The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP015559	Pasteurella multocida strain USDA-ARS-USMARC-60215 chromosome, complete genome	2344126	337672	395574	2344126	integrase,head,coat,holin,terminase,tail,transposase	Mannheimia_phage(37.5%)	72	337171:337221	389645:389695
337171:337221	attL	AATTAATGGCACGCCCTATTGGATTCGAACCAATGACCTACGGCTTAGAAG	NA	NA	NA	NA
AUK27429.1|337672_338089_-|transposase	transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
AUK27430.1|338135_339272_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	58.0	3.8e-123
AUK27431.1|339411_339738_-	hypothetical protein	NA	NA	NA	NA	NA
AUK27432.1|345683_346274_-|tail	phage tail protein	tail	A0A0M3LQC4	Mannheimia_phage	57.1	3.1e-52
AUK27433.1|346216_346957_-|tail	phage tail protein	tail	A0A0M3LQI5	Mannheimia_phage	60.0	1.3e-84
AUK27434.1|346959_347664_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	64.1	1.6e-82
AUK27435.1|347660_350375_-	hypothetical protein	NA	A0A0M3LS69	Mannheimia_phage	39.1	5.1e-174
AUK27436.1|350497_351193_-	hypothetical protein	NA	NA	NA	NA	NA
AUK29175.1|351497_351827_-|tail	phage tail protein	tail	A0A0M3LQW6	Mannheimia_phage	49.1	4.8e-26
AUK27437.1|351867_352209_-	hypothetical protein	NA	A0A0M3LQT0	Mannheimia_phage	53.8	2.7e-24
AUK27438.1|352196_352613_-	hypothetical protein	NA	NA	NA	NA	NA
AUK27439.1|352685_353702_-	hypothetical protein	NA	A0A0M3LQ19	Mannheimia_phage	69.9	7.6e-131
AUK27440.1|353714_354107_-	hypothetical protein	NA	A0A0M3LQB6	Mannheimia_phage	46.2	5.5e-29
AUK29176.1|354106_354508_-	hypothetical protein	NA	A0A0M3LPJ5	Mannheimia_phage	61.4	2.1e-39
AUK27441.1|354509_354884_-	hypothetical protein	NA	NA	NA	NA	NA
AUK27442.1|354885_355353_-	hypothetical protein	NA	A0A0M3LSP7	Mannheimia_phage	55.7	1.4e-34
AUK27443.1|355369_355606_-	hypothetical protein	NA	NA	NA	NA	NA
AUK27444.1|355662_356820_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	43.3	8.3e-81
AUK27445.1|356837_357608_-	hypothetical protein	NA	A0A1V0DY60	Dinoroseobacter_phage	36.2	1.5e-25
AUK27446.1|357943_358378_-	guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	D0UIJ3	Aggregatibacter_phage	61.2	3.1e-41
AUK27447.1|358352_358571_-	hypothetical protein	NA	NA	NA	NA	NA
AUK29177.1|358573_360175_-|head	phage head morphogenesis protein	head	A0A0M3LQ07	Mannheimia_phage	52.1	3.3e-152
AUK27448.1|360164_361568_-	hypothetical protein	NA	A0A0M3LQA1	Mannheimia_phage	59.6	4.4e-153
AUK27449.1|361577_362849_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	61.7	8.6e-148
AUK29178.1|362851_363373_-	hypothetical protein	NA	A0A2H4J1J5	uncultured_Caudovirales_phage	38.6	9.0e-19
AUK27450.1|363757_364186_-	hypothetical protein	NA	NA	NA	NA	NA
AUK27451.1|364172_364874_-	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
AUK27452.1|365012_365393_+	hypothetical protein	NA	NA	NA	NA	NA
AUK27453.1|365380_365635_+	hypothetical protein	NA	NA	NA	NA	NA
AUK27454.1|365764_366121_-	hypothetical protein	NA	NA	NA	NA	NA
AUK27455.1|366399_366723_-	hypothetical protein	NA	NA	NA	NA	NA
AUK27456.1|366725_367310_-	hypothetical protein	NA	Q7Y5V0	Haemophilus_phage	55.3	6.5e-58
AUK27457.1|367281_367647_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
AUK27458.1|368235_368601_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	27.3	3.5e-09
AUK27459.1|368600_369203_-	recombinase NinG	NA	H6WRY9	Salmonella_phage	38.2	6.3e-32
AUK27460.1|369290_369503_-	hypothetical protein	NA	NA	NA	NA	NA
AUK27461.1|369576_370035_-	NinB protein	NA	Q7Y5V7	Haemophilus_phage	53.4	5.8e-38
AUK29179.1|370024_370555_-	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	58.9	1.0e-54
AUK27462.1|370564_371254_-	replication protein P	NA	D0UIL4	Aggregatibacter_phage	34.1	1.4e-32
AUK27463.1|371253_372156_-	hypothetical protein	NA	A0A0U4JX08	Bacillus_phage	37.7	5.5e-32
AUK27464.1|372157_372511_-	hypothetical protein	NA	A0A1C9LVX4	Vibrio_phage	33.6	1.3e-08
AUK27465.1|372507_373209_-	DNA-binding protein	NA	A0A2I7RHG4	Vibrio_phage	55.8	7.1e-35
AUK27466.1|373266_373542_-	hypothetical protein	NA	NA	NA	NA	NA
AUK27467.1|373562_373772_-	transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	52.3	5.5e-12
AUK27468.1|373899_374589_+	transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	58.2	1.7e-73
AUK27469.1|374734_374998_+	hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
AUK27470.1|375000_375480_+	HicB	NA	K7PJX6	Enterobacterial_phage	47.1	8.3e-19
AUK27471.1|375476_375860_+	hypothetical protein	NA	NA	NA	NA	NA
AUK27472.1|376478_376709_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	52.8	3.4e-10
AUK27473.1|377300_377846_+|integrase	integrase	integrase	NA	NA	NA	NA
AUK27474.1|378111_378759_+	antirepressor	NA	Q7Y5V4	Haemophilus_phage	64.2	3.5e-36
AUK27475.1|378820_379132_-	hypothetical protein	NA	NA	NA	NA	NA
AUK27476.1|379198_379483_+	hypothetical protein	NA	NA	NA	NA	NA
AUK27477.1|379469_379706_+	hypothetical protein	NA	NA	NA	NA	NA
AUK27478.1|379883_380864_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	40.1	3.4e-51
AUK27479.1|380867_381719_+	phage recombination protein Bet	NA	A0A2H4JAQ4	uncultured_Caudovirales_phage	63.9	4.8e-62
AUK27480.1|381711_382323_+	exonuclease	NA	A0A0M3LPU0	Mannheimia_phage	76.4	6.3e-88
AUK27481.1|382326_382791_+	single-stranded DNA-binding protein	NA	A0A2I7RK19	Vibrio_phage	69.0	6.1e-35
AUK27482.1|382802_382994_+	hypothetical protein	NA	NA	NA	NA	NA
AUK27483.1|383036_383390_+	hypothetical protein	NA	I6XKT1	Burkholderia_virus	31.8	1.7e-05
AUK27484.1|383461_384250_+	hypothetical protein	NA	C5IHK3	Burkholderia_virus	29.2	3.2e-20
AUK27485.1|384300_384900_+	hypothetical protein	NA	A0A218KC93	Bacillus_phage	34.2	3.9e-18
AUK27486.1|384896_385262_+	hypothetical protein	NA	NA	NA	NA	NA
AUK27487.1|385473_385962_+	hypothetical protein	NA	A0A0M3LS47	Mannheimia_phage	51.2	3.2e-34
AUK27488.1|386065_386974_+	hypothetical protein	NA	A0A0M4S6X1	Salmonella_phage	36.1	2.5e-40
AUK27489.1|387218_387440_+	hypothetical protein	NA	NA	NA	NA	NA
AUK27490.1|387450_388173_+	DNA-binding protein	NA	G0ZND1	Cronobacter_phage	52.5	3.3e-35
AUK27491.1|388562_389618_+|integrase	integrase	integrase	A0A077KGX2	Edwardsiella_phage	37.9	1.6e-62
AUK27492.1|389992_390847_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	40.3	5.8e-31
389645:389695	attR	AATTAATGGCACGCCCTATTGGATTCGAACCAATGACCTACGGCTTAGAAG	NA	NA	NA	NA
AUK27493.1|391423_391888_-|transposase	transposase	transposase	A0A0A8WIU6	Clostridium_phage	36.1	2.3e-13
AUK27494.1|392070_392571_-	single-stranded DNA-binding protein	NA	I3PUY5	Vibrio_phage	55.6	4.0e-40
AUK27495.1|392742_395574_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.3	0.0e+00
>prophage 2
CP015559	Pasteurella multocida strain USDA-ARS-USMARC-60215 chromosome, complete genome	2344126	746592	755950	2344126	tRNA	Planktothrix_phage(16.67%)	9	NA	NA
AUK27796.1|746592_747591_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	2.3e-15
AUK27797.1|747607_748588_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	1.3e-15
AUK27798.1|748664_749450_-	high-affinity zinc transporter membrane component	NA	NA	NA	NA	NA
AUK27799.1|749458_750250_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	4.4e-17
AUK27800.1|750484_752038_+	peptidase M23	NA	A0A2K9VGT1	Pontimonas_phage	49.6	8.4e-20
AUK27801.1|752113_753061_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.7	1.9e-43
AUK27802.1|753130_754018_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AUK27803.1|754017_754635_-	lipoprotein localization factor LolB	NA	NA	NA	NA	NA
AUK27804.1|754675_755950_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	49.5	1.8e-92
>prophage 3
CP015559	Pasteurella multocida strain USDA-ARS-USMARC-60215 chromosome, complete genome	2344126	1719722	1822818	2344126	integrase,tRNA,terminase,tail,transposase	Mannheimia_phage(42.37%)	109	1776833:1776878	1822923:1822968
AUK28581.1|1719722_1720187_-|transposase	transposase	transposase	A0A0A8WIU6	Clostridium_phage	36.1	2.3e-13
AUK28582.1|1720368_1721097_-	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	38.1	4.9e-31
AUK28583.1|1721162_1721831_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
AUK28584.1|1721840_1722383_-	cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	45.7	4.8e-23
AUK28585.1|1722445_1723756_-	hypothetical protein	NA	NA	NA	NA	NA
AUK28586.1|1724000_1724291_+	hypothetical protein	NA	NA	NA	NA	NA
AUK28587.1|1724338_1726000_-	transporter	NA	NA	NA	NA	NA
AUK28588.1|1728089_1728644_+	hypothetical protein	NA	NA	NA	NA	NA
AUK28589.1|1728861_1730517_+	alpha-D-phosphohexomutase	NA	A0A1X9I671	Streptococcus_phage	34.9	7.4e-83
AUK28590.1|1730606_1731686_-	endonuclease	NA	NA	NA	NA	NA
AUK28591.1|1732166_1732721_+	hypothetical protein	NA	NA	NA	NA	NA
AUK28592.1|1733028_1733817_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUK28593.1|1733829_1734774_+	ABC transporter permease	NA	NA	NA	NA	NA
AUK28594.1|1734785_1735523_+	ferrichrome ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	32.5	1.5e-14
AUK28595.1|1735668_1738098_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUK28596.1|1738562_1739588_-	hypothetical protein	NA	NA	NA	NA	NA
AUK28597.1|1740605_1741844_+	hypothetical protein	NA	A0A0R6PKN1	Moraxella_phage	25.6	1.0e-12
AUK28598.1|1741857_1742430_+	hypothetical protein	NA	NA	NA	NA	NA
AUK28599.1|1742845_1746739_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	53.4	1.7e-114
AUK28600.1|1746963_1747263_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUK28601.1|1747243_1748248_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AUK28602.1|1748524_1749406_-	ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AUK28603.1|1749548_1750982_-	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AUK28604.1|1750971_1751223_-	hypothetical protein	NA	NA	NA	NA	NA
AUK28605.1|1751305_1752652_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AUK28606.1|1752753_1753215_-	acetyl-CoA carboxylase, biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AUK28607.1|1753369_1753816_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AUK28608.1|1753886_1754900_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
AUK28609.1|1755152_1756010_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
AUK28610.1|1756120_1757374_-	hypothetical protein	NA	NA	NA	NA	NA
AUK28611.1|1757655_1758558_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AUK28612.1|1758588_1758852_+	hypothetical protein	NA	NA	NA	NA	NA
AUK28613.1|1758869_1759493_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUK28614.1|1759623_1760004_+	hypothetical protein	NA	NA	NA	NA	NA
AUK28615.1|1760033_1762103_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUK28616.1|1762238_1763657_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
AUK28617.1|1763985_1765557_+	aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
AUK28618.1|1765687_1766158_+	membrane protein FxsA	NA	NA	NA	NA	NA
AUK28619.1|1766246_1766537_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	40.0	4.5e-12
AUK28620.1|1766632_1768267_+	chaperonin GroL	NA	A0A2I7SAK5	Vibrio_phage	68.6	1.7e-188
AUK28621.1|1769119_1769917_+	ABC transporter	NA	NA	NA	NA	NA
AUK28622.1|1769918_1770518_+	iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	9.7e-17
AUK28623.1|1770535_1771384_+	ModD protein	NA	NA	NA	NA	NA
AUK28624.1|1771483_1773316_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.7	1.8e-53
AUK28625.1|1773423_1774320_-	lipoprotein NlpI-like protein	NA	NA	NA	NA	NA
AUK28626.1|1774403_1776548_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
1776833:1776878	attL	TGGTGGAGATAATCGGGATCGAACCGACGACCTCTTGCATGCCATG	NA	NA	NA	NA
AUK28627.1|1777299_1777716_-|transposase	transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
AUK28628.1|1777762_1778899_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	58.0	3.8e-123
AUK28629.1|1779038_1779365_-	hypothetical protein	NA	NA	NA	NA	NA
AUK28630.1|1779412_1784416_-	host specificity protein	NA	A0A0M3LQ61	Mannheimia_phage	38.8	6.2e-250
AUK28631.1|1784419_1785040_-|tail	phage tail protein	tail	A0A0M3LQC4	Mannheimia_phage	57.4	1.1e-52
AUK28632.1|1784982_1785726_-|tail	phage tail protein	tail	A0A0M3LQI5	Mannheimia_phage	59.6	7.4e-83
AUK28633.1|1785730_1786444_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	63.9	2.1e-82
AUK28634.1|1786533_1786863_-	hypothetical protein	NA	S5MW28	Escherichia_phage	37.1	3.2e-14
AUK29212.1|1786865_1789310_-|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	57.0	1.6e-150
AUK28635.1|1789368_1789764_-	hypothetical protein	NA	A0A0M3LR23	Mannheimia_phage	83.2	7.7e-55
AUK28636.1|1789831_1790296_-	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	50.0	5.2e-34
AUK28637.1|1790326_1790998_-	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	42.9	1.5e-42
AUK28638.1|1791051_1791534_-|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	62.0	2.0e-44
AUK28639.1|1791545_1791917_-	hypothetical protein	NA	NA	NA	NA	NA
AUK28640.1|1791913_1792285_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	51.2	1.3e-24
AUK28641.1|1792289_1792634_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	57.9	3.0e-31
AUK28642.1|1792636_1793005_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	42.1	4.7e-22
AUK28643.1|1792985_1793372_-	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	73.9	4.2e-13
AUK28644.1|1793382_1794381_-	encapsulating for peroxidase	NA	A0A0M3LQZ1	Mannheimia_phage	74.7	9.1e-145
AUK28645.1|1794392_1794827_-	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	75.7	1.1e-54
AUK28646.1|1794826_1796173_-	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	55.3	4.0e-127
AUK28647.1|1796187_1797159_-	hypothetical protein	NA	F1C5D8	Cronobacter_phage	41.0	1.6e-53
AUK28648.1|1797112_1798558_-	hypothetical protein	NA	A0A0M3LPQ5	Mannheimia_phage	58.6	2.4e-146
AUK28649.1|1798572_1799799_-|terminase	terminase	terminase	A0A0M3LTA2	Mannheimia_phage	77.0	9.4e-192
AUK28650.1|1799782_1800280_-|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	70.7	7.4e-47
AUK28651.1|1800573_1801008_+	CopG family transcriptional regulator	NA	A0A0R6PJ17	Moraxella_phage	38.0	1.0e-20
AUK28652.1|1801229_1801553_-	hypothetical protein	NA	NA	NA	NA	NA
AUK28653.1|1801525_1802056_-	glycoside hydrolase	NA	A0A0M3LPQ1	Mannheimia_phage	50.9	9.7e-45
AUK29213.1|1802052_1802307_-	hypothetical protein	NA	NA	NA	NA	NA
AUK28654.1|1802901_1803267_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	27.3	3.5e-09
AUK28655.1|1803266_1803869_-	recombinase NinG	NA	H6WRY9	Salmonella_phage	38.2	6.3e-32
AUK28656.1|1803956_1804169_-	hypothetical protein	NA	NA	NA	NA	NA
AUK28657.1|1804242_1804701_-	NinB protein	NA	Q7Y5V7	Haemophilus_phage	53.4	5.8e-38
AUK29214.1|1804690_1805221_-	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	58.9	1.0e-54
AUK28658.1|1805230_1805920_-	replication protein P	NA	D0UIL4	Aggregatibacter_phage	34.1	1.4e-32
AUK28659.1|1805919_1806822_-	hypothetical protein	NA	A0A0U4JX08	Bacillus_phage	37.7	5.5e-32
AUK28660.1|1806823_1807177_-	hypothetical protein	NA	A0A1C9LVX4	Vibrio_phage	33.6	1.3e-08
AUK28661.1|1807173_1807875_-	DNA-binding protein	NA	A0A2I7RHG4	Vibrio_phage	55.8	7.1e-35
AUK28662.1|1807932_1808208_-	hypothetical protein	NA	NA	NA	NA	NA
AUK28663.1|1808228_1808438_-	transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	52.3	5.5e-12
AUK28664.1|1808565_1809255_+	transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	58.2	1.7e-73
AUK28665.1|1809400_1809664_+	hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
AUK28666.1|1809666_1810146_+	HicB	NA	K7PJX6	Enterobacterial_phage	47.1	8.3e-19
AUK28667.1|1810142_1810526_+	hypothetical protein	NA	NA	NA	NA	NA
AUK28668.1|1811144_1811375_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	52.8	3.4e-10
AUK28669.1|1811599_1811863_+	hypothetical protein	NA	NA	NA	NA	NA
AUK28670.1|1811950_1812484_+	hypothetical protein	NA	NA	NA	NA	NA
AUK28671.1|1812945_1813581_+	antirepressor	NA	A6XMM0	Bacillus_virus	53.3	2.1e-22
AUK28672.1|1813642_1813954_-	hypothetical protein	NA	NA	NA	NA	NA
AUK28673.1|1814020_1814305_+	hypothetical protein	NA	NA	NA	NA	NA
AUK28674.1|1814291_1814528_+	hypothetical protein	NA	NA	NA	NA	NA
AUK28675.1|1814705_1815686_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	40.1	3.4e-51
AUK28676.1|1815689_1816541_+	phage recombination protein Bet	NA	A0A2H4JAQ4	uncultured_Caudovirales_phage	63.9	4.8e-62
AUK28677.1|1816533_1817145_+	exonuclease	NA	A0A0M3LPU0	Mannheimia_phage	76.4	6.3e-88
AUK28678.1|1817148_1817613_+	single-stranded DNA-binding protein	NA	A0A2I7RK19	Vibrio_phage	69.0	6.1e-35
AUK28679.1|1817624_1817816_+	hypothetical protein	NA	NA	NA	NA	NA
AUK28680.1|1817858_1818212_+	hypothetical protein	NA	I6XKT1	Burkholderia_virus	31.8	1.7e-05
AUK28681.1|1818283_1819072_+	hypothetical protein	NA	C5IHK3	Burkholderia_virus	29.2	3.2e-20
AUK28682.1|1819122_1819722_+	hypothetical protein	NA	A0A218KC93	Bacillus_phage	34.2	3.0e-18
AUK28683.1|1819856_1820390_+	hypothetical protein	NA	A0A0M3LS47	Mannheimia_phage	36.6	1.3e-20
AUK28684.1|1820399_1820699_+	hypothetical protein	NA	NA	NA	NA	NA
AUK28685.1|1820784_1821270_+	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	40.2	1.2e-20
AUK28686.1|1821645_1822818_+|integrase	integrase	integrase	A0A059VF45	Pseudomonas_phage	52.9	5.9e-111
1822923:1822968	attR	TGGTGGAGATAATCGGGATCGAACCGACGACCTCTTGCATGCCATG	NA	NA	NA	NA
