The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	1041386	1055346	5072975		Escherichia_phage(45.45%)	13	NA	NA
AUK20668.1|1041386_1042148_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
AUK20669.1|1042141_1042768_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AUK20670.1|1042907_1044047_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AUK20671.1|1044109_1045102_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AUK20672.1|1045195_1046560_-	GntP family transporter	NA	NA	NA	NA	NA
AUK20673.1|1046648_1047425_-	hypothetical protein	NA	NA	NA	NA	NA
AUK20674.1|1047429_1048068_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AUK20675.1|1048064_1049327_-	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	61.0	8.3e-135
AUK20676.1|1049323_1050232_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AUK20677.1|1050427_1051195_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
AUK20678.1|1051245_1051545_-	serine/threonine protein phosphatase	NA	C6ZCW7	Enterobacteria_phage	45.8	6.7e-19
AUK20679.1|1052226_1052679_-	Ser/Thr protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.2	1.9e-25
AUK20680.1|1052784_1055346_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	2.3e-30
>prophage 2
CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	1135066	1146269	5072975	transposase,integrase	Enterobacteria_phage(77.78%)	13	1134047:1134060	1147638:1147651
1134047:1134060	attL	AATATCATTTATCC	NA	NA	NA	NA
AUK20751.1|1135066_1137400_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.5	0.0e+00
AUK20752.1|1137414_1137735_-	hypothetical protein	NA	NA	NA	NA	NA
AUK24412.1|1137870_1138326_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	97.3	3.0e-63
AUK20753.1|1138369_1139583_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
AUK20754.1|1139634_1139919_-	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	3.2e-47
AUK20755.1|1139911_1140502_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	99.3	1.3e-69
AUK20756.1|1140498_1140765_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
AUK20757.1|1141317_1142052_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.8	6.1e-130
AUK20758.1|1142048_1142549_+	transactivation protein	NA	NA	NA	NA	NA
AUK20759.1|1142622_1143195_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	4.2e-94
AUK20760.1|1143484_1144384_+	hypothetical protein	NA	NA	NA	NA	NA
AUK20761.1|1144383_1145043_+	hypothetical protein	NA	NA	NA	NA	NA
AUK20762.1|1145075_1146269_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.6	8.7e-102
1147638:1147651	attR	GGATAAATGATATT	NA	NA	NA	NA
>prophage 3
CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	1669501	1750232	5072975	transposase,capsid,lysis,head,tail,tRNA,holin,terminase,integrase	Enterobacteria_phage(38.27%)	90	1657383:1657442	1746092:1746859
1657383:1657442	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
AUK21220.1|1669501_1670428_+	ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
AUK21221.1|1670432_1671164_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AUK21222.1|1671144_1671252_-	hypothetical protein	NA	NA	NA	NA	NA
AUK21223.1|1671311_1671998_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.4	9.5e-101
AUK21224.1|1672033_1673320_-|integrase	site-specific integrase	integrase	A0A0N7KZF5	Stx2-converting_phage	99.3	5.5e-251
AUK21225.1|1673353_1673608_-	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
AUK21226.1|1673626_1673761_-	hypothetical protein	NA	H6WZF8	Escherichia_phage	100.0	2.2e-22
AUK21227.1|1673764_1674007_-	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	100.0	1.2e-37
AUK21228.1|1674094_1674598_-	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	43.0	1.0e-56
AUK21229.1|1674599_1675286_-	hypothetical protein	NA	H6WZG2	Escherichia_phage	84.8	3.2e-117
AUK21230.1|1675602_1675884_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
AUK21231.1|1675894_1676086_-	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
AUK24427.1|1676058_1676241_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	98.3	2.8e-28
AUK21232.1|1676237_1676918_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	1.0e-131
AUK21233.1|1676914_1677700_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.2	2.0e-147
AUK21234.1|1677705_1678002_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AUK21235.1|1677970_1678123_-	host-nuclease inhibitor protein Gam	NA	Q08J51	Stx2-converting_phage	94.0	5.2e-20
AUK21236.1|1678077_1678347_-	host cell division inhibitory peptide Kil	NA	M1FN78	Enterobacteria_phage	95.5	2.1e-40
AUK21237.1|1678426_1678795_-	DUF2528 domain-containing protein	NA	K7PGR6	Enterobacteria_phage	99.2	2.6e-65
AUK21238.1|1678945_1679416_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	8.2e-88
AUK21239.1|1679547_1680760_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
AUK21240.1|1681175_1681559_-	antitermination protein	NA	G9L671	Escherichia_phage	99.2	6.7e-64
AUK21241.1|1682065_1682686_-	hypothetical protein	NA	A4KWT4	Enterobacteria_phage	99.0	6.9e-50
AUK21242.1|1682682_1683117_-	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	99.3	3.5e-77
AUK21243.1|1683187_1683529_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
AUK21244.1|1683589_1684294_-	XRE family transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
AUK21245.1|1684407_1684641_+	transcriptional regulator	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
AUK21246.1|1684779_1685076_+	hypothetical protein	NA	G9L678	Escherichia_phage	99.0	1.2e-47
AUK21247.1|1685108_1686047_+	Replication protein O	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
AUK21248.1|1686043_1686745_+	Replication protein P	NA	Q6H9X6	Enterobacteria_phage	99.1	4.9e-129
AUK21249.1|1686741_1687032_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	100.0	5.7e-47
AUK21250.1|1687102_1687381_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
AUK21251.1|1687513_1687729_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
AUK21252.1|1687739_1687976_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
AUK21253.1|1687932_1688379_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	98.6	1.2e-80
AUK21254.1|1688375_1688903_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	100.0	7.3e-101
AUK21255.1|1688899_1689082_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
AUK21256.1|1689585_1691358_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.3	0.0e+00
AUK21257.1|1691921_1692488_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
AUK21258.1|1692462_1693065_+	protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	3.9e-90
AUK21259.1|1693061_1693733_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
AUK21260.1|1693723_1694212_+	antiterminator	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
AUK21261.1|1694853_1695282_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.1	6.4e-63
AUK21262.1|1695583_1695712_+	hypothetical protein	NA	NA	NA	NA	NA
AUK21263.1|1695760_1697611_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
AUK21264.1|1697894_1698110_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	95.8	3.8e-32
AUK21265.1|1698114_1698459_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.4	2.1e-56
AUK21266.1|1698509_1699043_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.3e-100
AUK21267.1|1699316_1700012_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
AUK24428.1|1700240_1700708_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	94.2	2.0e-73
AUK24429.1|1700737_1700938_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	76.9	5.0e-10
AUK21268.1|1700859_1701111_+	hypothetical protein	NA	H6WZK4	Escherichia_phage	95.7	3.2e-30
AUK21269.1|1701046_1701373_+	hypothetical protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
AUK21270.1|1701504_1701705_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	95.5	3.7e-29
AUK21271.1|1701746_1702112_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.8e-65
AUK21272.1|1702401_1702965_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.5	3.6e-82
AUK21273.1|1702961_1704623_+|terminase	terminase	terminase	A0A0N7KZG0	Stx2-converting_phage	98.9	0.0e+00
AUK21274.1|1704686_1706624_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
AUK24430.1|1706668_1706890_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
AUK21275.1|1709416_1709743_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	98.1	2.7e-53
AUK21276.1|1709752_1710103_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AUK21277.1|1710099_1710546_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AUK21278.1|1710542_1710887_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AUK21279.1|1710945_1711662_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.9	2.3e-126
AUK21280.1|1711667_1712042_+|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
AUK21281.1|1712065_1712347_+|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
AUK21282.1|1715632_1715974_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	99.1	2.5e-62
AUK21283.1|1715973_1716672_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	98.3	8.1e-132
AUK21284.1|1716682_1717426_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	1.7e-148
AUK21285.1|1717323_1718004_+|tail	phage tail protein	tail	Q9EYE5	Enterobacteria_phage	93.3	4.8e-113
AUK21286.1|1718253_1721733_+|tail	phage tail protein	tail	A0A0P0ZBW1	Stx2-converting_phage	87.8	0.0e+00
AUK21287.1|1721800_1722400_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	9.7e-110
AUK21288.1|1722464_1723778_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.2	1.9e-81
AUK21289.1|1723779_1724049_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	2.7e-43
AUK21290.1|1724339_1724744_+	type III effector	NA	A5LH48	Enterobacteria_phage	96.3	1.3e-68
AUK21291.1|1725041_1726283_-	hypothetical protein	NA	H6WZN2	Escherichia_phage	85.2	7.7e-218
AUK21292.1|1726551_1726740_+	hypothetical protein	NA	NA	NA	NA	NA
AUK21293.1|1726934_1728143_-	secretion protein EspV	NA	H6WZN3	Escherichia_phage	99.5	1.0e-230
AUK21294.1|1728347_1728596_-	damage-inducible protein DinI	NA	H6WZN4	Escherichia_phage	100.0	2.4e-38
AUK21295.1|1729110_1730796_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AUK21296.1|1730792_1731512_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUK21297.1|1731558_1732029_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AUK21298.1|1732069_1732531_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
AUK21299.1|1732655_1734656_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
AUK21300.1|1734652_1735789_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
AUK21301.1|1735781_1738061_-	hypothetical protein	NA	NA	NA	NA	NA
AUK21302.1|1738071_1739160_-	MoxR family ATPase	NA	NA	NA	NA	NA
AUK21303.1|1739466_1739784_-	hypothetical protein	NA	NA	NA	NA	NA
AUK21304.1|1739844_1743477_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
AUK21305.1|1748198_1750232_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.8	1.0e-54
1746092:1746859	attR	GCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCAGGGCATTCCATGCTTTTACTGCTTTCTCCAGCGGCAATGTTGTCAAAATCCCCAACTGCCAATAATGCCCGGTAGGTGAATGAAACACCTTAAATTCACTTAGTAAGGTTGAATAATCTTCATTTAGCCATGCCTCAACTACCGCTTCGGGAGCTTTAATATATGTACCAGCGATCCGTCGTTGAAAACCCATCCTTGCCAACAGGTTGGTAGTACTTTCTTCATGGCTAACCGTGATGTGTTTTGAATACCAGATATATTTCGCCAAAAGTTGATTACTGATTTCTTCTGTCAGATAACAGATTGGCTCAATGCCTAATGGCGCTAAATCCAGCACCGGAATCGGCGATTTTTTCTTTTTCGAAAGCCAGGGAGGGGAGACTACTACGGCTGGCAGTAGATCGGCGCTGGCATGGTTTGAGGGCTGTGTCAGTTGTTGCTGGCATGATTTCAGTACGGCAACTGCGGGTGTCGAGAGCCAGGGAATGACCTGTTCTGCCAGTGCTGGTTGTGAGATAAGCATTGTCATTAGCATAATGCGCCAACTGTTCTCTTCTTTTTGCCCAAGAAGTTCCGTCAGTGCCGCCATTGCTGCATGTGGGAACGCAGCAATGGCTTTCGTCATCCGATCGTGACAGCGTTTAGTTTGCCCGGCTACACGTATAAGCAGTGTCAATGCGAACGGATGATTGATATGACGCAACACA	NA	NA	NA	NA
>prophage 4
CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	1826648	1836994	5072975	transposase	Enterobacteria_phage(33.33%)	11	NA	NA
AUK21372.1|1826648_1828043_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	1.7e-19
AUK21373.1|1828217_1829111_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AUK21374.1|1829147_1829411_-	hypothetical protein	NA	NA	NA	NA	NA
AUK21375.1|1829483_1830569_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	3.6e-102
AUK21376.1|1830568_1831468_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.3	6.3e-28
AUK21377.1|1831525_1832404_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.7	2.8e-105
AUK21378.1|1832408_1832957_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.5	4.2e-51
AUK21379.1|1832963_1834037_+	glycosyltransferase WbsX family protein	NA	A0A1V0SDW6	Indivirus	25.8	7.8e-25
AUK21380.1|1834029_1834761_+	hypothetical protein	NA	M1HJ62	Paramecium_bursaria_Chlorella_virus	35.1	1.7e-07
AUK21381.1|1834753_1836241_+	O115 family O-antigen flippase	NA	NA	NA	NA	NA
AUK21382.1|1836300_1836994_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	88.3	1.3e-121
>prophage 5
CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	1890081	1975608	5072975	transposase,capsid,lysis,head,tail,holin,terminase,portal,integrase	Enterobacteria_phage(43.9%)	76	1892645:1892663	1960380:1960398
AUK21431.1|1890081_1891233_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	2.0e-42
AUK21432.1|1891189_1891546_-|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	91.2	1.3e-32
AUK21433.1|1891802_1893015_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
1892645:1892663	attL	GTGCTGGATGCACTGGAGC	NA	NA	NA	NA
AUK21434.1|1893637_1893760_+	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
AUK21435.1|1893911_1894457_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AUK21436.1|1894453_1895197_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
AUK21437.1|1895208_1896288_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
AUK21438.1|1896352_1897285_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AUK21439.1|1897742_1898660_+	nitrogen assimilation regulatory protein nac	NA	NA	NA	NA	NA
AUK24440.1|1898761_1899712_+	transcriptional regulator Cbl	NA	NA	NA	NA	NA
AUK21440.1|1899985_1901473_+	FMN/FAD transporter	NA	NA	NA	NA	NA
AUK21441.1|1901844_1902057_+	hypothetical protein	NA	NA	NA	NA	NA
AUK21442.1|1902101_1902818_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUK21443.1|1903160_1904615_-	AMP nucleosidase	NA	NA	NA	NA	NA
AUK21444.1|1904716_1906033_-	MFS transporter	NA	NA	NA	NA	NA
AUK21445.1|1906347_1907400_+	hypothetical protein	NA	NA	NA	NA	NA
AUK21446.1|1907527_1908004_-	invasin	NA	NA	NA	NA	NA
AUK21447.1|1908016_1909525_-	adhesin	NA	NA	NA	NA	NA
AUK21448.1|1909521_1909692_-	adhesin	NA	NA	NA	NA	NA
AUK21449.1|1909618_1910425_-	hypothetical protein	NA	NA	NA	NA	NA
AUK21450.1|1911018_1913040_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUK21451.1|1913171_1914749_-	2,3-dihydroxybenzoate-AMP ligase	NA	NA	NA	NA	NA
AUK21452.1|1914752_1915556_-	thioesterase	NA	NA	NA	NA	NA
AUK21453.1|1915552_1916653_-	thiazolinyl imide reductase	NA	NA	NA	NA	NA
AUK21454.1|1916649_1926141_-	polyketide synthase	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
AUK21455.1|1926228_1932336_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
AUK21456.1|1932526_1933486_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUK21457.1|1933652_1935455_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	8.5e-32
AUK21458.1|1935441_1937244_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
AUK21459.1|1937236_1938517_+	MFS transporter	NA	NA	NA	NA	NA
AUK21460.1|1938544_1939849_+	salicylate synthase	NA	NA	NA	NA	NA
AUK21461.1|1940042_1941305_-|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	3.1e-73
AUK24441.1|1941642_1942440_-	protein MtfA	NA	NA	NA	NA	NA
AUK21462.1|1942675_1943701_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
AUK24442.1|1944547_1944694_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	73.2	3.3e-11
AUK21463.1|1945184_1945451_+	hypothetical protein	NA	NA	NA	NA	NA
AUK21464.1|1945864_1947715_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
AUK21465.1|1947993_1948155_-	hypothetical protein	NA	NA	NA	NA	NA
AUK21466.1|1948153_1948369_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
AUK21467.1|1948331_1948676_-	hypothetical protein	NA	NA	NA	NA	NA
AUK21468.1|1948624_1948861_-	hypothetical protein	NA	NA	NA	NA	NA
AUK21469.1|1948829_1949024_+	hypothetical protein	NA	NA	NA	NA	NA
AUK21470.1|1949056_1949590_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
AUK21471.1|1949810_1949924_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
AUK21472.1|1949925_1950393_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	92.9	6.3e-72
AUK21473.1|1950475_1950616_+	hypothetical protein	NA	NA	NA	NA	NA
AUK21474.1|1950858_1951173_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AUK21475.1|1951254_1951479_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
AUK21476.1|1951881_1952391_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AUK21477.1|1952362_1954291_+|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	2.3e-261
AUK21478.1|1954274_1954481_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AUK21479.1|1954477_1956070_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
AUK21480.1|1956059_1957565_+	scaffolding protein	NA	A0A2I6TC87	Escherichia_phage	54.2	1.6e-100
AUK21481.1|1957601_1957949_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
AUK21482.1|1958006_1959035_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
AUK21483.1|1959038_1959461_+	hypothetical protein	NA	NA	NA	NA	NA
AUK24443.1|1959453_1959807_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
AUK21484.1|1959822_1960356_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
AUK21485.1|1960352_1960748_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
1960380:1960398	attR	GTGCTGGATGCACTGGAGC	NA	NA	NA	NA
AUK21486.1|1960755_1961508_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	2.7e-133
AUK21487.1|1961521_1961953_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
AUK21488.1|1961979_1962393_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	7.8e-42
AUK21489.1|1962373_1964953_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.7	0.0e+00
AUK21490.1|1964949_1965279_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
AUK21491.1|1965278_1965977_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
AUK21492.1|1965982_1966726_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	1.3e-148
AUK21493.1|1966623_1967304_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.8	1.9e-114
AUK21494.1|1967257_1967464_+	hypothetical protein	NA	NA	NA	NA	NA
AUK21495.1|1967494_1968022_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	61.0	2.1e-60
AUK21496.1|1968155_1971632_+|tail	phage tail protein	tail	Q6H9T2	Enterobacteria_phage	96.9	0.0e+00
AUK24444.1|1971700_1972324_+	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.7e-69
AUK21497.1|1972388_1973702_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.3	1.2e-75
AUK21498.1|1973703_1973973_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
AUK21499.1|1974149_1975130_+	type III secretion system effector NleB	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
AUK24445.1|1975190_1975454_+	T3SS effector NleC domain protein	NA	NA	NA	NA	NA
AUK21500.1|1975476_1975608_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
>prophage 6
CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	2027846	2063174	5072975	capsid,portal,tail,holin,terminase,plate,integrase	Enterobacteria_phage(86.11%)	44	2026778:2026837	2063281:2063404
2026778:2026837	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
AUK21556.1|2027846_2027987_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
AUK21557.1|2028177_2028438_-	hypothetical protein	NA	NA	NA	NA	NA
AUK24449.1|2028705_2030145_+	hypothetical protein	NA	NA	NA	NA	NA
AUK21558.1|2030275_2031385_-	late control protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	8.2e-195
AUK21559.1|2031542_2032727_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
AUK21560.1|2032726_2033239_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
AUK21561.1|2033293_2033659_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
AUK21562.1|2033586_2033823_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	3.9e-22
AUK21563.1|2033809_2036617_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.0	0.0e+00
AUK21564.1|2036623_2037118_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.2	7.3e-87
AUK21565.1|2037159_2037693_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.6	6.3e-68
AUK21566.1|2037695_2040155_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	57.1	1.8e-173
AUK21567.1|2040157_2040688_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	9.6e-93
AUK21568.1|2040680_2041577_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	2.3e-155
AUK21569.1|2041580_2041931_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
AUK21570.1|2041927_2042509_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.4	8.0e-101
AUK21571.1|2042505_2043141_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	98.6	3.4e-113
AUK21572.1|2043133_2043601_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	4.5e-86
AUK21573.1|2043587_2043776_-	hypothetical protein	NA	NA	NA	NA	NA
AUK21574.1|2043738_2044146_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
AUK21575.1|2044142_2044535_-	peptidase M15	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.3e-70
AUK21576.1|2044531_2044855_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	98.1	4.7e-50
AUK21577.1|2044857_2045058_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
AUK21578.1|2045057_2045552_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	98.2	3.0e-88
AUK21579.1|2045653_2046454_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.3	1.9e-124
AUK21580.1|2046499_2047552_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.1	6.6e-194
AUK21581.1|2047575_2048412_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
AUK21582.1|2048566_2050318_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
AUK21583.1|2050317_2051364_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.6e-206
AUK21584.1|2051857_2054083_-	peptidase S8 and S53, subtilisin, kexin, sedolisin	NA	NA	NA	NA	NA
AUK21585.1|2054106_2055228_-	ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	3.7e-17
AUK21586.1|2055408_2058192_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	86.6	0.0e+00
AUK21587.1|2058188_2058578_-	inositol monophosphatase	NA	NA	NA	NA	NA
AUK21588.1|2058686_2058905_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	46.7	9.6e-07
AUK21589.1|2058901_2059105_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
AUK21590.1|2059302_2059545_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	5.2e-38
AUK21591.1|2059556_2059835_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	1.6e-35
AUK21592.1|2059845_2060196_-	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	80.2	2.1e-48
AUK21593.1|2060217_2060421_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
AUK21594.1|2060437_2060644_-	hypothetical protein	NA	NA	NA	NA	NA
AUK21595.1|2060719_2061124_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	9.4e-24
AUK21596.1|2061139_2061790_+	hypothetical protein	NA	NA	NA	NA	NA
AUK21597.1|2061819_2062167_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AUK21598.1|2062172_2063174_+|integrase	integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2063281:2063404	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 7
CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	2384994	2399349	5072975	protease,capsid,head,tail,terminase,portal,integrase	uncultured_Caudovirales_phage(100.0%)	24	2373800:2373815	2396861:2396876
2373800:2373815	attL	CATTATCCCGATTAAT	NA	NA	NA	NA
AUK21903.1|2384994_2386224_+|integrase	integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	3.2e-131
AUK21904.1|2386598_2386787_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
AUK21905.1|2386844_2387636_+	hypothetical protein	NA	NA	NA	NA	NA
AUK21906.1|2387661_2387859_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AUK21907.1|2387851_2388064_+	hypothetical protein	NA	NA	NA	NA	NA
AUK21908.1|2388053_2388293_+	hypothetical protein	NA	NA	NA	NA	NA
AUK21909.1|2388285_2388519_+	hypothetical protein	NA	NA	NA	NA	NA
AUK21910.1|2388511_2388745_+	hypothetical protein	NA	NA	NA	NA	NA
AUK21911.1|2388750_2389050_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AUK21912.1|2389046_2390447_+	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	9.6e-116
AUK21913.1|2390647_2390899_+	hypothetical protein	NA	NA	NA	NA	NA
AUK21914.1|2390895_2391306_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AUK21915.1|2391316_2391589_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AUK21916.1|2391545_2391674_+	trigger factor	NA	NA	NA	NA	NA
AUK21917.1|2391715_2391940_+	hypothetical protein	NA	NA	NA	NA	NA
AUK21918.1|2392232_2393390_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.1e-137
AUK21919.1|2393429_2394002_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
AUK21920.1|2394003_2395215_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
AUK21921.1|2396023_2396326_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	56.4	2.7e-28
AUK21922.1|2396322_2396619_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	2.4e-32
AUK21923.1|2396618_2397059_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	1.8e-60
2396861:2396876	attR	CATTATCCCGATTAAT	NA	NA	NA	NA
AUK24467.1|2397051_2397225_+	hypothetical protein	NA	NA	NA	NA	NA
AUK21924.1|2397347_2397704_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
AUK21925.1|2397687_2399349_+|terminase	terminase	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	2.0e-277
>prophage 8
CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	2413912	2489342	5072975	transposase,capsid,lysis,head,tail,holin,terminase,integrase	Stx2-converting_phage(31.58%)	89	2406381:2406397	2450246:2450262
2406381:2406397	attL	GAGGCGCTGGAGCAGCA	NA	NA	NA	NA
AUK21941.1|2413912_2416339_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	1.0e-213
AUK21942.1|2416537_2416843_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AUK24470.1|2416950_2417631_+	hypothetical protein	NA	NA	NA	NA	NA
AUK21943.1|2417663_2418224_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AUK21944.1|2418258_2418600_-	hypothetical protein	NA	NA	NA	NA	NA
AUK21945.1|2418734_2419061_+	hypothetical protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AUK21946.1|2419097_2419286_+	hypothetical protein	NA	NA	NA	NA	NA
AUK21947.1|2419266_2420481_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AUK21948.1|2420492_2421512_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	3.7e-16
AUK21949.1|2421569_2421680_+	transporter	NA	NA	NA	NA	NA
AUK21950.1|2421699_2422995_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
AUK21951.1|2423014_2423266_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	48.7	2.4e-14
AUK21952.1|2423335_2425810_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.0	1.9e-58
AUK21953.1|2425903_2426095_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUK21954.1|2426091_2426280_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AUK21955.1|2426847_2427066_-	hypothetical protein	NA	NA	NA	NA	NA
AUK21956.1|2427137_2427437_-	hypothetical protein	NA	NA	NA	NA	NA
AUK21957.1|2427420_2427579_-	hypothetical protein	NA	NA	NA	NA	NA
AUK21958.1|2427763_2428183_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
AUK21959.1|2428283_2428565_+	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
AUK21960.1|2428548_2428974_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUK21961.1|2429045_2430116_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	66.2	1.3e-64
AUK21962.1|2430122_2430863_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	90.7	9.2e-126
AUK21963.1|2430888_2431659_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	4.8e-85
AUK21964.1|2431674_2432070_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
AUK21965.1|2432126_2432711_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
AUK21966.1|2432826_2432931_+	hypothetical protein	NA	NA	NA	NA	NA
AUK21967.1|2432919_2433075_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	83.8	1.9e-09
AUK21968.1|2433119_2433332_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
AUK21969.1|2433499_2433778_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
AUK21970.1|2433779_2434838_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.7	3.7e-88
AUK21971.1|2434838_2435177_+	hypothetical protein	NA	V5URS4	Shigella_phage	62.9	1.9e-30
AUK21972.1|2435211_2435766_+	antiterminator	NA	A0A0U2S606	Escherichia_phage	67.4	8.0e-66
AUK21973.1|2435990_2436188_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
AUK21974.1|2436322_2437036_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUK21975.1|2437486_2437918_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
AUK21976.1|2437808_2438075_+	hypothetical protein	NA	NA	NA	NA	NA
AUK21977.1|2438481_2440335_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
AUK21978.1|2440484_2440700_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	5.9e-33
AUK21979.1|2440704_2441049_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	2.9e-58
AUK21980.1|2441099_2441633_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	8.1e-100
AUK21981.1|2441907_2442477_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
AUK21982.1|2442633_2443101_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	94.2	2.8e-72
AUK21983.1|2443183_2443324_+	hypothetical protein	NA	NA	NA	NA	NA
AUK21984.1|2443566_2443881_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AUK21985.1|2443962_2444187_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	3.8e-19
AUK21986.1|2444228_2444594_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
AUK21987.1|2444884_2445448_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
AUK21988.1|2445444_2447106_+|terminase	terminase	terminase	A0A0P0ZD10	Stx2-converting_phage	99.3	0.0e+00
AUK21989.1|2447169_2449107_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
AUK24471.1|2449151_2449373_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
AUK21990.1|2451897_2452224_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	98.1	2.7e-53
2450246:2450262	attR	GAGGCGCTGGAGCAGCA	NA	NA	NA	NA
AUK21991.1|2452233_2452584_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AUK21992.1|2452580_2453027_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AUK21993.1|2453023_2453368_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AUK21994.1|2453426_2454143_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.9	2.3e-126
AUK21995.1|2454148_2454523_+|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
AUK21996.1|2454546_2454828_+|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
AUK21997.1|2454879_2458122_+|tail	phage tail tape measure protein	tail	H6WZM1	Escherichia_phage	97.7	0.0e+00
AUK21998.1|2458114_2458456_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	99.1	2.5e-62
AUK21999.1|2458455_2459154_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	98.3	8.1e-132
AUK22000.1|2459164_2459908_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	1.7e-148
AUK22001.1|2459805_2460486_+|tail	phage tail protein	tail	Q9EYE5	Enterobacteria_phage	93.3	1.6e-113
AUK22002.1|2460724_2464201_+|tail	phage tail protein	tail	A0A0P0ZBW1	Stx2-converting_phage	92.8	0.0e+00
AUK22003.1|2464267_2464867_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	7.5e-110
AUK22004.1|2464931_2466245_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
AUK22005.1|2466246_2466516_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
AUK22006.1|2466656_2467532_+	secretion protein EspS	NA	A0A0P0ZCT1	Stx2-converting_phage	98.6	1.4e-160
AUK24472.1|2467756_2468128_-	DUF1076 domain-containing protein	NA	A0A0P0ZBX1	Stx2-converting_phage	98.4	8.2e-67
AUK24473.1|2469001_2469316_-	DinI family protein	NA	Q687E4	Enterobacteria_phage	81.9	7.0e-27
AUK22007.1|2469375_2470659_+	MFS transporter	NA	NA	NA	NA	NA
AUK22008.1|2470747_2472208_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.2	1.5e-42
AUK22009.1|2472243_2472447_-	selenoprotein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
AUK22010.1|2472623_2473310_-	transcriptional regulator	NA	NA	NA	NA	NA
AUK22011.1|2473398_2474145_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUK22012.1|2474281_2476327_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
AUK22013.1|2476370_2476889_-	hypothetical protein	NA	NA	NA	NA	NA
AUK22014.1|2477164_2477557_+	TIGR00156 family protein	NA	NA	NA	NA	NA
AUK22015.1|2479698_2479794_-	hypothetical protein	NA	NA	NA	NA	NA
AUK22016.1|2479920_2481108_-	MFS transporter	NA	NA	NA	NA	NA
AUK22017.1|2481302_2482202_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
AUK22018.1|2482232_2482451_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
AUK22019.1|2482482_2482866_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
AUK22020.1|2482885_2483320_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUK22021.1|2483531_2484197_+	stress protection protein MarC	NA	NA	NA	NA	NA
AUK22022.1|2484221_2485412_-	sugar efflux transporter	NA	NA	NA	NA	NA
AUK22023.1|2485561_2486677_-	hypothetical protein	NA	NA	NA	NA	NA
AUK22024.1|2486754_2487636_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUK22025.1|2488637_2489342_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 9
CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	2855527	2914261	5072975	capsid,head,lysis,tRNA,tail,holin,terminase,integrase	Escherichia_phage(25.49%)	69	2863818:2863832	2914363:2914377
AUK22343.1|2855527_2856634_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUK24497.1|2856669_2857311_+	lysogenization protein HflD	NA	NA	NA	NA	NA
AUK22344.1|2857314_2858685_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
AUK22345.1|2858852_2859524_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AUK22346.1|2859523_2860984_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
AUK22347.1|2861059_2862181_+	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AUK22348.1|2862326_2863556_-	peptidase T	NA	NA	NA	NA	NA
AUK22349.1|2863611_2863827_+	hypothetical protein	NA	NA	NA	NA	NA
AUK22350.1|2863805_2864942_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
2863818:2863832	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
AUK22351.1|2864925_2865789_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AUK24498.1|2865953_2866283_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AUK22352.1|2866428_2867037_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	43.6	2.9e-37
AUK24499.1|2867044_2868328_-|tail	phage tail protein	tail	Q9LA62	Enterobacterial_phage	67.9	6.4e-34
AUK22353.1|2868392_2868992_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	85.9	1.4e-95
AUK22354.1|2869059_2872446_-|tail	phage tail protein	tail	A0A0P0ZCI5	Stx2-converting_phage	86.2	0.0e+00
AUK22355.1|2872686_2873367_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.9	6.3e-113
AUK22356.1|2873264_2874008_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	4.5e-149
AUK22357.1|2874018_2874717_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	98.3	1.4e-131
AUK22358.1|2874716_2875058_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.3	6.9e-52
AUK22359.1|2875050_2878293_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	88.1	0.0e+00
AUK22360.1|2878340_2878622_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	7.9e-46
AUK22361.1|2878645_2879020_-|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
AUK22362.1|2879034_2879751_-|tail	phage tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
AUK22363.1|2879811_2880156_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	89.5	3.4e-51
AUK22364.1|2880152_2880599_-	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	4.4e-75
AUK22365.1|2880595_2880946_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	98.3	5.0e-58
AUK22366.1|2880955_2881282_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	99.1	2.7e-53
AUK22367.1|2883646_2883868_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	93.2	2.1e-33
AUK22368.1|2883912_2885850_-|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.2	0.0e+00
AUK22369.1|2885913_2887575_-|terminase	terminase	terminase	A0A0P0ZEI4	Stx2-converting_phage	98.9	0.0e+00
AUK22370.1|2887571_2888135_-|terminase	terminase	terminase	B6DZ97	Enterobacteria_phage	93.0	1.2e-80
AUK22371.1|2888424_2888790_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	94.2	8.7e-61
AUK22372.1|2888831_2889032_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
AUK22373.1|2889163_2889490_-	hypothetical protein	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
AUK22374.1|2889425_2889608_-	hypothetical protein	NA	H6WZK4	Escherichia_phage	100.0	4.5e-26
AUK22375.1|2889833_2890058_-	hypothetical protein	NA	NA	NA	NA	NA
AUK24500.1|2890081_2890549_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	89.0	3.4e-70
AUK22376.1|2890777_2891473_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	98.7	1.4e-123
AUK22377.1|2891746_2892280_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	94.9	9.0e-99
AUK22378.1|2892330_2892675_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	94.7	2.3e-55
AUK22379.1|2892678_2892894_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AUK22380.1|2892969_2893239_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	70.8	8.5e-05
AUK22381.1|2893276_2893459_-	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	84.7	1.7e-20
AUK22382.1|2893593_2895546_-	sialate O-acetylesterase	NA	A0A0P0ZBH7	Stx2-converting_phage	69.8	5.5e-263
AUK22383.1|2896341_2897400_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	88.2	6.9e-183
AUK24501.1|2897550_2897871_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.6	1.6e-34
AUK22384.1|2897990_2898521_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	71.4	1.0e-70
AUK22385.1|2898529_2898889_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	1.6e-35
AUK22386.1|2898901_2899951_-	hypothetical protein	NA	U5P0K4	Shigella_phage	54.3	1.4e-108
AUK22387.1|2899952_2900231_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	4.8e-11
AUK22388.1|2900333_2901437_-	DNA-binding protein	NA	NA	NA	NA	NA
AUK22389.1|2901417_2902068_-	hypothetical protein	NA	NA	NA	NA	NA
AUK22390.1|2902233_2902446_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	95.7	3.6e-27
AUK22391.1|2903093_2903867_+	iroE	NA	NA	NA	NA	NA
AUK22392.1|2904232_2904649_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	86.1	2.1e-58
AUK22393.1|2904664_2905378_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	61.7	4.9e-76
AUK22394.1|2905400_2906153_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	79.8	2.6e-107
AUK22395.1|2906159_2907113_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	52.6	1.1e-73
AUK22396.1|2907134_2907560_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUK22397.1|2907556_2907787_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	53.8	2.9e-06
AUK24502.1|2907992_2908517_+	LexA family transcriptional repressor	NA	H9C160	Pectobacterium_phage	28.0	6.3e-12
AUK24503.1|2908800_2908956_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
AUK22398.1|2908915_2909086_+	hypothetical protein	NA	NA	NA	NA	NA
AUK22399.1|2909115_2909334_+	hypothetical protein	NA	NA	NA	NA	NA
AUK22400.1|2909901_2910090_+	division inhibition protein DicB	NA	NA	NA	NA	NA
AUK22401.1|2910086_2910278_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUK22402.1|2910371_2912843_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
AUK22403.1|2912904_2913174_+	excisionase	NA	NA	NA	NA	NA
AUK22404.1|2913142_2914261_+|integrase	integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
2914363:2914377	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 10
CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	3191705	3287975	5072975	protease,capsid,lysis,head,portal,tRNA,tail,holin,terminase,plate,integrase	Escherichia_phage(38.98%)	92	3236302:3236319	3279310:3279327
AUK22670.1|3191705_3193106_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
AUK22671.1|3193708_3194797_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
AUK22672.1|3194812_3194995_-	hypothetical protein	NA	NA	NA	NA	NA
AUK22673.1|3194981_3196172_+	aromatic amino acid transaminase	NA	NA	NA	NA	NA
AUK22674.1|3196393_3197041_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AUK24524.1|3197067_3197616_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
AUK22675.1|3197796_3199644_-	transpeptidase	NA	NA	NA	NA	NA
AUK22676.1|3199904_3204365_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
AUK22677.1|3204364_3205069_-	condensin subunit E	NA	NA	NA	NA	NA
AUK22678.1|3205049_3206372_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
AUK22679.1|3206368_3207154_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AUK22680.1|3207222_3207387_+	hypothetical protein	NA	NA	NA	NA	NA
AUK22681.1|3207289_3208069_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AUK22682.1|3208045_3208939_-	hypothetical protein	NA	NA	NA	NA	NA
AUK22683.1|3209092_3209839_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AUK22684.1|3209835_3210018_-	protein YcaR	NA	NA	NA	NA	NA
AUK22685.1|3210069_3211302_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUK22686.1|3211338_3212325_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AUK22687.1|3212321_3214070_-	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
AUK22688.1|3214106_3216287_-	ComEC family protein	NA	NA	NA	NA	NA
AUK22689.1|3217355_3217640_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
AUK22690.1|3217799_3219473_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AUK22691.1|3219583_3220267_-	cytidylate kinase	NA	NA	NA	NA	NA
AUK22692.1|3220439_3221204_-|protease	metalloprotease	protease	NA	NA	NA	NA
AUK22693.1|3221372_3222656_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUK22694.1|3222726_3223815_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
AUK22695.1|3224013_3224706_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AUK22696.1|3224835_3226596_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AUK22697.1|3227001_3227859_+	formate transporter FocA	NA	NA	NA	NA	NA
AUK22698.1|3227913_3230196_+	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AUK22699.1|3230514_3230769_-	transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AUK22700.1|3230814_3231978_-	hypothetical protein	NA	U5N3V4	Enterobacteria_phage	99.2	5.4e-205
AUK22701.1|3231977_3232457_-|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
AUK22702.1|3232471_3234919_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.7	0.0e+00
AUK22703.1|3234911_3235067_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	98.0	7.5e-22
AUK22704.1|3235063_3235339_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AUK22705.1|3235395_3235914_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AUK22706.1|3235926_3237117_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	2.4e-224
3236302:3236319	attL	GCGGAAACCGTCACGGCG	NA	NA	NA	NA
AUK22707.1|3237240_3237678_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	42.8	1.9e-22
AUK22708.1|3237677_3239408_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	64.3	3.1e-84
AUK22709.1|3239404_3240016_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
AUK22710.1|3240008_3240917_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
AUK22711.1|3240921_3241269_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	1.1e-57
AUK22712.1|3241265_3241901_-|plate	baseplate assembly protein	plate	U5N3F0	Enterobacteria_phage	99.1	1.7e-112
AUK22713.1|3241967_3242420_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
AUK22714.1|3242412_3242880_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	4.3e-81
AUK22715.1|3242842_3243016_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
AUK22716.1|3242987_3243413_-	protein lysB	NA	Q7Y4E2	Escherichia_virus	96.5	1.6e-66
AUK22717.1|3243761_3244259_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AUK22718.1|3244258_3244540_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AUK22719.1|3244543_3244747_-|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
AUK22720.1|3244746_3245256_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AUK22721.1|3245355_3246099_-|terminase	terminase	terminase	Q94MK1	Enterobacteria_phage	99.2	1.4e-121
AUK22722.1|3246102_3247176_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.2	2.4e-199
AUK22723.1|3247234_3248089_-|capsid	capsid scaffolding protein	capsid	A0A0F7LA11	Escherichia_phage	98.6	4.6e-137
AUK22724.1|3248262_3250035_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
AUK22725.1|3250034_3251069_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.1	3.2e-201
AUK22726.1|3251494_3252436_+	hypothetical protein	NA	Q2P9W7	Enterobacteria_phage	81.2	2.7e-146
AUK22727.1|3252508_3252661_-	meiotically up-regulated 80 protein	NA	Q2P9X3	Enterobacteria_phage	91.8	4.4e-19
AUK22728.1|3252755_3253436_-	hypothetical protein	NA	Q2P9W8	Enterobacteria_phage	99.1	4.6e-124
AUK22729.1|3253463_3253685_-	DUF2158 domain-containing protein	NA	Q2P9W9	Enterobacteria_phage	100.0	4.5e-36
AUK22730.1|3253781_3256061_-	replication protein A	NA	A0A0F7LBQ2	Escherichia_phage	98.4	0.0e+00
AUK22731.1|3256050_3256326_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
AUK22732.1|3256322_3256547_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
AUK22733.1|3256546_3256849_-	hypothetical protein	NA	M1RZ07	Escherichia_phage	97.0	1.6e-44
AUK22734.1|3256848_3257073_-	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AUK22735.1|3257136_3257637_-	replication protein B	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
AUK22736.1|3257633_3257831_-	hypothetical protein	NA	A0A0F7LDS9	Escherichia_phage	98.5	6.1e-29
AUK22737.1|3257814_3258186_-	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	100.0	1.6e-65
AUK22738.1|3258279_3258579_+	XRE family transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
AUK22739.1|3258672_3259668_+|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
AUK22740.1|3259699_3260497_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
AUK24525.1|3260578_3261118_-	hypothetical protein	NA	NA	NA	NA	NA
AUK22741.1|3261267_3262176_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUK22742.1|3262176_3263607_-	inner membrane transporter YcaM	NA	NA	NA	NA	NA
AUK22743.1|3263816_3264965_-	MFS transporter	NA	NA	NA	NA	NA
AUK22744.1|3265278_3265905_+	hydrolase	NA	NA	NA	NA	NA
AUK22745.1|3265939_3266803_-	dimethyl sulfoxide reductase subunit C	NA	NA	NA	NA	NA
AUK22746.1|3266804_3267422_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	60.6	3.8e-77
AUK22747.1|3267432_3269877_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
AUK22748.1|3270115_3271408_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AUK22749.1|3271498_3272842_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AUK22750.1|3272852_3273464_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUK22751.1|3273618_3277608_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AUK22752.1|3277742_3278237_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AUK22753.1|3278781_3279747_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
3279310:3279327	attR	CGCCGTGACGGTTTCCGC	NA	NA	NA	NA
AUK22754.1|3279869_3281636_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
AUK22755.1|3281636_3283358_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	3.8e-21
AUK22756.1|3283399_3284104_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUK22757.1|3284388_3284607_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AUK22758.1|3285347_3287624_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	2.5e-166
AUK22759.1|3287654_3287975_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 11
CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	3371818	3450161	5072975	transposase,capsid,head,lysis,tail,holin,terminase,portal,integrase	Enterobacteria_phage(32.2%)	95	3379952:3379986	3451595:3451629
AUK22835.1|3371818_3372931_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUK22836.1|3373132_3373810_+	PKHD-type hydroxylase	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
AUK22837.1|3373883_3374150_+	DksA/TraR family C4-type zinc finger protein	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
AUK22838.1|3374414_3374675_+	hypothetical protein	NA	NA	NA	NA	NA
AUK22839.1|3374902_3375988_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
AUK22840.1|3376128_3377091_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AUK22841.1|3377118_3379269_-	ATP-dependent helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
AUK22842.1|3379388_3379871_+	Swarming motility protein YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	2.6e-36
3379952:3379986	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
AUK22843.1|3380102_3381467_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
AUK24528.1|3381695_3382367_+	transcriptional regulator	NA	NA	NA	NA	NA
AUK22844.1|3382366_3383365_+	transporter	NA	NA	NA	NA	NA
AUK22845.1|3383357_3385094_+	multidrug ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
AUK22846.1|3385086_3386220_+	inner membrane transport permease YbhS	NA	NA	NA	NA	NA
AUK22847.1|3386230_3387337_+	ABC transporter permease	NA	NA	NA	NA	NA
AUK22848.1|3387298_3387709_-	hypothetical protein	NA	NA	NA	NA	NA
AUK22849.1|3387841_3388603_+	EEP domain-containing protein	NA	NA	NA	NA	NA
AUK22850.1|3388599_3389841_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
AUK22851.1|3389840_3390797_+	hypothetical protein	NA	NA	NA	NA	NA
AUK22852.1|3390832_3391546_-	BAX inhibitor (BI)-1/YccA family protein	NA	NA	NA	NA	NA
AUK22853.1|3391750_3392455_-	hypothetical protein	NA	NA	NA	NA	NA
AUK22854.1|3392590_3393043_-	molybdopterin synthase catalytic subunit	NA	NA	NA	NA	NA
AUK22855.1|3393044_3393290_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
AUK22856.1|3393282_3393768_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
AUK22857.1|3393770_3394283_-	molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
AUK22858.1|3394304_3395294_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
AUK22859.1|3395690_3396599_+	hypothetical protein	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
AUK22860.1|3396790_3398812_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AUK22861.1|3399390_3400068_-	dethiobiotin synthase	NA	NA	NA	NA	NA
AUK22862.1|3400060_3400816_-	malonyl-[acyl-carrier protein] O-methyltransferase BioC	NA	NA	NA	NA	NA
AUK22863.1|3400802_3401957_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AUK22864.1|3401953_3402994_-	biotin synthase	NA	NA	NA	NA	NA
AUK22865.1|3403080_3404370_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	7.7e-19
AUK22866.1|3404428_3404905_+	kinase inhibitor	NA	NA	NA	NA	NA
AUK22867.1|3404819_3404999_+	hypothetical protein	NA	NA	NA	NA	NA
AUK22868.1|3405408_3406062_+	secretion protein EspJ	NA	NA	NA	NA	NA
AUK22869.1|3406074_3406296_-	hypothetical protein	NA	NA	NA	NA	NA
AUK22870.1|3406379_3406760_-	hypothetical protein	NA	NA	NA	NA	NA
AUK22871.1|3406960_3407536_-	T3SS effector NleG	NA	H6WZN1	Escherichia_phage	77.0	2.3e-76
AUK22872.1|3407628_3408841_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
AUK22873.1|3409292_3409664_+|integrase	integrase	integrase	K7PH54	Enterobacteria_phage	95.1	1.1e-58
AUK22874.1|3409767_3410616_-	cell division protein	NA	A5LH49	Enterobacteria_phage	98.5	3.5e-153
AUK22875.1|3410679_3410865_+	hypothetical protein	NA	NA	NA	NA	NA
AUK22876.1|3410839_3411721_-	T3SS effector protein NleH	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
AUK22877.1|3411826_3412096_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
AUK22878.1|3412097_3413411_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	9.7e-78
AUK22879.1|3413475_3414075_-	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	8.2e-109
AUK22880.1|3417768_3418449_-|tail	phage tail protein	tail	Q9EYE5	Enterobacteria_phage	92.0	3.1e-112
AUK22881.1|3418346_3419090_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	1.0e-148
AUK22882.1|3419095_3419794_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
AUK22883.1|3419793_3420123_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
AUK22884.1|3420119_3422699_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.7	0.0e+00
AUK22885.1|3422679_3423093_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	7.8e-42
AUK22886.1|3423119_3423551_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
AUK22887.1|3423564_3424317_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	2.7e-133
AUK22888.1|3424324_3424720_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
AUK22889.1|3424716_3425250_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
AUK24529.1|3425265_3425619_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
AUK22890.1|3425611_3426034_-	hypothetical protein	NA	NA	NA	NA	NA
AUK22891.1|3426037_3427066_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
AUK22892.1|3427123_3427471_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
AUK22893.1|3427507_3429013_-	scaffolding protein	NA	A0A2I6TC87	Escherichia_phage	54.2	1.6e-100
AUK22894.1|3429002_3430595_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
AUK22895.1|3430591_3430798_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AUK22896.1|3430781_3432710_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	2.3e-261
AUK22897.1|3432681_3433191_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AUK22898.1|3433585_3433780_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
AUK22899.1|3433859_3434000_+	hypothetical protein	NA	NA	NA	NA	NA
AUK22900.1|3433967_3434585_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
AUK22901.1|3434734_3435172_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
AUK22902.1|3435168_3435666_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
AUK22903.1|3435665_3435881_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AUK22904.1|3435879_3436041_+	hypothetical protein	NA	NA	NA	NA	NA
AUK22905.1|3436319_3438170_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	96.4	0.0e+00
AUK22906.1|3438712_3439429_-	hypothetical protein	NA	NA	NA	NA	NA
AUK22907.1|3439640_3440330_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
AUK22908.1|3440344_3440467_-	hypothetical protein	NA	NA	NA	NA	NA
AUK22909.1|3440805_3441768_+	DUF2219 domain-containing protein	NA	NA	NA	NA	NA
AUK22910.1|3441975_3442641_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	98.6	4.7e-129
AUK22911.1|3442637_3443258_-	recombination protein NinG	NA	Q716C3	Shigella_phage	94.2	7.0e-95
AUK22912.1|3443250_3443421_-	protein ninF	NA	Q716C4	Shigella_phage	98.2	4.6e-25
AUK24530.1|3443417_3443600_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
AUK22913.1|3443596_3443986_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	99.2	2.9e-70
AUK22914.1|3444028_3445242_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
AUK22915.1|3445279_3445468_+	gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	7.9e-26
AUK22916.1|3445473_3446259_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
AUK22917.1|3446255_3446936_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
AUK24531.1|3446932_3447115_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
AUK22918.1|3447087_3447279_+	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
AUK22919.1|3447289_3447571_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	3.6e-46
AUK22920.1|3447669_3447891_+	conjugal transfer protein TraR	NA	A0A0N7C211	Escherichia_phage	93.2	3.5e-33
AUK22921.1|3447890_3448175_+	ASCH domain-containing protein	NA	A0A1I9LJL9	Stx_converting_phage	91.5	2.6e-44
AUK22922.1|3448247_3448415_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	7.0e-26
AUK22923.1|3448443_3448788_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
AUK22924.1|3448894_3449113_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AUK22925.1|3449090_3450161_+|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	2.5e-201
3451595:3451629	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 12
CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	3671050	3749219	5072975	transposase,capsid,protease,head,tail,tRNA,holin,terminase,portal	Enterobacteria_phage(62.86%)	76	NA	NA
AUK23118.1|3671050_3672187_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AUK23119.1|3672457_3674695_+	bacteriophage N4 adsorption protein B	NA	NA	NA	NA	NA
AUK23120.1|3674681_3677654_+	phage receptor	NA	NA	NA	NA	NA
AUK23121.1|3677654_3678545_+	hypothetical protein	NA	NA	NA	NA	NA
AUK23122.1|3678458_3678671_-	hypothetical protein	NA	NA	NA	NA	NA
AUK23123.1|3678727_3679489_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUK23124.1|3679482_3679599_+	hypothetical protein	NA	NA	NA	NA	NA
AUK23125.1|3679784_3679976_-	hypothetical protein	NA	NA	NA	NA	NA
AUK23126.1|3680001_3680955_+|protease	outer membrane protease PgtE	protease	NA	NA	NA	NA
AUK23127.1|3681141_3682626_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUK23128.1|3682809_3683115_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	74.5	1.8e-11
AUK24540.1|3683213_3683840_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUK23129.1|3683784_3683922_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AUK23130.1|3683894_3684479_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	93.3	2.8e-101
AUK23131.1|3684478_3687829_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
AUK23132.1|3687893_3688493_-	Ail/Lom family protein	NA	Q6H9T1	Enterobacteria_phage	98.5	2.8e-109
AUK23133.1|3688559_3691958_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.2	0.0e+00
AUK23134.1|3692018_3692690_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	90.1	9.9e-103
AUK23135.1|3692587_3693331_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
AUK23136.1|3693336_3694035_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
AUK23137.1|3694034_3694364_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
AUK23138.1|3694360_3696940_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.4	0.0e+00
AUK23139.1|3696932_3697367_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	4.5e-64
AUK23140.1|3697348_3697771_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
AUK23141.1|3699310_3699706_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
AUK23142.1|3699702_3700281_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	2.5e-78
AUK23143.1|3700292_3700646_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	7.6e-62
AUK23144.1|3700657_3701056_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	83.3	1.2e-50
AUK23145.1|3701097_3702123_-|capsid	major capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	98.8	9.6e-190
AUK23146.1|3702178_3702511_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	1.9e-54
AUK23147.1|3702520_3703840_-|capsid	capsid assembly protein	capsid	A0A0K2FI53	Enterobacteria_phage	98.9	1.3e-234
AUK23148.1|3703820_3705422_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.2e-308
AUK23149.1|3705418_3705625_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AUK23150.1|3705621_3707547_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
AUK23151.1|3707521_3708067_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AUK23152.1|3708336_3708657_+	hypothetical protein	NA	NA	NA	NA	NA
AUK23153.1|3708544_3708898_+	hypothetical protein	NA	NA	NA	NA	NA
AUK23154.1|3709020_3709401_-	hypothetical protein	NA	H6WZK5	Escherichia_phage	72.2	2.6e-39
AUK23155.1|3709827_3710121_+	lipoprotein bor	NA	C6ZCX3	Enterobacteria_phage	91.8	1.6e-44
AUK23156.1|3710211_3710394_-	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
AUK23157.1|3710610_3711144_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	95.5	1.1e-99
AUK23158.1|3711249_3711522_+	hypothetical protein	NA	NA	NA	NA	NA
AUK23159.1|3711487_3711832_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	90.5	3.5e-35
AUK24541.1|3711836_3712052_-|holin	holin	holin	M1FN85	Enterobacteria_phage	95.8	1.0e-32
AUK23160.1|3712593_3712788_+	hypothetical protein	NA	NA	NA	NA	NA
AUK23161.1|3714046_3715259_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
AUK23162.1|3715225_3715384_+	PapI protein	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.2e-06
AUK23163.1|3715909_3716542_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUK23164.1|3716544_3717060_-	fimbriae assembly protein	NA	NA	NA	NA	NA
AUK23165.1|3718907_3719600_-	fimbrial chaperone SfmC	NA	NA	NA	NA	NA
AUK23166.1|3719819_3720362_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AUK23167.1|3720832_3721699_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AUK23168.1|3721700_3721913_+	ribosome-associated protein	NA	NA	NA	NA	NA
AUK23169.1|3722020_3722542_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AUK23170.1|3722577_3723963_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
AUK23171.1|3724136_3724631_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AUK23172.1|3724633_3725356_+	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
AUK23173.1|3725473_3725983_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AUK23174.1|3725979_3727047_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AUK23175.1|3727241_3728135_-	carbamate kinase	NA	NA	NA	NA	NA
AUK23176.1|3728131_3728947_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
AUK23177.1|3728957_3730217_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
AUK23178.1|3730226_3731894_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
AUK23179.1|3732210_3733260_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
AUK23180.1|3733281_3734517_+	allantoate amidohydrolase	NA	NA	NA	NA	NA
AUK23181.1|3736317_3737463_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
AUK23182.1|3737484_3738786_-	uracil/xanthine transporter	NA	NA	NA	NA	NA
AUK23183.1|3738842_3740204_-	cyclic amidohydrolase	NA	NA	NA	NA	NA
AUK23184.1|3740263_3741718_-	allantoin permease	NA	NA	NA	NA	NA
AUK23185.1|3741886_3742765_-	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
AUK23186.1|3742864_3743641_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
AUK23187.1|3743653_3745435_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
AUK23188.1|3745524_3746340_-	transcriptional regulator	NA	NA	NA	NA	NA
AUK23189.1|3746417_3746900_-	ureidoglycolate lyase	NA	NA	NA	NA	NA
AUK23190.1|3747129_3748056_+	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
AUK23191.1|3748124_3749219_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
>prophage 13
CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	3945526	4042344	5072975	transposase,capsid,protease,head,portal,lysis,tail,holin,terminase,plate	Shigella_phage(41.67%)	99	NA	NA
AUK23373.1|3945526_3947560_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
AUK24548.1|3947556_3947772_-	hypothetical protein	NA	NA	NA	NA	NA
AUK23374.1|3947688_3948276_+	transcriptional regulator	NA	NA	NA	NA	NA
AUK23375.1|3948289_3949762_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AUK23376.1|3949775_3951446_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
AUK23377.1|3951658_3952327_+	hypothetical protein	NA	NA	NA	NA	NA
AUK23378.1|3952298_3952496_+	universal stress protein	NA	NA	NA	NA	NA
AUK23379.1|3952402_3952615_+	hypothetical protein	NA	NA	NA	NA	NA
AUK23380.1|3952569_3953265_-	lactate utilization protein C	NA	NA	NA	NA	NA
AUK23381.1|3953257_3954685_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
AUK23382.1|3954695_3955415_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
AUK23383.1|3955941_3956796_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUK23384.1|3957021_3958347_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	3.2e-113
AUK23385.1|3958455_3958692_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AUK23386.1|3958703_3959297_+	hypothetical protein	NA	NA	NA	NA	NA
AUK23387.1|3959854_3960739_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUK23388.1|3960878_3965135_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
AUK23389.1|3966249_3966351_+	hypothetical protein	NA	NA	NA	NA	NA
AUK23390.1|3966714_3966978_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
AUK23391.1|3966977_3967118_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
AUK23392.1|3967152_3967380_-	hypothetical protein	NA	NA	NA	NA	NA
AUK23393.1|3967441_3967621_-	hypothetical protein	NA	NA	NA	NA	NA
AUK23394.1|3968047_3969028_-|transposase	IS5/IS1182 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.3e-183
AUK23395.1|3969026_3969245_+	hypothetical protein	NA	NA	NA	NA	NA
AUK23396.1|3969354_3969945_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AUK23397.1|3970019_3970607_+	fimbrial protein	NA	NA	NA	NA	NA
AUK23398.1|3970664_3971333_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
AUK23399.1|3973872_3975516_+	fimbria adhesin EcpD	NA	NA	NA	NA	NA
AUK23400.1|3976508_3976838_+	ferredoxin	NA	NA	NA	NA	NA
AUK23401.1|3977084_3977699_-	hypothetical protein	NA	NA	NA	NA	NA
AUK23402.1|3978115_3978805_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
AUK23403.1|3978801_3979758_+	xanthine dehydrogenase	NA	NA	NA	NA	NA
AUK23404.1|3979754_3981953_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	3.3e-38
AUK23405.1|3981962_3982919_+	hypothetical protein	NA	NA	NA	NA	NA
AUK23406.1|3982897_3983308_+	hypothetical protein	NA	NA	NA	NA	NA
AUK23407.1|3983544_3983697_-	hypothetical protein	NA	NA	NA	NA	NA
AUK23408.1|3984045_3984315_-	hypothetical protein	NA	NA	NA	NA	NA
AUK23409.1|3984942_3986832_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AUK23410.1|3986865_3987057_-	DNA invertase	NA	A0A1S6L009	Salmonella_phage	70.5	1.7e-15
AUK23411.1|3987086_3987617_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	95.5	9.9e-98
AUK23412.1|3987616_3988219_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	3.6e-96
AUK23413.1|3988190_3988610_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	66.1	4.8e-39
AUK23414.1|3989485_3990070_-	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	100.0	1.1e-113
AUK23415.1|3990060_3991119_-|plate	phage baseplate protein	plate	U5P424	Shigella_phage	98.0	6.8e-199
AUK23416.1|3991105_3991534_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	2.0e-80
AUK23417.1|3991530_3992079_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.4	3.3e-96
AUK23418.1|3992078_3993158_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	4.5e-206
AUK23419.1|3993154_3994525_-	DNA circularization protein	NA	S5FUX4	Shigella_phage	98.9	1.1e-254
AUK23420.1|3994543_3996379_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.3	5.0e-306
AUK23421.1|3996371_3996554_-	hypothetical protein	NA	NA	NA	NA	NA
AUK23422.1|3996520_3996790_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
AUK23423.1|3996789_3997146_-|tail	phage tail protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
AUK23424.1|3997145_3998642_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	98.8	2.9e-272
AUK23425.1|3998625_3998796_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
AUK23426.1|3998804_3999365_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
AUK23427.1|3999361_3999868_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.3	6.6e-83
AUK23428.1|3999842_4000253_-|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	94.9	6.1e-71
AUK23429.1|4000249_4000573_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	98.1	3.3e-56
AUK23430.1|4000575_4000776_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	1.7e-26
AUK23431.1|4000825_4002031_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
AUK23432.1|4002045_4002732_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	1.1e-125
AUK23433.1|4002673_4003915_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
AUK23434.1|4003914_4004097_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	96.7	8.5e-25
AUK23435.1|4004108_4005842_-|terminase	terminase	terminase	U5P0Q5	Shigella_phage	98.6	0.0e+00
AUK23436.1|4005855_4006350_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	99.4	1.6e-86
AUK23437.1|4006466_4006817_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	1.2e-62
AUK23438.1|4007109_4007250_-	Rz1 lytic protein	NA	U5P461	Shigella_phage	81.0	3.5e-10
AUK23439.1|4007342_4007636_+	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AUK23440.1|4007667_4008129_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.7	9.2e-76
AUK23441.1|4008125_4008602_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	96.8	7.8e-86
AUK24549.1|4008605_4008941_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	100.0	5.2e-60
AUK23442.1|4009017_4010070_-	site-specific DNA-methyltransferase	NA	K7PKK9	Enterobacteria_phage	97.7	7.0e-204
AUK23443.1|4010219_4010414_-	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	93.8	3.7e-26
AUK23444.1|4010991_4012074_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
AUK23445.1|4012262_4012646_-	antitermination protein	NA	A0A088CD47	Shigella_phage	83.3	5.2e-56
AUK23446.1|4012731_4012872_-	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
AUK23447.1|4012868_4013231_-	hypothetical protein	NA	K7PM48	Enterobacteria_phage	94.0	2.3e-58
AUK23448.1|4013227_4013518_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	2.5e-47
AUK24550.1|4013510_4013606_-	hypothetical protein	NA	NA	NA	NA	NA
AUK23449.1|4013686_4014899_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
AUK23450.1|4017293_4018772_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AUK23451.1|4018710_4019454_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AUK23452.1|4019450_4022216_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.4e-81
AUK23453.1|4022224_4022986_-	hypothetical protein	NA	NA	NA	NA	NA
AUK23454.1|4022990_4024322_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AUK23455.1|4024324_4024849_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AUK23456.1|4024845_4026126_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AUK23457.1|4026150_4027233_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AUK23458.1|4027196_4029047_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AUK23459.1|4029050_4029464_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AUK23460.1|4029470_4030946_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AUK23461.1|4030996_4031221_-	hypothetical protein	NA	NA	NA	NA	NA
AUK23462.1|4031255_4031756_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AUK23463.1|4032450_4032969_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AUK23464.1|4033001_4033139_+	hypothetical protein	NA	NA	NA	NA	NA
AUK23465.1|4033178_4035320_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.9	9.1e-25
AUK23466.1|4035395_4039430_+	RHS element protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.1e-22
AUK23467.1|4040385_4040604_+	hypothetical protein	NA	NA	NA	NA	NA
AUK23468.1|4041207_4042344_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 14
CP024127	Escherichia coli strain 14EC001 chromosome, complete genome	5072975	4061162	4078095	5072975	transposase,integrase	Enterobacteria_phage(31.82%)	24	4062473:4062486	4066697:4066710
AUK23489.1|4061162_4062218_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	5.0e-117
4062473:4062486	attL	ATCATTTTTCCTAA	NA	NA	NA	NA
AUK23490.1|4062505_4063609_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AUK23491.1|4063620_4064874_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
AUK24553.1|4065078_4066017_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	4.7e-183
AUK23492.1|4066118_4066499_-	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	99.1	2.2e-59
AUK23493.1|4066440_4066719_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.7	1.4e-47
4066697:4066710	attR	TTAGGAAAAATGAT	NA	NA	NA	NA
AUK23494.1|4066766_4066985_-	conjugal transfer protein TraR	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
AUK23495.1|4067083_4067365_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
AUK24554.1|4067927_4068086_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	96.2	1.5e-22
AUK23496.1|4068082_4068763_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
AUK23497.1|4068759_4069545_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
AUK23498.1|4069550_4069847_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	5.2e-48
AUK23499.1|4069923_4070130_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AUK23500.1|4070725_4071481_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AUK23501.1|4071519_4071750_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AUK23502.1|4071819_4072359_+	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
AUK23503.1|4072355_4073375_+	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	62.8	5.3e-108
AUK23504.1|4073371_4074073_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.7	1.9e-128
AUK23505.1|4074069_4074363_+	ArsR family transcriptional regulator	NA	A0A0P0ZCJ0	Stx2-converting_phage	84.9	3.7e-38
AUK23506.1|4074651_4075404_+	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	36.5	3.9e-31
AUK23507.1|4075660_4076143_+	hypothetical protein	NA	NA	NA	NA	NA
AUK23508.1|4076234_4076336_+	hypothetical protein	NA	NA	NA	NA	NA
AUK23509.1|4076332_4076788_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	67.5	5.4e-60
AUK23510.1|4076881_4078095_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
>prophage 1
CP024129	Escherichia coli strain 14EC001 plasmid p14EC001b, complete sequence	123884	80	73589	123884	transposase	Escherichia_phage(25.0%)	51	NA	NA
AUK24650.1|80_1293_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
AUK24651.1|1414_1693_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	34.2	8.8e-05
AUK24652.1|2324_4985_+	peptidase M66	NA	NA	NA	NA	NA
AUK24653.1|5068_5944_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
AUK24749.1|6001_7915_+	type II secretion system protein GspD	NA	A7BJX1	Enterobacteria_phage	27.6	1.9e-26
AUK24654.1|9414_10638_+	type II secretion system protein GspF	NA	NA	NA	NA	NA
AUK24655.1|10668_11103_+	type II secretion system protein GspG	NA	NA	NA	NA	NA
AUK24656.1|11099_11651_+	type II secretion system protein GspH	NA	NA	NA	NA	NA
AUK24750.1|11665_12013_+	type II secretion system protein GspI	NA	NA	NA	NA	NA
AUK24657.1|12009_12609_+	type II secretion system protein GspJ	NA	NA	NA	NA	NA
AUK24658.1|13620_14793_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
AUK24659.1|14779_15295_+	type II secretion system protein M	NA	NA	NA	NA	NA
AUK24751.1|15462_16179_+	prepilin peptidase	NA	NA	NA	NA	NA
AUK24660.1|21703_21916_-	hypothetical protein	NA	NA	NA	NA	NA
AUK24661.1|23428_23707_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	34.2	8.8e-05
AUK24662.1|29881_31384_+	type II secretion system protein GspE	NA	NA	NA	NA	NA
AUK24663.1|31385_32609_+	type II secretion system protein GspF	NA	NA	NA	NA	NA
AUK24664.1|33069_33621_+	type II secretion system protein GspH	NA	NA	NA	NA	NA
AUK24752.1|33635_33983_+	type II secretion system protein GspI	NA	NA	NA	NA	NA
AUK24665.1|33979_34579_+	type II secretion system protein GspJ	NA	NA	NA	NA	NA
AUK24666.1|34575_35553_+	pullulanase	NA	NA	NA	NA	NA
AUK24667.1|36752_37268_+	type II secretion system protein M	NA	NA	NA	NA	NA
AUK24668.1|38247_38649_+	lipoprotein, PulS/OutS family	NA	NA	NA	NA	NA
AUK24669.1|39928_41142_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.0e-166
AUK24670.1|41253_41643_-	cytochrome b562 family protein	NA	NA	NA	NA	NA
AUK24671.1|41686_43897_-	Catalase-peroxidase 2	NA	NA	NA	NA	NA
AUK24672.1|44075_45288_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
AUK24673.1|45254_45350_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.4e-07
AUK24674.1|46396_46762_-|transposase	transposase	transposase	NA	NA	NA	NA
AUK24675.1|47497_51241_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	38.9	6.1e-218
AUK24676.1|53186_53474_-	addiction module toxin RelE	NA	NA	NA	NA	NA
AUK24677.1|53546_54755_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.8	8.8e-235
AUK24678.1|55120_56326_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
AUK24679.1|56769_57090_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AUK24680.1|57082_57469_+	amino acid-binding protein	NA	NA	NA	NA	NA
AUK24681.1|57476_58163_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUK24682.1|58140_58767_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUK24683.1|58845_60051_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
AUK24684.1|60163_60832_-	putative tetracyline resistance transcriptional regulator TetC	NA	NA	NA	NA	NA
AUK24685.1|61270_62479_-|transposase	IS4 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.5	7.5e-234
AUK24686.1|62631_62895_-	plasmid stabilization protein	NA	NA	NA	NA	NA
AUK24687.1|63001_63226_-	hypothetical protein	NA	NA	NA	NA	NA
AUK24688.1|63203_63392_+	hypothetical protein	NA	NA	NA	NA	NA
AUK24689.1|63353_63602_-	replication protein	NA	NA	NA	NA	NA
AUK24690.1|64262_65475_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.0e-166
AUK24691.1|66423_66666_+	hypothetical protein	NA	NA	NA	NA	NA
AUK24692.1|66932_67754_+	carbohydrate transporter	NA	NA	NA	NA	NA
AUK24693.1|67753_68860_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AUK24694.1|68953_70675_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
AUK24695.1|70748_71747_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AUK24696.1|72050_73589_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	4.9e-299
>prophage 2
CP024129	Escherichia coli strain 14EC001 plasmid p14EC001b, complete sequence	123884	106141	113927	123884	integrase	Escherichia_phage(28.57%)	11	105798:105813	121253:121268
105798:105813	attL	CAGCCAGTGCCTGAAT	NA	NA	NA	NA
AUK24733.1|106141_106825_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.7	8.7e-30
AUK24756.1|107209_108112_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AUK24734.1|108149_108419_-	hypothetical protein	NA	NA	NA	NA	NA
AUK24735.1|108529_108778_+	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
AUK24736.1|108774_109212_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.4	1.1e-25
AUK24737.1|109211_110483_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.5	1.4e-142
AUK24738.1|110487_110916_-	plasmid stability protein	NA	NA	NA	NA	NA
AUK24739.1|110884_111856_-	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
AUK24740.1|112084_112729_+	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
AUK24741.1|112722_112998_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AUK24742.1|113135_113927_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	9.4e-52
121253:121268	attR	ATTCAGGCACTGGCTG	NA	NA	NA	NA
>prophage 1
CP024130	Escherichia coli strain 14EC001 plasmid p14EC001c, complete sequence	88460	7924	59323	88460	integrase,transposase	Escherichia_phage(38.1%)	50	43472:43531	59328:60110
AUK24763.1|7924_8713_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.5e-52
AUK24764.1|8770_8962_-	hypothetical protein	NA	NA	NA	NA	NA
AUK24765.1|11441_11723_+	hypothetical protein	NA	NA	NA	NA	NA
AUK24766.1|12631_13957_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	1.9e-113
AUK24767.1|14891_15239_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AUK24768.1|16913_17144_+	hypothetical protein	NA	NA	NA	NA	NA
AUK24769.1|17061_17514_+	hypothetical protein	NA	NA	NA	NA	NA
AUK24770.1|20738_21710_-	plasmid-partitioning protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	1.4e-150
AUK24771.1|21709_22876_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
AUK24772.1|23616_24627_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
AUK24773.1|24994_25084_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.3e-07
AUK24774.1|25049_26263_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
AUK24775.1|27268_27685_-	traK protein	NA	NA	NA	NA	NA
AUK24776.1|28269_28605_+	hypothetical protein	NA	NA	NA	NA	NA
AUK24777.1|28613_28805_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AUK24778.1|29932_30688_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
AUK24779.1|30688_30883_+	hypothetical protein	NA	NA	NA	NA	NA
AUK24780.1|31367_31556_-	hypothetical protein	NA	NA	NA	NA	NA
AUK24781.1|31682_31871_-	hypothetical protein	NA	NA	NA	NA	NA
AUK24782.1|32025_32295_+	hypothetical protein	NA	NA	NA	NA	NA
AUK24783.1|32291_33002_+	hypothetical protein	NA	A0A077SL39	Escherichia_phage	99.4	2.3e-89
AUK24784.1|33103_33583_+	transcriptional regulator	NA	NA	NA	NA	NA
AUK24785.1|33652_36805_-	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
AUK24786.1|36828_38004_-	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
AUK24787.1|38323_39028_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AUK24788.1|38973_39153_-	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	85.7	7.3e-05
AUK24789.1|39221_39608_+	bleomycin binding protein	NA	NA	NA	NA	NA
AUK24790.1|40704_41097_-	NimC/NimA family protein	NA	NA	NA	NA	NA
AUK24791.1|42851_43163_-	hypothetical protein	NA	NA	NA	NA	NA
AUK24792.1|43198_43477_-	IncN plasmid KikA protein	NA	NA	NA	NA	NA
43472:43531	attL	CGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
AUK24793.1|43535_44240_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AUK24794.1|44680_44866_+	hypothetical protein	NA	NA	NA	NA	NA
AUK24795.1|45720_46512_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
AUK24834.1|46602_46830_-	hypothetical protein	NA	NA	NA	NA	NA
AUK24796.1|46980_47226_-	hypothetical protein	NA	NA	NA	NA	NA
AUK24797.1|47263_48127_-	short-chain dehydrogenase/reductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
AUK24798.1|48272_49502_-	macrolide efflux MFS transporter Mef(B)	NA	A0A1B0RXG2	Streptococcus_phage	39.0	2.1e-74
AUK24799.1|49951_50656_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUK24800.1|50806_51622_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AUK24801.1|51811_52516_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
AUK24802.1|52562_53867_-|integrase	integrase	integrase	NA	NA	NA	NA
AUK24803.1|53905_54613_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AUK24804.1|54609_54846_-	mercury resistance protein	NA	NA	NA	NA	NA
AUK24805.1|54842_55205_-	transcriptional regulator	NA	NA	NA	NA	NA
AUK24806.1|55222_56917_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AUK24835.1|56968_57391_-	mercury transport protein MerC	NA	NA	NA	NA	NA
AUK24807.1|57426_57702_-	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AUK24808.1|57715_58066_-	mercuric transporter	NA	NA	NA	NA	NA
AUK24809.1|58137_58572_+	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AUK24810.1|58618_59323_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
59328:60110	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGTTCTGCTCTGTCCAGAATCTGTTGGCGCAGATTTTCTTTCATGTGTTCGATTAATGGGCTGACCATCGGATTAGTGGCATAACCAGAAGCGCGTTCGTACACCATGGAATAGGCTTCCTGAATCGCGTTCTCAATGCTGACAGGATCGTTAGCATCGAAGTGGACATCATAACTTCCGTTTAATGCCTCTGTTGCTCTCTCAACCTCTTTTAGCTGTTTCTGCATTTTGTCTAAACCTGTGATTTTGACGCTCATAACAACCTCCGGACTAAGTGAGATGTATCAACCTTTATAGATAGCACGTTGGAGATGTGGGGTAAGGGATATCACTCAAATTCCATGTAATTTCATTAAGATCAGACTTAACCTTTTTTCGGATCTCCGATAAAAAAGAAAGAAATAGAGATATGCTAAACATATGCCTGGCATCTACATATGCTACCGCTATACATATGCCACACATCTGCCTATACTAAACATATGCACACACCCGGTGCTTTGAATATTCCGGATATGTTTCACATATCCATATGCTCGGGAGAGAAAAAACATGAGAACCGTATCGATATTCAAAAATGGCAACAACCGCGCCATCCGTCTGCCTCGTGATCTGGATTTTGAGGGGGTGAGCGAGCTCGAGATCGTCCGGGAAGGGGACAGCATCATCCTGCGCCCCGTCCGGCCAACCTGGGGATCATTCCTAGAGTACGAAAAAGCCGATCC	NA	NA	NA	NA
