The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024147	Escherichia coli strain 14EC033 chromosome, complete genome	4639454	965094	1027249	4639454	protease,plate,tRNA	uncultured_Mediterranean_phage(12.5%)	55	NA	NA
AUJ94823.1|965094_966519_+|protease	periplasmic serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
AUJ94824.1|966673_967831_+	carbohydrate diacid regulator	NA	NA	NA	NA	NA
AUJ94825.1|967919_968306_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ94826.1|968619_969444_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AUJ94827.1|969474_972147_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
AUJ94828.1|972208_973003_-	methionine aminopeptidase	NA	NA	NA	NA	NA
AUJ94829.1|973002_973224_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ94830.1|973370_974096_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
AUJ94831.1|974230_975082_+	elongation factor Ts	NA	NA	NA	NA	NA
AUJ94832.1|975228_975954_+	UMP kinase	NA	NA	NA	NA	NA
AUJ94833.1|976103_976661_+	ribosome-recycling factor	NA	NA	NA	NA	NA
AUJ94834.1|976752_977949_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AUJ94835.1|978137_978896_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
AUJ94836.1|978908_979766_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AUJ94837.1|979777_981130_+|protease	zinc metalloprotease RseP	protease	NA	NA	NA	NA
AUJ94838.1|981159_983592_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AUJ94839.1|983713_984199_+	chaperone protein Skp	NA	NA	NA	NA	NA
AUJ94840.1|984202_985228_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AUJ94841.1|985332_985788_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AUJ94842.1|985791_986580_+	acyl-[acyl-carrier-protein]--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AUJ94843.1|986579_987728_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AUJ94844.1|987724_988321_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	1.3e-26
AUJ94845.1|988357_991840_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
AUJ94846.1|991852_992812_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AUJ94847.1|992910_995052_+	lysine decarboxylase	NA	NA	NA	NA	NA
AUJ94848.1|995108_995498_+	VOC family protein	NA	NA	NA	NA	NA
AUJ94849.1|995562_996858_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AUJ98158.1|996910_997165_-	protein rof	NA	NA	NA	NA	NA
AUJ94850.1|997157_997358_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ94851.1|997523_998069_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ94852.1|998065_998488_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUJ94853.1|998501_999212_+	copper homeostasis/adhesion lipoprotein NlpE	NA	NA	NA	NA	NA
AUJ94854.1|999411_1000236_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ94855.1|1000288_1002007_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AUJ94856.1|1002117_1002825_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AUJ94857.1|1002821_1003226_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
AUJ94858.1|1003343_1004159_-	methionine ABC transporter substrate-binding protein MetQ	NA	NA	NA	NA	NA
AUJ94859.1|1004198_1004852_-	methionine ABC transporter	NA	NA	NA	NA	NA
AUJ94860.1|1004844_1005876_-	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
AUJ94861.1|1006063_1006639_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AUJ94862.1|1013197_1014112_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ94863.1|1014352_1015153_+	EEP domain-containing protein	NA	NA	NA	NA	NA
AUJ94864.1|1015230_1016001_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ94865.1|1016048_1017407_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AUJ94866.1|1017478_1018234_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AUJ94867.1|1018267_1018990_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ94868.1|1018986_1019454_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AUJ98159.1|1019518_1020250_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
AUJ94869.1|1020590_1021637_-	cytoplasmic protein	NA	NA	NA	NA	NA
AUJ94870.1|1021647_1022643_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AUJ94871.1|1022639_1024523_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AUJ94872.1|1024538_1025033_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AUJ94873.1|1025227_1025860_-	impE family protein	NA	NA	NA	NA	NA
AUJ94874.1|1025846_1026761_-	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
AUJ94875.1|1027093_1027249_+|protease	Clp protease ClpB	protease	NA	NA	NA	NA
>prophage 2
CP024147	Escherichia coli strain 14EC033 chromosome, complete genome	4639454	1057086	1070424	4639454	integrase	Enterobacteria_phage(50.0%)	23	1051825:1051884	1066275:1066412
1051825:1051884	attL	CATAACCTGAATCTGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCA	NA	NA	NA	NA
AUJ94902.1|1057086_1058142_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
AUJ94903.1|1058429_1059533_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AUJ94904.1|1059544_1060798_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	7.5e-96
AUJ94905.1|1061002_1062163_-|integrase	integrase	integrase	K7P7R5	Enterobacteria_phage	99.7	3.4e-228
AUJ94906.1|1062455_1062734_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
AUJ94907.1|1062781_1063000_-	conjugal transfer protein TraR	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
AUJ94908.1|1063098_1063380_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
AUJ94909.1|1063390_1063948_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	7.0e-62
AUJ98162.1|1063940_1064105_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	92.3	7.9e-22
AUJ94910.1|1064101_1064782_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
AUJ94911.1|1064778_1065564_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AUJ94912.1|1065569_1065866_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
AUJ94913.1|1065941_1066148_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AUJ94914.1|1067022_1067331_+	hypothetical protein	NA	NA	NA	NA	NA
1066275:1066412	attR	TGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCC	NA	NA	NA	NA
AUJ94915.1|1067489_1067693_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ94916.1|1067778_1067880_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ94917.1|1067876_1068332_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	7.0e-60
AUJ94918.1|1068331_1068502_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AUJ94919.1|1068494_1068785_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	5.7e-47
AUJ94920.1|1068781_1069144_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	5.6e-60
AUJ94921.1|1069140_1069281_+	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	72.1	3.5e-10
AUJ94922.1|1069366_1069744_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
AUJ94923.1|1069899_1070424_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	53.5	1.2e-47
>prophage 3
CP024147	Escherichia coli strain 14EC033 chromosome, complete genome	4639454	1341824	1386929	4639454	lysis,tail,integrase,tRNA,capsid	Enterobacteria_phage(65.0%)	51	1376397:1376443	1392895:1392941
AUJ95148.1|1341824_1342919_-|tRNA	selenophosphate-dependent tRNA 2-selenouridine synthase	tRNA	NA	NA	NA	NA
AUJ95149.1|1342987_1343914_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
AUJ95150.1|1344143_1344626_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
AUJ95151.1|1344703_1345519_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ95152.1|1345608_1347390_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
AUJ95153.1|1347402_1348179_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
AUJ95154.1|1348278_1349157_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
AUJ95155.1|1349325_1350780_+	allantoin permease	NA	NA	NA	NA	NA
AUJ95156.1|1350839_1352201_+	allantoinase AllB	NA	NA	NA	NA	NA
AUJ95157.1|1352257_1353559_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
AUJ95158.1|1353580_1354726_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.7	6.3e-49
AUJ95159.1|1354953_1355739_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
AUJ95160.1|1355749_1356985_-	allantoate amidohydrolase	NA	NA	NA	NA	NA
AUJ95161.1|1357006_1358056_-	ureidoglycolate dehydrogenase (NAD(+))	NA	NA	NA	NA	NA
AUJ95162.1|1358372_1360040_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
AUJ95163.1|1360049_1361309_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
AUJ95164.1|1361319_1362135_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
AUJ95165.1|1362131_1363025_+	carbamate kinase	NA	NA	NA	NA	NA
AUJ95166.1|1363161_1364229_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AUJ95167.1|1364225_1364735_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AUJ95168.1|1364852_1365575_-	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
AUJ95169.1|1365577_1366072_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUJ95170.1|1366245_1367631_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
AUJ95171.1|1367666_1368188_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AUJ95172.1|1368295_1368508_-	ribosome-associated protein	NA	NA	NA	NA	NA
AUJ95173.1|1368509_1369376_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AUJ95174.1|1369846_1370389_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AUJ95175.1|1370608_1371301_+	fimbrial chaperone SfmC	NA	NA	NA	NA	NA
AUJ95176.1|1371331_1373941_+	fimbrial protein	NA	NA	NA	NA	NA
AUJ95177.1|1373953_1374961_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AUJ95178.1|1374971_1375487_+	fimbriae assembly protein	NA	NA	NA	NA	NA
AUJ95179.1|1375489_1376122_-	DNA-binding response regulator	NA	NA	NA	NA	NA
1376397:1376443	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AUJ95180.1|1376456_1377620_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
AUJ95181.1|1377475_1377847_-	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
AUJ95182.1|1377818_1378097_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
AUJ95183.1|1378144_1378363_-	conjugal transfer protein TraR	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
AUJ95184.1|1378590_1378953_+	hypothetical protein	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
AUJ95185.1|1378949_1379090_+	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	65.1	2.1e-07
AUJ95186.1|1379175_1379559_+	antitermination protein	NA	A0A088CD47	Shigella_phage	83.3	5.2e-56
AUJ95187.1|1379747_1380830_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
AUJ95188.1|1381403_1381619_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AUJ95189.1|1381618_1382116_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	95.2	5.6e-87
AUJ95190.1|1382112_1382571_+|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	80.3	6.2e-56
AUJ95191.1|1383733_1383898_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ95192.1|1383943_1384354_-	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	77.0	3.4e-53
AUJ95193.1|1384411_1384645_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
AUJ95194.1|1384750_1384894_+	DNA-packaging protein	NA	NA	NA	NA	NA
AUJ95195.1|1385033_1385858_+	hypothetical protein	NA	A0A0K2FIG2	Enterobacteria_phage	86.4	1.1e-71
AUJ95196.1|1385873_1386224_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.1	1.9e-36
AUJ95197.1|1386234_1386819_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	4.6e-104
AUJ95198.1|1386791_1386929_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
1392895:1392941	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 4
CP024147	Escherichia coli strain 14EC033 chromosome, complete genome	4639454	2208152	2215693	4639454	tRNA	Escherichia_phage(33.33%)	8	NA	NA
AUJ95927.1|2208152_2208668_-	methylated-DNA--protein-cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
AUJ95928.1|2209434_2209716_-	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	96.4	2.5e-07
AUJ95929.1|2209910_2210894_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AUJ95930.1|2211168_2211342_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ95931.1|2211371_2212745_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	5.1e-53
AUJ95932.1|2212873_2213809_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
AUJ95933.1|2213984_2214419_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
AUJ95934.1|2214559_2215693_-	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	58.5	1.4e-117
>prophage 5
CP024147	Escherichia coli strain 14EC033 chromosome, complete genome	4639454	2359915	2415818	4639454	transposase,lysis,tail	Enterobacteria_phage(34.62%)	61	NA	NA
AUJ96046.1|2359915_2360476_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
AUJ96047.1|2360479_2363446_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	99.9	0.0e+00
AUJ96048.1|2363922_2365515_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
AUJ96049.1|2365593_2366547_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
AUJ96050.1|2368323_2369352_+	autoinducer 2 import system permease LsrC	NA	NA	NA	NA	NA
AUJ96051.1|2369351_2370344_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
AUJ96052.1|2370355_2371378_+	autoinducer 2 ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ96053.1|2371404_2372280_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
AUJ96054.1|2372303_2372594_+	autoinducer 2-degrading protein LsrG	NA	NA	NA	NA	NA
AUJ96055.1|2372650_2373409_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
AUJ96056.1|2373412_2374327_-	bestrophin family inner membrane protein	NA	NA	NA	NA	NA
AUJ98211.1|2374276_2374477_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ96057.1|2374523_2375975_-	altronate oxidoreductase	NA	NA	NA	NA	NA
AUJ96058.1|2376119_2376251_-	diguanylate cyclase	NA	NA	NA	NA	NA
AUJ98212.1|2376201_2377149_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	9.6e-19
AUJ96059.1|2377757_2378117_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
AUJ96060.1|2378116_2379043_-	glutaminase 2	NA	NA	NA	NA	NA
AUJ96061.1|2379106_2380495_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUJ96062.1|2380595_2381477_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ96063.1|2381554_2382670_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ96064.1|2382820_2384011_+	sugar efflux transporter	NA	NA	NA	NA	NA
AUJ96065.1|2384035_2384701_-	stress protection protein MarC	NA	NA	NA	NA	NA
AUJ96066.1|2384912_2385347_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
AUJ96067.1|2385367_2385751_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
AUJ96068.1|2385782_2386001_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
AUJ96069.1|2386031_2386931_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
AUJ96070.1|2387125_2388337_+	MFS transporter	NA	NA	NA	NA	NA
AUJ96071.1|2388463_2388559_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ96072.1|2388777_2389668_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
AUJ96073.1|2389922_2390315_-	TIGR00156 family protein	NA	NA	NA	NA	NA
AUJ96074.1|2390590_2391109_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ96075.1|2391153_2393199_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
AUJ98213.1|2393105_2393324_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ96076.1|2393335_2394082_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ96077.1|2394170_2394857_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ96078.1|2395033_2395237_+	selenoprotein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
AUJ96079.1|2395272_2396733_-	D-mannonate oxidoreductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	5.6e-42
AUJ96080.1|2396821_2398105_-	MFS transporter	NA	NA	NA	NA	NA
AUJ96081.1|2398888_2399122_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AUJ96082.1|2399438_2400029_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
AUJ96083.1|2400126_2400702_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	2.9e-103
AUJ96084.1|2400701_2401289_-	hypothetical protein	NA	A0A1B0VFW4	Salmonella_phage	58.3	1.4e-31
AUJ96085.1|2401406_2402105_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.0e-134
AUJ96086.1|2402114_2402444_-|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
AUJ98214.1|2402443_2404567_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	95.0	3.9e-312
AUJ96087.1|2405182_2405389_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
AUJ96088.1|2405543_2405744_+	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	70.0	7.7e-11
AUJ96089.1|2405689_2406100_+	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	89.0	2.1e-63
AUJ96090.1|2406251_2406425_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
AUJ98215.1|2406596_2406752_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ96091.1|2406899_2407088_-	cold-shock protein	NA	NA	NA	NA	NA
AUJ96092.1|2407098_2407311_-	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AUJ96093.1|2408168_2408702_-	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AUJ96094.1|2408698_2409010_-	hypothetical protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AUJ96095.1|2409014_2409230_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AUJ96096.1|2409983_2410199_-	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AUJ96097.1|2411294_2412507_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.1	8.9e-102
AUJ96098.1|2412853_2412982_-	transporter	NA	NA	NA	NA	NA
AUJ96099.1|2413039_2414059_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.5	1.9e-17
AUJ96100.1|2414070_2415285_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AUJ96101.1|2415491_2415818_-	hypothetical protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
>prophage 6
CP024147	Escherichia coli strain 14EC033 chromosome, complete genome	4639454	2834666	2854596	4639454	transposase,plate,integrase,tail	Shigella_phage(36.36%)	25	2823107:2823120	2855992:2856005
2823107:2823120	attL	GGAAGTTAAACAGC	NA	NA	NA	NA
AUJ96506.1|2834666_2835647_-|transposase	IS5/IS1182 family transposase	transposase	Q38213	Escherichia_phage	98.5	1.2e-184
AUJ96507.1|2835819_2836149_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ96508.1|2836320_2837379_-	FUSC family protein	NA	NA	NA	NA	NA
AUJ96509.1|2837576_2838041_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
AUJ96510.1|2838159_2839326_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.5	1.6e-225
AUJ96511.1|2839669_2839801_-	umuD domain protein	NA	O64339	Escherichia_phage	66.7	4.7e-09
AUJ96512.1|2840081_2841152_-	acyltransferase	NA	C6ZR20	Salmonella_phage	23.9	2.8e-06
AUJ96513.1|2841435_2842362_-	carbohydrate kinase	NA	U5P0I1	Shigella_phage	96.0	2.5e-48
AUJ96514.1|2842365_2842950_-	hypothetical protein	NA	O22003	Shigella_phage	98.5	5.9e-112
AUJ96515.1|2842940_2843999_-|plate	phage baseplate protein	plate	M1FQW3	Enterobacteria_phage	98.3	2.3e-199
AUJ96516.1|2843985_2844414_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	100.0	2.3e-81
AUJ96517.1|2844410_2844959_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.9	6.6e-97
AUJ96518.1|2844958_2846038_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.2	2.2e-205
AUJ98233.1|2846034_2847363_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	97.3	2.2e-242
AUJ96519.1|2848506_2849214_+	recombinase	NA	Q716E7	Shigella_phage	99.1	1.4e-136
AUJ96520.1|2849214_2849721_+	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	100.0	2.3e-80
AUJ96521.1|2849734_2850031_+	RecBCD nuclease inhibitor	NA	A0A220NRR0	Escherichia_phage	99.0	8.6e-51
AUJ98234.1|2850041_2850206_+	DUF2737 domain-containing protein	NA	K7P7R0	Enterobacteria_phage	98.1	5.5e-23
AUJ96522.1|2850202_2850685_+	hypothetical protein	NA	K7PJM1	Enterobacteria_phage	96.2	1.5e-81
AUJ96523.1|2850681_2851161_+	hypothetical protein	NA	A5VWB3	Enterobacteria_phage	92.7	1.9e-47
AUJ96524.1|2851157_2851670_+	hypothetical protein	NA	V5UT79	Shigella_phage	65.6	2.6e-42
AUJ96525.1|2851766_2851958_+	Eag protein	NA	A0A088CQ59	Enterobacteria_phage	94.7	1.5e-27
AUJ98235.1|2852823_2853168_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	1.0e-58
AUJ96526.1|2853245_2853437_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
AUJ96527.1|2853417_2854596_-|integrase	integrase	integrase	K7P7J2	Enterobacteria_phage	99.5	4.4e-231
2855992:2856005	attR	GCTGTTTAACTTCC	NA	NA	NA	NA
>prophage 7
CP024147	Escherichia coli strain 14EC033 chromosome, complete genome	4639454	2872718	2890467	4639454		Synechococcus_phage(30.77%)	17	NA	NA
AUJ96544.1|2872718_2874878_-	hypothetical protein	NA	A0A1V0SAH6	Catovirus	34.4	3.5e-08
AUJ96545.1|2874870_2876199_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ96546.1|2876195_2876726_-	HAD family hydrolase	NA	NA	NA	NA	NA
AUJ96547.1|2876722_2877400_-	hypothetical protein	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	27.6	2.4e-11
AUJ96548.1|2877402_2877993_-	SIS domain-containing protein	NA	A0A067XQR2	Caulobacter_phage	36.7	3.3e-17
AUJ96549.1|2877980_2879009_-	dehydrogenase	NA	A0A222YW25	Synechococcus_phage	41.6	4.0e-63
AUJ96550.1|2879025_2880054_-	GDP-mannose 4,6 dehydratase	NA	A0A222YY99	Synechococcus_phage	74.0	8.0e-144
AUJ96551.1|2880060_2880894_-	NAD-dependent dehydratase	NA	A0A222YYW2	Synechococcus_phage	33.3	4.9e-35
AUJ96552.1|2880967_2881942_-	O52 family O-antigen ABC transporter ATP-binding protein Wzt	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	2.5e-14
AUJ96553.1|2881938_2882712_-	O52 family O-antigen ABC transporter permease subunit Wzm	NA	NA	NA	NA	NA
AUJ96554.1|2882713_2883568_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AUJ96555.1|2883564_2884698_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	39.3	1.3e-75
AUJ96556.1|2884700_2885654_-	hypothetical protein	NA	A0A0E3FNQ3	Synechococcus_phage	23.9	6.9e-17
AUJ96557.1|2885650_2886520_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	68.5	2.2e-110
AUJ96558.1|2886532_2887621_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.6	2.3e-101
AUJ96559.1|2888044_2888935_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.3e-46
AUJ96560.1|2889069_2890467_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	29.4	3.5e-17
>prophage 8
CP024147	Escherichia coli strain 14EC033 chromosome, complete genome	4639454	2957913	2967590	4639454	tRNA	Enterobacteria_phage(71.43%)	10	NA	NA
AUJ96620.1|2957913_2959947_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
AUJ96621.1|2960787_2961282_+	zinc-binding protein	NA	Q9EYF6	Enterobacteria_phage	92.7	8.1e-78
AUJ96622.1|2961406_2961868_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AUJ96623.1|2961908_2962379_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AUJ96624.1|2962425_2963145_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ96625.1|2963141_2964827_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.5	1.2e-303
AUJ96626.1|2965048_2965780_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AUJ96627.1|2965839_2965947_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ96628.1|2965927_2966659_-	ABC transporter permease	NA	NA	NA	NA	NA
AUJ96629.1|2966663_2967590_-	ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 9
CP024147	Escherichia coli strain 14EC033 chromosome, complete genome	4639454	3202842	3285254	4639454	transposase,integrase	Shigella_phage(23.08%)	58	3199374:3199390	3246339:3246355
3199374:3199390	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
AUJ96839.1|3202842_3204033_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	57.3	7.6e-130
AUJ96840.1|3205299_3205455_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ96841.1|3209771_3210788_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ96842.1|3211269_3213468_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
AUJ96843.1|3213464_3214781_-	ATP-binding protein	NA	NA	NA	NA	NA
AUJ96844.1|3214784_3217094_-	ATPase	NA	NA	NA	NA	NA
AUJ96845.1|3217895_3218135_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ96846.1|3220145_3221435_+	MFS transporter	NA	NA	NA	NA	NA
AUJ96847.1|3221406_3222432_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUJ96848.1|3222428_3222686_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ96849.1|3222975_3224132_-	hypothetical protein	NA	A0A0P0I4A4	Acinetobacter_phage	44.7	4.7e-68
AUJ96850.1|3227709_3228048_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AUJ96851.1|3228041_3228329_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AUJ96852.1|3229087_3229447_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ96853.1|3229494_3230166_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ96854.1|3230670_3231883_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.1	8.9e-102
AUJ96855.1|3232678_3232933_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ96856.1|3232960_3236458_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.9	1.2e-98
AUJ96857.1|3236827_3237034_+	alkaline phosphatase	NA	NA	NA	NA	NA
AUJ96858.1|3237417_3238690_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AUJ96859.1|3238827_3239184_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	92.5	2.6e-33
AUJ96860.1|3239140_3240292_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	6.8e-43
AUJ96861.1|3241457_3241904_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ96862.1|3241966_3242188_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
AUJ96863.1|3242258_3242654_+	antitoxin	NA	NA	NA	NA	NA
AUJ96864.1|3242847_3243783_-	DNA-binding transcriptional regulator DsdC	NA	NA	NA	NA	NA
AUJ96865.1|3244000_3245338_+	D-serine transporter DsdX	NA	NA	NA	NA	NA
AUJ96866.1|3245355_3246684_+	D-serine ammonia-lyase	NA	NA	NA	NA	NA
3246339:3246355	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
AUJ96867.1|3246791_3248330_-	multidrug resistance protein EmrY	NA	NA	NA	NA	NA
AUJ96868.1|3248329_3249493_-	multidrug resistance protein EmrK	NA	NA	NA	NA	NA
AUJ96869.1|3249907_3250522_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ96870.1|3250526_3254120_+	two-component system sensor histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	31.8	6.6e-36
AUJ96871.1|3254175_3255321_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
AUJ96872.1|3255394_3256339_-	transporter YfdV	NA	NA	NA	NA	NA
AUJ96873.1|3256408_3258103_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.8	1.0e-23
AUJ96874.1|3258156_3259407_-	formyl-CoA--oxalate CoA-transferase	NA	NA	NA	NA	NA
AUJ96875.1|3259919_3260552_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ96876.1|3260847_3261123_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ96877.1|3261199_3261442_-	DUF2545 domain-containing protein	NA	NA	NA	NA	NA
AUJ96878.1|3261794_3262715_+	lipid A biosynthesis palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	5.7e-77
AUJ96879.1|3263206_3264445_-	glutamate--pyruvate aminotransferase AlaC	NA	NA	NA	NA	NA
AUJ96880.1|3264821_3266519_+	sensor histidine kinase	NA	NA	NA	NA	NA
AUJ96881.1|3266533_3267268_+	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
AUJ96882.1|3267280_3268138_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ96883.1|3268140_3270636_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AUJ96884.1|3270660_3271698_-	aminopeptidase	NA	NA	NA	NA	NA
AUJ96885.1|3271697_3272783_-	aminopeptidase	NA	NA	NA	NA	NA
AUJ96886.1|3272797_3274045_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
AUJ96887.1|3274066_3274393_-	fructose-like phosphotransferase enzyme IIB component 1	NA	NA	NA	NA	NA
AUJ96888.1|3274611_3275577_-	glucokinase	NA	NA	NA	NA	NA
AUJ96889.1|3275780_3277037_+	ion channel protein	NA	NA	NA	NA	NA
AUJ96890.1|3277151_3277478_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
AUJ96891.1|3277618_3278857_-	divalent metal cation transporter	NA	NA	NA	NA	NA
AUJ96892.1|3279192_3280395_+	nucleoside permease NupC	NA	NA	NA	NA	NA
AUJ96893.1|3280444_3282634_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AUJ96894.1|3283267_3283612_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ96895.1|3283613_3284006_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ96896.1|3284045_3285254_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.3	7.8e-207
>prophage 10
CP024147	Escherichia coli strain 14EC033 chromosome, complete genome	4639454	3595532	3602671	4639454		Escherichia_phage(83.33%)	6	NA	NA
AUJ97175.1|3595532_3598094_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	2.0e-31
AUJ97176.1|3598199_3598856_+	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	8.6e-51
AUJ97177.1|3598906_3599674_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
AUJ97178.1|3599916_3600777_+	oxidoreductase	NA	A0A077SLF7	Escherichia_phage	77.5	2.9e-115
AUJ97179.1|3600773_3602036_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
AUJ97180.1|3602032_3602671_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	6.3e-83
>prophage 1
CP024150	Escherichia coli strain 14EC033 plasmid p14EC033c, complete sequence	108710	34976	46362	108710	transposase	Salmonella_phage(20.0%)	12	NA	NA
AUJ98445.1|34976_36128_+|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AUJ98446.1|36267_36450_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ98447.1|36937_37198_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.8	1.4e-12
AUJ98448.1|37384_37576_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ98449.1|37618_38125_-	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
AUJ98450.1|38482_39154_+	DNA breaking-rejoining protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	1.3e-78
AUJ98451.1|39333_39756_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	51.9	1.8e-30
AUJ98452.1|39755_41030_+	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.5	1.4e-153
AUJ98453.1|41111_42089_-	chromosome partitioning protein ParB	NA	A0A1B0V750	Salmonella_phage	53.2	2.0e-83
AUJ98454.1|42085_43291_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	1.8e-163
AUJ98455.1|43937_45099_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	5.2e-51
AUJ98456.1|45834_46362_+	superoxide dismutase	NA	Q9MC02	Salmonella_phage	64.5	5.6e-61
>prophage 1
CP024151	Escherichia coli strain 14EC033 plasmid p14EC033d, complete sequence	97858	65	37420	97858	integrase,transposase	Escherichia_phage(35.71%)	32	7056:7070	34437:34451
AUJ98515.1|65_770_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	9.9e-138
AUJ98516.1|1049_1280_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AUJ98517.1|1276_1693_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AUJ98518.1|1766_3329_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AUJ98519.1|3313_4336_+	DNA helicase UvrD	NA	NA	NA	NA	NA
AUJ98520.1|4622_4853_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AUJ98521.1|6442_6664_+	hypothetical protein	NA	NA	NA	NA	NA
7056:7070	attL	TATTATTAATAAATG	NA	NA	NA	NA
AUJ98522.1|8196_8838_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ98523.1|8894_9101_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ98524.1|9214_9691_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ98525.1|10012_10990_+	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	59.2	3.9e-100
AUJ98526.1|11274_12015_-	site-specific recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
AUJ98619.1|12771_14259_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUJ98527.1|14363_15011_-	peptidase	NA	NA	NA	NA	NA
AUJ98528.1|14908_15313_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ98529.1|15565_16546_-|transposase	IS5/IS1182 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
AUJ98530.1|16591_17862_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	2.2e-172
AUJ98531.1|18366_22482_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	37.1	1.6e-126
AUJ98532.1|22583_23564_+|transposase	IS5/IS1182 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
AUJ98533.1|23829_24144_-	hypothetical protein	NA	Q716C2	Shigella_phage	56.6	1.7e-25
AUJ98534.1|24949_25645_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	88.0	1.5e-117
AUJ98535.1|25863_26670_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	96.5	1.1e-55
AUJ98536.1|26670_26976_-	toxin CcdB	NA	NA	NA	NA	NA
AUJ98537.1|26977_27196_-	antitoxin CcdA	NA	NA	NA	NA	NA
AUJ98538.1|27824_28022_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ98539.1|28011_28302_-	korC	NA	NA	NA	NA	NA
AUJ98540.1|28298_28490_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ98541.1|30122_31236_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.3	5.6e-50
AUJ98542.1|32383_32641_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ98543.1|32709_34407_-	sulfatase	NA	A0A1V0SA98	Catovirus	23.2	2.0e-06
AUJ98544.1|34502_35639_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	56.6	8.3e-118
34437:34451	attR	CATTTATTAATAATA	NA	NA	NA	NA
AUJ98545.1|36147_37420_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	4.4e-168
>prophage 1
CP024153	Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence	98181	239	53358	98181	integrase,transposase,protease	Escherichia_phage(35.71%)	57	41:100	56833:58402
41:100	attL	TATGTTGACCCGCAAAAGTATCGATACAGTTCTGCTCTCTGTTGGTGCTGAGAAGCTCTC	NA	NA	NA	NA
AUJ98734.1|239_1439_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AUJ98812.1|1743_1878_+	StbA	NA	NA	NA	NA	NA
AUJ98735.1|1886_2078_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AUJ98736.1|3205_3961_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
AUJ98737.1|3961_4156_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ98738.1|4640_4829_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ98813.1|4948_5134_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ98739.1|5323_5977_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUJ98740.1|6196_6661_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AUJ98741.1|6945_8718_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AUJ98742.1|9654_10659_-|transposase	IS110 family transposase IS4321	transposase	NA	NA	NA	NA
AUJ98743.1|10737_11172_-	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AUJ98744.1|11243_11594_+	mercuric transporter	NA	NA	NA	NA	NA
AUJ98745.1|11607_11883_+	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AUJ98814.1|11918_12341_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AUJ98816.1|14525_15035_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AUJ98746.1|15052_15415_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ98747.1|15411_15648_+	mercury resistance protein	NA	NA	NA	NA	NA
AUJ98748.1|15644_16352_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AUJ98749.1|16390_17695_+|integrase	integrase	integrase	NA	NA	NA	NA
AUJ98750.1|17741_18446_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUJ98815.1|18518_18758_+	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
AUJ98751.1|18903_19767_+	short-chain dehydrogenase/reductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
AUJ98752.1|19804_20050_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ98817.1|20200_20428_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ98753.1|20518_21310_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
AUJ98754.1|22164_22350_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ98755.1|22645_23617_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	38.1	2.4e-49
AUJ98756.1|24932_25058_-	ABC transporter	NA	NA	NA	NA	NA
AUJ98757.1|25662_25878_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ98758.1|26076_26274_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
AUJ98759.1|26335_26743_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ98818.1|28730_29123_+	cysteine hydrolase	NA	NA	NA	NA	NA
AUJ98760.1|29260_30145_+	EamA family transporter	NA	NA	NA	NA	NA
AUJ98761.1|30176_31376_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
AUJ98762.1|31454_32132_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ98763.1|32163_32406_-	relaxase	NA	NA	NA	NA	NA
AUJ98764.1|34043_34748_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUJ98765.1|34693_35254_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ98766.1|35636_36293_-	quinolone resistance pentapeptide repeat protein QnrS2	NA	NA	NA	NA	NA
AUJ98819.1|36718_37093_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUJ98820.1|37157_37436_-	hypothetical protein	NA	E5FFF9	Burkholderia_phage	47.3	1.0e-05
AUJ98767.1|37406_38111_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUJ98768.1|38402_38750_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AUJ98769.1|38972_39425_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
AUJ98770.1|39509_40142_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
AUJ98821.1|40279_41110_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AUJ98822.1|41240_41795_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AUJ98771.1|42831_43536_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUJ98772.1|44281_44779_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AUJ98773.1|45186_45978_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AUJ98774.1|46462_46855_+	NimC/NimA family protein	NA	NA	NA	NA	NA
AUJ98775.1|47174_47561_-	bleomycin binding protein	NA	NA	NA	NA	NA
AUJ98776.1|48673_50110_+	glutathione synthase	NA	NA	NA	NA	NA
AUJ98777.1|50527_51532_+|transposase	IS110 family transposase IS4321	transposase	NA	NA	NA	NA
AUJ98823.1|51919_52606_-	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	28.5	1.1e-19
AUJ98778.1|52653_53358_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
56833:58402	attR	GAGAGCTTCTCAGCACCAACAGAGAGCAGAACTGTATCGATACTTTTGCGGGTCAACATAAGGGGATGAGTCCTTAATAAAACAGGTCCTCAGAGCATACATATTCTGCGGGGCGTGCGGCAACAACAGGACGAACCGGGGCGGTTTTCAATTTGCAGCCGCCAGGCTGCCGTGGTTCATGATAACTTCTGCTCTTCATCGTGCGGCCGACTGGGCTAAATCTGTGTTCTCTTCGGCGGCGCTGGGTGATCCTCGCCGTACTGCCCGCTTGGTTAACGTCGCCGCCCAATTGGCAAAATATTCTGGTAAATCAATAACCATCTCATCAGAGGGTAGTGAAGCCATGCAGGAAGGCGCTTACCGATTTATCCGCAATCCCAACGTTTCTGCCGAGGCGATCAGAAAGGCTGGCGCCATGCAAACAGTCAAGTTGGCTCAGGAGTTTCCCGAACTGCTGGCCATTGAGGACACCACCTCTTTGAGTTATCGCCACCAGGTCGCCGAAGAGCTTGGCAAGCTGGGCTCTATTCAGGATAAATCCCGCGGATGGTGGGTTCACTCCGTTCTCTTGCTCGAGGCCACCACATTCCGCACCGTAGGATTACTGCATCAGGAGTGGTGGATGCGCCCGGATGACCCTGCCGATGCGGATGAAAAGGAGAGTGGCAAATGGCTGGCAGCGGCCGCAACTAGCCGGTTACGCATGGGCAGCATGATGAGCAACGTGATTGCGGTCTGTGACCGCGAAGCCGATATTCATGCTTATCTGCAGGACAAACTGGCGCATAACGAGCGCTTCGTGGTGCGCTCCAAGCACCCACGCAAGGACGTAGAGTCTGGGTTGTATCTGTACGACCATCTGAAGAACCAACCGGAGTTGGGTGGCTATCAGATCAGCATTCCGCAAAAGGGCGTGGTGGATAAACGCGGTAAACGTAAAAATCGACCAGCCCGCAAGGCGAGCTTGAGCCTGCGCAGTGGGCGCATCACGCTAAAACAGGGGAATATCACGCTCAACGCGGTGCTGGCCGAGGAGATTAACCCGCCCAAGGGTGAGACCCCGTTGAAATGGTTGTTGCTGACCAGCGAACCGGTCGAGTCGCTAGCCCAAGCCTTGCGCGTCATCGACATTTATACCCATCGCTGGCGGATCGAGGAGTTCCATAAGGCATGGAAAACCGGAGCAGGAGCCGAGAGGCAACGCATGGAGGAGCCGGATAATCTGGAGCGGATGGTCTCGATCCTCTCGTTTGTTGCGGTCAGGCTGTTACAGCTCAGAGAAAGCTTCACGCTGCCGCAAGCACTCAGGGCGCAAGGGCTGCTAAAGGAAGCGGAACACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGCAGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTT	NA	NA	NA	NA
