The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP015562	Pasteurella multocida strain USDA-ARS-USMARC-59910 chromosome, complete genome	2345801	524594	571997	2345801	tRNA,transposase,integrase,terminase,tail	Mannheimia_phage(51.06%)	64	526156:526201	572419:572464
AUK33824.1|524594_526037_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
526156:526201	attL	CATGGCATGCAAGAGGTCGTCGGTTCGATCCCGATTATCTCCACCA	NA	NA	NA	NA
AUK33825.1|526305_527478_-|integrase	integrase	integrase	A0A059VF45	Pseudomonas_phage	52.9	5.9e-111
AUK33826.1|527853_528339_-	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	40.2	1.2e-20
AUK33827.1|528424_528724_-	hypothetical protein	NA	NA	NA	NA	NA
AUK33828.1|528733_529267_-	hypothetical protein	NA	A0A0M3LS47	Mannheimia_phage	36.6	1.3e-20
AUK33829.1|529401_530001_-	hypothetical protein	NA	A0A218KC93	Bacillus_phage	34.2	3.0e-18
AUK33830.1|530051_530840_-	hypothetical protein	NA	C5IHK3	Burkholderia_virus	29.2	3.2e-20
AUK33831.1|530911_531265_-	hypothetical protein	NA	I6XKT1	Burkholderia_virus	31.8	1.7e-05
AUK33832.1|531307_531499_-	hypothetical protein	NA	NA	NA	NA	NA
AUK33833.1|531510_531975_-	single-stranded DNA-binding protein	NA	A0A2I7RK19	Vibrio_phage	69.0	6.1e-35
AUK33834.1|531978_532590_-	exonuclease	NA	A0A0M3LPU0	Mannheimia_phage	76.4	6.3e-88
AUK33835.1|532582_533434_-	phage recombination protein Bet	NA	A0A2H4JAQ4	uncultured_Caudovirales_phage	63.9	4.8e-62
AUK33836.1|533437_534424_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	39.9	5.8e-51
AUK33837.1|534601_534838_-	hypothetical protein	NA	NA	NA	NA	NA
AUK33838.1|534824_535109_-	hypothetical protein	NA	NA	NA	NA	NA
AUK33839.1|535175_535487_+	hypothetical protein	NA	NA	NA	NA	NA
AUK33840.1|535548_536184_-	antirepressor	NA	A6XMM0	Bacillus_virus	53.3	2.1e-22
AUK33841.1|536645_537179_-	hypothetical protein	NA	NA	NA	NA	NA
AUK33842.1|537266_537530_-	hypothetical protein	NA	NA	NA	NA	NA
AUK33843.1|537754_537985_-	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	52.8	3.4e-10
AUK33844.1|538603_538987_-	hypothetical protein	NA	NA	NA	NA	NA
AUK33845.1|538983_539463_-	HicB	NA	K7PJX6	Enterobacterial_phage	47.1	8.3e-19
AUK33846.1|539465_539729_-	hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
AUK33847.1|539874_540564_-	transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	58.2	1.7e-73
AUK33848.1|540691_540901_+	transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	52.3	5.5e-12
AUK33849.1|540921_541197_+	hypothetical protein	NA	NA	NA	NA	NA
AUK33850.1|541254_541956_+	DNA-binding protein	NA	A0A2I7RHG4	Vibrio_phage	55.8	7.1e-35
AUK33851.1|541952_542306_+	hypothetical protein	NA	A0A1C9LVX4	Vibrio_phage	33.6	1.3e-08
AUK33852.1|542307_543210_+	hypothetical protein	NA	A0A0U4JX08	Bacillus_phage	37.7	5.5e-32
AUK33853.1|543209_543899_+	replication protein P	NA	D0UIL4	Aggregatibacter_phage	34.1	1.4e-32
AUK35390.1|543908_544439_+	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	58.9	1.0e-54
AUK33854.1|544428_544887_+	NinB protein	NA	Q7Y5V7	Haemophilus_phage	53.4	5.8e-38
AUK33855.1|544960_545173_+	hypothetical protein	NA	NA	NA	NA	NA
AUK33856.1|545260_545863_+	recombinase NinG	NA	H6WRY9	Salmonella_phage	38.2	6.3e-32
AUK33857.1|545862_546228_+	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	27.3	3.5e-09
AUK35391.1|546822_547077_+	hypothetical protein	NA	NA	NA	NA	NA
AUK33858.1|547073_547604_+	glycoside hydrolase	NA	A0A0M3LPQ1	Mannheimia_phage	50.9	9.7e-45
AUK35392.1|547576_547900_+	hypothetical protein	NA	NA	NA	NA	NA
AUK33859.1|547805_548087_+	hypothetical protein	NA	NA	NA	NA	NA
AUK33860.1|548121_548556_-	CopG family transcriptional regulator	NA	A0A0R6PJ17	Moraxella_phage	38.0	1.0e-20
AUK33861.1|548849_549347_+|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	70.7	7.4e-47
AUK33862.1|549330_550557_+|terminase	terminase	terminase	A0A0M3LTA2	Mannheimia_phage	77.0	9.4e-192
AUK33863.1|550571_552017_+	hypothetical protein	NA	A0A0M3LPQ5	Mannheimia_phage	58.6	2.4e-146
AUK33864.1|551970_552942_+	hypothetical protein	NA	F1C5D8	Cronobacter_phage	41.0	1.6e-53
AUK33865.1|552956_554303_+	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	55.3	4.0e-127
AUK33866.1|554302_554737_+	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	75.7	1.1e-54
AUK33867.1|554748_555747_+	encapsulating for peroxidase	NA	A0A0M3LQZ1	Mannheimia_phage	74.7	9.1e-145
AUK35393.1|556291_556660_+	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	42.1	4.7e-22
AUK33868.1|556662_557007_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	57.9	3.0e-31
AUK33869.1|557011_557383_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	51.2	1.3e-24
AUK33870.1|557379_557751_+	hypothetical protein	NA	NA	NA	NA	NA
AUK33871.1|557762_558245_+|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	62.0	2.0e-44
AUK33872.1|558298_558970_+	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	42.9	1.5e-42
AUK33873.1|559000_559465_+	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	50.0	5.2e-34
AUK33874.1|559532_559928_+	hypothetical protein	NA	A0A0M3LR23	Mannheimia_phage	83.2	7.7e-55
AUK35394.1|559986_562431_+|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	57.0	1.6e-150
AUK33875.1|562433_562763_+	hypothetical protein	NA	S5MW28	Escherichia_phage	37.1	3.2e-14
AUK33876.1|562852_563566_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	63.9	2.1e-82
AUK33877.1|563570_564314_+|tail	phage tail protein	tail	A0A0M3LQI5	Mannheimia_phage	59.6	7.4e-83
AUK35395.1|564256_564877_+|tail	phage tail protein	tail	A0A0M3LQC4	Mannheimia_phage	57.4	1.1e-52
AUK33878.1|564880_569884_+	host specificity protein	NA	A0A0M3LQ61	Mannheimia_phage	38.9	2.5e-251
AUK33879.1|569931_570258_+	hypothetical protein	NA	NA	NA	NA	NA
AUK33880.1|570397_571534_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	58.0	3.8e-123
AUK33881.1|571580_571997_+|transposase	transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
572419:572464	attR	CATGGCATGCAAGAGGTCGTCGGTTCGATCCCGATTATCTCCACCA	NA	NA	NA	NA
>prophage 2
CP015562	Pasteurella multocida strain USDA-ARS-USMARC-59910 chromosome, complete genome	2345801	1593354	1602712	2345801	tRNA	Sinorhizobium_phage(16.67%)	9	NA	NA
AUK34704.1|1593354_1594629_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	49.5	1.8e-92
AUK34705.1|1594669_1595287_+	lipoprotein localization factor LolB	NA	NA	NA	NA	NA
AUK34706.1|1595286_1596174_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AUK34707.1|1596243_1597191_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.7	1.9e-43
AUK34708.1|1597266_1598820_-	peptidase M23	NA	A0A2K9VGT1	Pontimonas_phage	49.6	8.4e-20
AUK34709.1|1599054_1599846_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	4.4e-17
AUK34710.1|1599854_1600640_+	high-affinity zinc transporter membrane component	NA	NA	NA	NA	NA
AUK34711.1|1600716_1601697_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	1.3e-15
AUK34712.1|1601713_1602712_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	2.3e-15
>prophage 3
CP015562	Pasteurella multocida strain USDA-ARS-USMARC-59910 chromosome, complete genome	2345801	1953735	2011673	2345801	tail,holin,transposase,coat,integrase,terminase,head	Mannheimia_phage(37.5%)	72	1959615:1959665	2012125:2012175
AUK35014.1|1953735_1956567_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.3	0.0e+00
AUK35015.1|1956738_1957239_+	single-stranded DNA-binding protein	NA	I3PUY5	Vibrio_phage	55.6	4.0e-40
AUK35016.1|1957421_1957886_+|transposase	transposase	transposase	A0A0A8WIU6	Clostridium_phage	36.1	2.3e-13
AUK35017.1|1958462_1959317_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	40.3	5.8e-31
1959615:1959665	attL	CTTCTAAGCCGTAGGTCATTGGTTCGAATCCAATAGGGCGTGCCATTAATT	NA	NA	NA	NA
AUK35018.1|1959691_1960747_-|integrase	integrase	integrase	A0A077KGX2	Edwardsiella_phage	37.9	1.6e-62
AUK35019.1|1961136_1961859_-	DNA-binding protein	NA	G0ZND1	Cronobacter_phage	52.5	3.3e-35
AUK35020.1|1961869_1962091_-	hypothetical protein	NA	NA	NA	NA	NA
AUK35021.1|1962335_1963244_-	hypothetical protein	NA	A0A0M4S6X1	Salmonella_phage	36.1	2.5e-40
AUK35022.1|1963347_1963836_-	hypothetical protein	NA	A0A0M3LS47	Mannheimia_phage	51.2	3.2e-34
AUK35023.1|1964047_1964413_-	hypothetical protein	NA	NA	NA	NA	NA
AUK35024.1|1964409_1965009_-	hypothetical protein	NA	A0A218KC93	Bacillus_phage	34.2	3.9e-18
AUK35025.1|1965059_1965848_-	hypothetical protein	NA	C5IHK3	Burkholderia_virus	29.2	3.2e-20
AUK35026.1|1965919_1966273_-	hypothetical protein	NA	I6XKT1	Burkholderia_virus	31.8	1.7e-05
AUK35027.1|1966315_1966507_-	hypothetical protein	NA	NA	NA	NA	NA
AUK35028.1|1966518_1966983_-	single-stranded DNA-binding protein	NA	A0A2I7RK19	Vibrio_phage	69.0	6.1e-35
AUK35029.1|1966986_1967598_-	exonuclease	NA	A0A0M3LPU0	Mannheimia_phage	76.4	6.3e-88
AUK35030.1|1967590_1968442_-	phage recombination protein Bet	NA	A0A2H4JAQ4	uncultured_Caudovirales_phage	63.9	4.8e-62
AUK35031.1|1968445_1969432_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	39.9	5.8e-51
AUK35032.1|1969609_1969846_-	hypothetical protein	NA	NA	NA	NA	NA
AUK35033.1|1969832_1970117_-	hypothetical protein	NA	NA	NA	NA	NA
AUK35034.1|1970183_1970495_+	hypothetical protein	NA	NA	NA	NA	NA
AUK35035.1|1970556_1971204_-	antirepressor	NA	Q7Y5V4	Haemophilus_phage	64.2	3.5e-36
AUK35036.1|1971469_1972015_-|integrase	integrase	integrase	NA	NA	NA	NA
AUK35037.1|1972606_1972837_-	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	52.8	3.4e-10
AUK35038.1|1973455_1973839_-	hypothetical protein	NA	NA	NA	NA	NA
AUK35039.1|1973835_1974315_-	HicB	NA	K7PJX6	Enterobacterial_phage	47.1	8.3e-19
AUK35040.1|1974317_1974581_-	hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
AUK35041.1|1974726_1975416_-	transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	58.2	1.7e-73
AUK35042.1|1975543_1975753_+	transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	52.3	5.5e-12
AUK35043.1|1975773_1976049_+	hypothetical protein	NA	NA	NA	NA	NA
AUK35044.1|1976106_1976808_+	DNA-binding protein	NA	A0A2I7RHG4	Vibrio_phage	55.8	7.1e-35
AUK35045.1|1976804_1977158_+	hypothetical protein	NA	A0A1C9LVX4	Vibrio_phage	33.6	1.3e-08
AUK35046.1|1977159_1978062_+	hypothetical protein	NA	A0A0U4JX08	Bacillus_phage	37.7	5.5e-32
AUK35047.1|1978061_1978751_+	replication protein P	NA	D0UIL4	Aggregatibacter_phage	34.1	1.4e-32
AUK35429.1|1978760_1979291_+	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	58.9	1.0e-54
AUK35048.1|1979280_1979739_+	NinB protein	NA	Q7Y5V7	Haemophilus_phage	53.4	5.8e-38
AUK35049.1|1979812_1980025_+	hypothetical protein	NA	NA	NA	NA	NA
AUK35050.1|1980112_1980715_+	recombinase NinG	NA	H6WRY9	Salmonella_phage	38.2	6.3e-32
AUK35051.1|1980714_1981080_+	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	27.3	3.5e-09
AUK35052.1|1981668_1982034_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
AUK35053.1|1982005_1982590_+	hypothetical protein	NA	Q7Y5V0	Haemophilus_phage	55.3	6.5e-58
AUK35054.1|1982592_1982916_+	hypothetical protein	NA	NA	NA	NA	NA
AUK35055.1|1983194_1983551_+	hypothetical protein	NA	NA	NA	NA	NA
AUK35056.1|1983680_1983935_-	hypothetical protein	NA	NA	NA	NA	NA
AUK35057.1|1983922_1984303_-	hypothetical protein	NA	NA	NA	NA	NA
AUK35058.1|1984441_1985143_+	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
AUK35059.1|1985129_1985558_+	hypothetical protein	NA	NA	NA	NA	NA
AUK35430.1|1985942_1986464_+	hypothetical protein	NA	A0A2H4J1J5	uncultured_Caudovirales_phage	38.6	9.0e-19
AUK35060.1|1986466_1987738_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	61.7	8.6e-148
AUK35061.1|1987747_1989151_+	hypothetical protein	NA	A0A0M3LQA1	Mannheimia_phage	59.6	4.4e-153
AUK35431.1|1989140_1990742_+|head	phage head morphogenesis protein	head	A0A0M3LQ07	Mannheimia_phage	52.1	3.3e-152
AUK35062.1|1990744_1990963_+	hypothetical protein	NA	NA	NA	NA	NA
AUK35063.1|1990937_1991372_+	guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	D0UIJ3	Aggregatibacter_phage	61.2	3.1e-41
AUK35064.1|1991707_1992478_+	hypothetical protein	NA	A0A1V0DY60	Dinoroseobacter_phage	36.2	1.5e-25
AUK35065.1|1992495_1993653_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	43.3	8.3e-81
AUK35066.1|1993709_1993946_+	hypothetical protein	NA	NA	NA	NA	NA
AUK35067.1|1993962_1994430_+	hypothetical protein	NA	A0A0M3LSP7	Mannheimia_phage	55.7	1.4e-34
AUK35068.1|1994431_1994806_+	hypothetical protein	NA	NA	NA	NA	NA
AUK35432.1|1994807_1995209_+	hypothetical protein	NA	A0A0M3LPJ5	Mannheimia_phage	61.4	2.1e-39
AUK35069.1|1995208_1995601_+	hypothetical protein	NA	A0A0M3LQB6	Mannheimia_phage	46.2	5.5e-29
AUK35070.1|1995613_1996630_+	hypothetical protein	NA	A0A0M3LQ19	Mannheimia_phage	69.9	7.6e-131
AUK35071.1|1996702_1997119_+	hypothetical protein	NA	NA	NA	NA	NA
AUK35072.1|1997106_1997448_+	hypothetical protein	NA	A0A0M3LQT0	Mannheimia_phage	53.8	2.7e-24
AUK35433.1|1997488_1997818_+|tail	phage tail protein	tail	A0A0M3LQW6	Mannheimia_phage	49.1	4.8e-26
AUK35073.1|1998122_1998818_+	hypothetical protein	NA	NA	NA	NA	NA
AUK35074.1|1998940_2001655_+	hypothetical protein	NA	A0A0M3LS69	Mannheimia_phage	39.1	5.1e-174
AUK35075.1|2001651_2002356_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	64.1	1.6e-82
AUK35076.1|2002358_2003099_+|tail	phage tail protein	tail	A0A0M3LQI5	Mannheimia_phage	60.0	8.7e-84
AUK35434.1|2003041_2003662_+|tail	phage tail protein	tail	A0A0M3LQC4	Mannheimia_phage	57.4	1.1e-52
AUK35077.1|2009607_2009934_+	hypothetical protein	NA	NA	NA	NA	NA
AUK35078.1|2010073_2011210_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	58.0	3.8e-123
AUK35079.1|2011256_2011673_+|transposase	transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
2012125:2012175	attR	CTTCTAAGCCGTAGGTCATTGGTTCGAATCCAATAGGGCGTGCCATTAATT	NA	NA	NA	NA
