168_2594585_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
AUL21304.1|2594855_2595353_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20276.1|2595368_2596160_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AUL21305.1|2596217_2597204_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AUL21306.1|2597550_2598096_-|transposase	transposase	transposase	U5P429	Shigella_phage	66.3	2.2e-68
AUL20277.1|2598138_2598399_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL20278.1|2598491_2598992_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL20279.1|2599508_2600162_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
AUL20280.1|2600343_2601051_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL20281.1|2601047_2603663_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
AUL20282.1|2603719_2604904_+	putative methylaconitate Delta-isomerase PrpF	NA	NA	NA	NA	NA
AUL20283.1|2604964_2605573_+	lysine transporter LysE	NA	NA	NA	NA	NA
AUL20284.1|2605695_2606721_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUL20285.1|2606784_2607315_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL20286.1|2607194_2607536_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20287.1|2607532_2608240_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL20288.1|2608249_2609143_-	carboxyvinyl-carboxyphosphonate phosphorylmutase	NA	NA	NA	NA	NA
AUL20289.1|2609126_2609885_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUL20290.1|2610176_2612852_+	aconitate hydratase 1	NA	NA	NA	NA	NA
AUL20291.1|2612868_2614230_+	dihydroorotase	NA	NA	NA	NA	NA
AUL20292.1|2614249_2614972_+	hydrolase	NA	NA	NA	NA	NA
AUL20293.1|2614976_2615975_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
AUL20294.1|2616395_2616704_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20295.1|2616751_2617324_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20296.1|2617301_2617706_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20297.1|2617824_2618742_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL20298.1|2618751_2619333_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AUL20299.1|2619329_2620082_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUL20300.1|2620124_2620844_+	arginyltransferase	NA	NA	NA	NA	NA
AUL20301.1|2620886_2621942_+	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AUL20302.1|2622051_2622894_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	77.8	4.5e-129
AUL20303.1|2622951_2623212_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL20304.1|2624704_2625823_+	porin	NA	NA	NA	NA	NA
AUL20305.1|2625895_2626753_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20306.1|2626774_2627614_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
AUL20307.1|2627687_2629205_+	peptidase	NA	NA	NA	NA	NA
AUL20308.1|2629217_2630315_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUL20309.1|2630326_2630749_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AUL20310.1|2630778_2630982_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20311.1|2631329_2632082_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20312.1|2632081_2632573_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20313.1|2632644_2634018_+	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	1.8e-50
AUL20314.1|2634124_2634508_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUL20315.1|2634506_2635361_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20316.1|2635383_2636199_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
AUL20317.1|2636312_2637143_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL20318.1|2637291_2638269_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL20319.1|2639937_2640516_+	Phasin (PHA-granule associated protein)	NA	NA	NA	NA	NA
AUL20320.1|2641075_2641897_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL20321.1|2641935_2642196_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL20322.1|2642239_2642869_-	calcium:sodium antiporter	NA	NA	NA	NA	NA
AUL20323.1|2643026_2644370_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AUL20324.1|2644378_2644762_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20325.1|2644921_2646073_+	monooxygenase	NA	NA	NA	NA	NA
AUL20326.1|2646171_2647122_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL20327.1|2647265_2648291_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
>prophage 19
CP018890	Bordetella holmesii isolate F613 chromosome, complete genome	3680984	2928413	3028183	3680984	tRNA,transposase	Ralstonia_virus(20.0%)	83	NA	NA
AUL20560.1|2928413_2929193_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AUL20561.1|2929215_2930163_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
AUL20562.1|2930164_2930365_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AUL20563.1|2930699_2930960_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL20564.1|2930998_2931820_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL20565.1|2932140_2932857_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
AUL20566.1|2932853_2933747_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL20567.1|2933910_2935131_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL20568.1|2935283_2936366_+	iron ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
AUL20569.1|2936376_2938023_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AUL20570.1|2938046_2939030_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL20571.1|2939092_2940505_-	signal recognition particle protein	NA	NA	NA	NA	NA
AUL20572.1|2940622_2941465_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20573.1|2941743_2942352_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
AUL20574.1|2942367_2942988_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUL20575.1|2943053_2943764_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.6e-13
AUL20576.1|2943765_2944488_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
AUL20577.1|2944474_2944765_-	inner-membrane translocator	NA	NA	NA	NA	NA
AUL20578.1|2944840_2946061_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	2.1e-183
AUL21316.1|2946785_2947637_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUL20579.1|2947688_2948942_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL20580.1|2949118_2949907_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20581.1|2950026_2950941_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL20582.1|2951073_2952966_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
AUL20583.1|2953151_2954531_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
AUL20584.1|2954975_2955272_+	site-specific recombinase	NA	NA	NA	NA	NA
AUL20585.1|2955315_2955576_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL20586.1|2955668_2956169_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL20587.1|2956182_2956407_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL20588.1|2959072_2959675_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AUL20589.1|2959808_2960267_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AUL20590.1|2960268_2960868_-	iron transport sensor protein	NA	NA	NA	NA	NA
AUL20591.1|2960876_2961686_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUL20592.1|2961720_2962575_+	permease	NA	NA	NA	NA	NA
AUL20593.1|2962694_2963282_+	histidine utilization protein HutD	NA	NA	NA	NA	NA
AUL20594.1|2963278_2964658_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
AUL20595.1|2972980_2974321_+	8-amino-7-oxononanoate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
AUL20596.1|2974334_2975186_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
AUL20597.1|2975197_2976463_-	capsule biosynthesis protein CapA	NA	NA	NA	NA	NA
AUL20598.1|2976524_2978606_-	beta-3-deoxy-D-manno-oct-2-ulosonic acid transferase	NA	NA	NA	NA	NA
AUL20599.1|2979553_2979814_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL20600.1|2979906_2980407_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AUL20601.1|2980403_2981258_-	sulfatase	NA	NA	NA	NA	NA
AUL20602.1|2981250_2982045_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL20603.1|2982260_2983211_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL20604.1|2983813_2984611_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL20605.1|2984650_2985304_-	DL-methionine transporter permease subunit	NA	NA	NA	NA	NA
AUL20606.1|2985284_2986349_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
AUL20607.1|2986512_2988738_-	glycosyl hydrolase	NA	NA	NA	NA	NA
AUL20608.1|2988983_2990828_-	FAD-dependent cmnm(5)s(2)U34 oxidoreductase	NA	NA	NA	NA	NA
AUL20609.1|2990944_2991817_+	inositol monophosphatase	NA	NA	NA	NA	NA
AUL20610.1|2991863_2993564_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
AUL20611.1|2993626_2994826_+	amidohydrolase	NA	NA	NA	NA	NA
AUL20612.1|2994836_2995715_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL20613.1|2995821_2996859_+	hypothetical protein	NA	NA	NA	NA	NA
AUL21317.1|2996939_2997344_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUL20614.1|2997355_2998813_+	magnesium transporter	NA	NA	NA	NA	NA
AUL20615.1|2999455_3000052_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AUL20616.1|3000212_3000671_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL20617.1|3001448_3002420_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20618.1|3002541_3002961_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20619.1|3003836_3004097_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL20620.1|3004252_3005473_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL20621.1|3005534_3006422_-	HflC protein	NA	NA	NA	NA	NA
AUL20622.1|3006439_3007744_-	HflK protein	NA	NA	NA	NA	NA
AUL20623.1|3007709_3008816_-	GTPase HflX	NA	NA	NA	NA	NA
AUL20624.1|3008903_3009140_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
AUL20625.1|3009323_3010397_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AUL20626.1|3010393_3011749_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AUL20627.1|3011773_3012931_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AUL20628.1|3012936_3013575_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20629.1|3013578_3014874_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AUL20630.1|3014906_3016193_-	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase	NA	NA	NA	NA	NA
AUL20631.1|3016205_3016694_-	transcriptional regulator	NA	NA	NA	NA	NA
AUL20632.1|3016690_3017839_-	23S rRNA (adenine(2503)-C(2))-methyltransferase	NA	NA	NA	NA	NA
AUL20633.1|3017868_3018294_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.9	2.4e-22
AUL20634.1|3018613_3021493_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	1.1e-137
AUL20635.1|3021546_3022767_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	3.0e-182
AUL20636.1|3022815_3023679_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AUL20637.1|3023678_3024272_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUL20638.1|3024563_3024824_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUL20639.1|3025323_3025575_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20640.1|3025561_3028183_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.5	2.8e-84
>prophage 20
CP018890	Bordetella holmesii isolate F613 chromosome, complete genome	3680984	3059794	3112207	3680984	tRNA,transposase,protease	Synechococcus_phage(20.0%)	43	NA	NA
AUL20671.1|3059794_3060745_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL20672.1|3062285_3065057_+	bifunctional glutamine synthetase adenylyltransferase/deadenyltransferase	NA	NA	NA	NA	NA
AUL20673.1|3065096_3065771_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20674.1|3065777_3067169_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AUL20675.1|3067346_3069011_+	Na/Pi cotransporter	NA	NA	NA	NA	NA
AUL20676.1|3069079_3069751_+	phosphoglycolate phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	28.3	1.7e-06
AUL20677.1|3069781_3070576_-	carboxymethylenebutenolidase	NA	NA	NA	NA	NA
AUL20678.1|3070615_3071464_-	ZIP family metal transporter	NA	NA	NA	NA	NA
AUL21318.1|3073114_3074065_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AUL20679.1|3074096_3076100_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AUL20680.1|3076092_3076734_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AUL20681.1|3076730_3077120_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
AUL20682.1|3077151_3077910_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20683.1|3077863_3080584_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	29.9	6.5e-68
AUL20684.1|3080600_3081266_+	Rossman fold protein, TIGR00730 family	NA	A0A1D8KU27	Synechococcus_phage	32.8	3.1e-16
AUL20685.1|3081351_3081825_+	toxin	NA	NA	NA	NA	NA
AUL20686.1|3081832_3082453_+	toxin	NA	NA	NA	NA	NA
AUL20687.1|3083696_3084071_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AUL20688.1|3084159_3085413_-	glycine/betaine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.6	5.1e-28
AUL20689.1|3085409_3086267_-	ABC transporter permease	NA	NA	NA	NA	NA
AUL20690.1|3086406_3087402_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL20691.1|3087951_3089172_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL21319.1|3089213_3090470_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUL20692.1|3090710_3091856_+	Bcr/CflA family drug resistance efflux transporter	NA	NA	NA	NA	NA
AUL20693.1|3092162_3092399_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AUL20694.1|3092479_3092647_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AUL20695.1|3092803_3093892_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20696.1|3093917_3095138_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AUL20697.1|3097356_3097788_+	DNA-binding protein	NA	NA	NA	NA	NA
AUL20698.1|3097914_3098427_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUL21320.1|3098459_3099620_+	MFS transporter	NA	NA	NA	NA	NA
AUL20699.1|3099691_3102349_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	38.7	7.5e-170
AUL20700.1|3102360_3103038_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20701.1|3103037_3104087_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AUL20702.1|3104110_3105370_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.2	1.9e-94
AUL20703.1|3105376_3105766_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20704.1|3105917_3106202_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUL20705.1|3106198_3106588_+	hypothetical protein	NA	NA	NA	NA	NA
AUL21321.1|3106600_3107764_-	secretion protein	NA	NA	NA	NA	NA
AUL20706.1|3107790_3109551_-|protease	protease/lipase ABC transporter ATP-binding protein	protease	F2Y2R6	Organic_Lake_phycodnavirus	28.5	3.5e-14
AUL20707.1|3109547_3110849_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20708.1|3111086_3111347_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL20709.1|3111385_3112207_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
>prophage 21
CP018890	Bordetella holmesii isolate F613 chromosome, complete genome	3680984	3334853	3402421	3680984	tRNA,transposase	Leptospira_phage(22.22%)	60	NA	NA
AUL20886.1|3334853_3335765_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AUL20887.1|3335766_3337902_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUL20888.1|3337898_3338438_+	D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AUL20889.1|3338441_3339170_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUL20890.1|3339156_3339990_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20891.1|3339994_3340921_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUL21336.1|3340999_3342415_+	FAD-binding dehydrogenase	NA	NA	NA	NA	NA
AUL20892.1|3342401_3343484_+	tricarballylate utilization protein B	NA	NA	NA	NA	NA
AUL20893.1|3343597_3343993_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
AUL20894.1|3343998_3344532_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.6	7.5e-13
AUL20895.1|3346922_3348152_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20896.1|3348152_3349595_-	pyruvate kinase	NA	NA	NA	NA	NA
AUL20897.1|3349690_3350833_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.0	3.2e-37
AUL20898.1|3350851_3351331_+	thioesterase	NA	NA	NA	NA	NA
AUL20899.1|3351359_3352148_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase	NA	NA	NA	NA	NA
AUL20900.1|3352161_3353700_-	molecular chaperone SurA	NA	NA	NA	NA	NA
AUL21337.1|3353696_3356105_-	LPS biosynthesis protein	NA	NA	NA	NA	NA
AUL20901.1|3356258_3357326_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AUL20902.1|3357325_3358006_+	mannose-1-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AUL20903.1|3358147_3358873_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20904.1|3358881_3359205_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
AUL20905.1|3359258_3359906_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20906.1|3360041_3360455_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20907.1|3360540_3361590_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AUL20908.1|3361735_3362599_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL20909.1|3362724_3363432_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL20910.1|3363399_3364221_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AUL20911.1|3364259_3364520_-|transposase	transposase	transposase	NA	NA	NA	NA
AUL20912.1|3364577_3366086_-	sulfite reductase	NA	NA	NA	NA	NA
AUL20913.1|3366242_3367766_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20914.1|3367820_3368468_-	carbonate dehydratase	NA	NA	NA	NA	NA
AUL20915.1|3368610_3368952_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20916.1|3369109_3369442_+	PsiF repeat family protein	NA	NA	NA	NA	NA
AUL20917.1|3369490_3370531_-	cyclase	NA	NA	NA	NA	NA
AUL20918.1|3370534_3371314_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AUL20919.1|3371349_3371646_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20920.1|3371660_3371936_-	muconolactone delta-isomerase	NA	NA	NA	NA	NA
AUL20921.1|3372003_3372648_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUL20922.1|3372650_3372740_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AUL20923.1|3372930_3373716_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUL20924.1|3373753_3374479_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUL20925.1|3374492_3375833_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
AUL20926.1|3375927_3376860_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUL20927.1|3377088_3379860_-	peptidase S8	NA	NA	NA	NA	NA
AUL20928.1|3380299_3383146_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AUL20929.1|3383292_3384006_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	41.4	1.6e-47
AUL20930.1|3384018_3384561_-	GNAT family N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	46.4	1.7e-28
AUL20931.1|3384666_3385575_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.7	4.4e-05
AUL20932.1|3385666_3387523_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AUL20933.1|3387706_3388747_-	GntR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.2	4.3e-20
AUL20934.1|3388889_3389795_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AUL20935.1|3392490_3393258_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
AUL20936.1|3393375_3394020_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20937.1|3394283_3394580_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AUL20938.1|3396009_3396204_-	hypothetical protein	NA	NA	NA	NA	NA
AUL20939.1|3396478_3397333_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20940.1|3397358_3398579_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL21338.1|3398896_3400828_+	hypothetical protein	NA	NA	NA	NA	NA
AUL20941.1|3401300_3401561_+|transposase	transposase	transposase	NA	NA	NA	NA
AUL20942.1|3401599_3402421_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
>prophage 22
CP018890	Bordetella holmesii isolate F613 chromosome, complete genome	3680984	3595305	3645469	3680984	tRNA,transposase,holin	Catovirus(18.18%)	40	NA	NA
AUL21111.1|3595305_3597096_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.5	5.5e-07
AUL21112.1|3597137_3597773_-	hypothetical protein	NA	A0A2I7S9X1	Vibrio_phage	29.0	1.2e-12
AUL21113.1|3597775_3598090_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
AUL21114.1|3599640_3601263_-|holin	choline dehydrogenase	holin	A0A1V0S9J5	Catovirus	29.6	5.4e-46
AUL21115.1|3601433_3601538_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
AUL21116.1|3601530_3602241_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
AUL21117.1|3602515_3603004_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUL21118.1|3603145_3604345_+	2-aminoadipate aminotransferase	NA	NA	NA	NA	NA
AUL21119.1|3604420_3605344_+	4-hydroxybenzoate polyprenyltransferase	NA	NA	NA	NA	NA
AUL21120.1|3605678_3606059_+	hypothetical protein	NA	NA	NA	NA	NA
AUL21346.1|3606202_3606961_-	transcriptional regulator GlcC	NA	NA	NA	NA	NA
AUL21347.1|3607172_3609344_+	malate synthase G	NA	NA	NA	NA	NA
AUL21121.1|3609401_3610475_-	lipase	NA	G9BWD6	Planktothrix_phage	37.1	4.4e-28
AUL21122.1|3610467_3612237_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AUL21123.1|3612251_3613361_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL21124.1|3613476_3615966_-	signal protein	NA	NA	NA	NA	NA
AUL21125.1|3615952_3616624_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUL21126.1|3617147_3618194_+	oxidoreductase	NA	NA	NA	NA	NA
AUL21127.1|3618202_3618772_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUL21128.1|3619869_3620952_+	UDP-N-acetylglucosamine 2-epimerase	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	32.9	2.3e-45
AUL21129.1|3620976_3622230_+	glycosyltransferase WbuB	NA	NA	NA	NA	NA
AUL21130.1|3622234_3623422_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	NA	NA	NA	NA
AUL21131.1|3623418_3624012_+	sugar transferase	NA	NA	NA	NA	NA
AUL21132.1|3624398_3626336_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	27.9	2.2e-25
AUL21133.1|3626469_3627420_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AUL21134.1|3627501_3628209_-	hypothetical protein	NA	NA	NA	NA	NA
AUL21135.1|3628272_3630909_+	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	26.3	8.0e-23
AUL21136.1|3631038_3632259_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.1e-181
AUL21348.1|3632337_3633393_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUL21137.1|3633392_3634163_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AUL21138.1|3634730_3635531_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
AUL21139.1|3635619_3637047_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUL21140.1|3637066_3637825_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUL21141.1|3639788_3640268_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AUL21142.1|3640255_3641182_-	bestrophin	NA	NA	NA	NA	NA
AUL21143.1|3641298_3641826_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
AUL21144.1|3641851_3643072_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AUL21349.1|3643467_3644136_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	40.7	2.3e-35
AUL21145.1|3644348_3645170_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.7	7.2e-55
AUL21146.1|3645208_3645469_-|transposase	transposase	transposase	NA	NA	NA	NA
