The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024155	Escherichia coli strain 14EC047 chromosome, complete genome	5060393	260049	265828	5060393	transposase	Stx2-converting_phage(50.0%)	7	NA	NA
AUJ89202.1|260049_260730_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	1.2e-31
AUJ89203.1|260722_262204_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
AUJ89204.1|262448_262880_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AUJ93574.1|263137_263518_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
AUJ89205.1|263514_263862_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AUJ89206.1|263911_265450_+|transposase	IS66 family transposase ISEc8	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
AUJ89207.1|265510_265828_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	7.4e-16
>prophage 2
CP024155	Escherichia coli strain 14EC047 chromosome, complete genome	5060393	1098023	1111983	5060393		Escherichia_phage(40.0%)	12	NA	NA
AUJ89963.1|1098023_1098785_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
AUJ89964.1|1098778_1099405_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AUJ89965.1|1099544_1100684_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AUJ89966.1|1100746_1101739_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AUJ89967.1|1101832_1103197_-	GntP family transporter	NA	NA	NA	NA	NA
AUJ89968.1|1103285_1104062_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ89969.1|1104066_1104705_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AUJ89970.1|1104701_1105964_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AUJ89971.1|1105960_1106869_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AUJ89972.1|1107064_1107832_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AUJ89973.1|1108659_1109316_-	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	46.3	1.7e-51
AUJ89974.1|1109421_1111983_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 3
CP024155	Escherichia coli strain 14EC047 chromosome, complete genome	5060393	1455389	1568464	5060393	coat,terminase,capsid,transposase,head,tail,tRNA,integrase,plate,holin,portal,lysis	Enterobacteria_phage(62.5%)	130	1526327:1526350	1572280:1572303
AUJ90270.1|1455389_1456551_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AUJ90271.1|1457519_1458455_+	DNA-binding transcriptional regulator DsdC	NA	NA	NA	NA	NA
AUJ90272.1|1458638_1458839_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AUJ90273.1|1458970_1459150_-	Eag protein	NA	K7PL40	Enterobacteria_phage	100.0	2.5e-29
AUJ90274.1|1459246_1460014_-	hypothetical protein	NA	A0A222YWE8	Escherichia_phage	91.7	1.6e-56
AUJ90275.1|1460024_1460780_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	93.2	6.5e-143
AUJ90276.1|1460781_1461534_-	hypothetical protein	NA	K7P6T4	Enterobacteria_phage	86.8	1.7e-98
AUJ90277.1|1461530_1462031_-	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	76.3	2.2e-59
AUJ90278.1|1462027_1462192_-	DUF2737 domain-containing protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
AUJ90279.1|1462188_1462479_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	99.0	1.1e-45
AUJ90280.1|1462489_1462783_-	RecBCD nuclease inhibitor	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
AUJ90281.1|1462806_1463190_-	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	100.0	3.8e-67
AUJ90282.1|1463189_1463795_-	recombinase	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
AUJ90283.1|1464416_1464887_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
AUJ90284.1|1464965_1465154_-	hypothetical protein	NA	K7PMF8	Enterobacteria_phage	90.9	1.1e-16
AUJ90285.1|1465212_1465485_-	antitermination protein N	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
AUJ90286.1|1465831_1466527_-	phage repressor	NA	A0A0N7BTS4	Escherichia_phage	96.1	8.3e-129
AUJ90287.1|1466602_1466818_+	XRE family transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
AUJ90288.1|1466958_1467255_+	hypothetical protein	NA	Q9MCQ0	Enterobacteria_phage	100.0	1.8e-48
AUJ90289.1|1467287_1467434_+	hypothetical protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
AUJ90290.1|1467426_1468326_+	DNA replication protein	NA	A0A0N7C1Z7	Escherichia_phage	99.0	3.0e-163
AUJ90291.1|1468300_1469752_+	helicase DnaB	NA	Q08J37	Stx2-converting_phage	100.0	7.7e-278
AUJ90292.1|1469827_1470268_+	phage protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
AUJ90293.1|1470264_1470792_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	99.4	1.6e-100
AUJ90294.1|1470788_1470971_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
AUJ90295.1|1470967_1471138_+	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	98.2	1.2e-25
AUJ90296.1|1471130_1471742_+	recombination protein NinG	NA	Q716C3	Shigella_phage	99.5	6.0e-99
AUJ90297.1|1471738_1472410_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	97.8	6.6e-131
AUJ90298.1|1472400_1472919_+	antiterminator	NA	Q716B8	Shigella_phage	100.0	9.0e-96
AUJ90299.1|1473380_1473704_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AUJ90300.1|1473687_1474164_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	98.7	8.3e-88
AUJ90301.1|1474160_1474598_+|lysis	lysis protein	lysis	Q716B4	Shigella_phage	97.9	1.1e-70
AUJ90302.1|1474585_1474738_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
AUJ90303.1|1474941_1475460_+	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	99.4	5.5e-93
AUJ90304.1|1475814_1476057_+	hypothetical protein	NA	A0A0M4R322	Salmonella_phage	98.8	1.7e-36
AUJ93621.1|1476092_1476581_+	DNA-packaging protein	NA	G8EYI7	Enterobacteria_phage	100.0	1.4e-90
AUJ90305.1|1476558_1478055_+|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	93.6	1.8e-282
AUJ90306.1|1478054_1480256_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	98.1	0.0e+00
AUJ90307.1|1480346_1481240_+	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	98.7	1.7e-129
AUJ90308.1|1481258_1482518_+|coat	coat protein	coat	A5VW72	Enterobacteria_phage	95.0	1.9e-224
AUJ90309.1|1482559_1482748_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
AUJ90310.1|1482728_1483190_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
AUJ90311.1|1483199_1484618_+	hypothetical protein	NA	Q716G7	Shigella_phage	98.5	1.9e-273
AUJ90312.1|1484617_1485319_+|tail	phage tail protein	tail	G5DA78	Enterobacteria_phage	97.9	7.4e-117
AUJ90313.1|1485318_1485774_+	hypothetical protein	NA	A0A2D1GLX4	Escherichia_phage	100.0	1.8e-87
AUJ90314.1|1485776_1486469_+	DNA transfer protein	NA	A0A2H4FUQ9	Salmonella_phage	99.6	3.9e-118
AUJ90315.1|1486479_1487829_+	DNA injection protein	NA	Q9AYZ0	Salmonella_phage	99.3	1.9e-246
AUJ93622.1|1489996_1490326_-	hypothetical protein	NA	Q9AYY8	Salmonella_phage	99.1	1.7e-52
AUJ90316.1|1490482_1491469_+	hypothetical protein	NA	A9YX09	Burkholderia_phage	47.6	2.7e-72
AUJ90317.1|1491484_1491736_-	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	50.0	7.6e-08
AUJ90318.1|1491850_1492003_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AUJ90319.1|1491999_1492182_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90320.1|1492244_1493147_+	phage antirepressor Ant	NA	Q0H8C7	Salmonella_phage	97.7	2.2e-169
AUJ90321.1|1495295_1495805_-	hypothetical protein	NA	C6ZR20	Salmonella_phage	36.8	1.3e-09
AUJ90322.1|1495888_1497190_-	hypothetical protein	NA	A0A193GZ69	Enterobacter_phage	48.3	3.3e-78
AUJ90323.1|1497338_1498370_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	40.6	1.1e-55
AUJ90324.1|1498496_1498886_+	DNA polymerase V	NA	K7P6F7	Enterobacteria_phage	86.7	7.8e-60
AUJ90325.1|1498892_1500050_-|integrase	integrase	integrase	A5VW56	Enterobacteria_phage	99.5	4.1e-221
AUJ90326.1|1500361_1501294_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
AUJ90327.1|1501391_1501562_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90328.1|1501587_1502343_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AUJ90329.1|1502524_1503583_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ90330.1|1503949_1505290_-	long-chain fatty acid transporter	NA	NA	NA	NA	NA
AUJ90331.1|1505325_1505577_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90332.1|1505661_1505946_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90333.1|1506125_1507436_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AUJ90334.1|1507435_1509580_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AUJ90335.1|1509782_1510268_+	phosphohistidine phosphatase	NA	NA	NA	NA	NA
AUJ90336.1|1510942_1511506_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AUJ90337.1|1511587_1514233_+	PapC/FimD family outer membrane usher protein	NA	NA	NA	NA	NA
AUJ90338.1|1514252_1515005_+	fimbrial protein	NA	NA	NA	NA	NA
AUJ90339.1|1515021_1515528_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90340.1|1515999_1516551_+	fimbrial protein	NA	NA	NA	NA	NA
AUJ90341.1|1517501_1518053_-	endonuclease SmrB	NA	NA	NA	NA	NA
AUJ90342.1|1518218_1519151_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUJ90343.1|1519185_1520271_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
AUJ90344.1|1520274_1521099_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AUJ90345.1|1521098_1521908_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90346.1|1521907_1522456_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AUJ90347.1|1522489_1522768_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90348.1|1522888_1524895_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
1526327:1526350	attL	GATAAGACGCGCCAGCGTCGCATC	NA	NA	NA	NA
AUJ93623.1|1526413_1526635_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ90349.1|1526576_1527755_+	arabinose transporter	NA	NA	NA	NA	NA
AUJ90350.1|1527751_1528747_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AUJ90351.1|1529014_1529908_-	type VI secretion protein	NA	NA	NA	NA	NA
AUJ90352.1|1529912_1530245_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AUJ90353.1|1530506_1530647_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
AUJ90354.1|1530837_1531098_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ90355.1|1531289_1532312_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90356.1|1532432_1533542_-	late control protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	6.3e-195
AUJ90357.1|1533699_1534884_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	4.7e-225
AUJ90358.1|1534883_1535396_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
AUJ90359.1|1535450_1535816_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.9e-55
AUJ90360.1|1535743_1535980_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	3.9e-22
AUJ90361.1|1538779_1539274_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	2.1e-86
AUJ90362.1|1539300_1539900_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	2.6e-86
AUJ90363.1|1539914_1540400_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	56.4	2.0e-41
AUJ90364.1|1543557_1544166_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
AUJ90365.1|1544158_1545055_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	3.9e-155
AUJ90366.1|1545058_1545409_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	9.2e-60
AUJ90367.1|1545405_1545987_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	5.0e-103
AUJ90368.1|1545983_1546619_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
AUJ90369.1|1546611_1547079_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
AUJ90370.1|1547065_1547623_-	hypothetical protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	2.1e-66
AUJ90371.1|1547619_1548012_-	peptidase M15	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	2.9e-70
AUJ90372.1|1548008_1548332_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
AUJ90373.1|1548279_1548534_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	1.3e-31
AUJ90374.1|1548533_1549028_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
AUJ90375.1|1549130_1549931_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	90.6	7.3e-129
AUJ90376.1|1549976_1551029_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
AUJ90377.1|1551052_1551889_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	1.5e-119
AUJ90378.1|1552043_1553795_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
AUJ90379.1|1553794_1554841_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
AUJ90380.1|1555961_1556273_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
AUJ90381.1|1556277_1557237_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	7.9e-178
AUJ90382.1|1560126_1560492_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.0	2.1e-59
AUJ90383.1|1560564_1560795_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	96.1	2.6e-31
AUJ90384.1|1561117_1561417_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	87.9	1.4e-40
AUJ90385.1|1561413_1561680_-	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	76.1	8.9e-31
AUJ90386.1|1561676_1561880_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
AUJ90387.1|1562076_1562319_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AUJ90388.1|1562330_1562618_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	6.0e-33
AUJ90389.1|1562628_1562970_-	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	91.4	1.1e-54
AUJ90390.1|1563222_1563429_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ90391.1|1563435_1563714_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	53.4	3.9e-21
AUJ93624.1|1563835_1564156_+	XRE family transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
AUJ90392.1|1564252_1565257_+|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.4	9.9e-99
AUJ90393.1|1565415_1566573_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	3.9e-22
AUJ90394.1|1566638_1567652_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUJ90395.1|1567651_1568464_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
1572280:1572303	attR	GATGCGACGCTGGCGCGTCTTATC	NA	NA	NA	NA
>prophage 4
CP024155	Escherichia coli strain 14EC047 chromosome, complete genome	5060393	1773784	1796919	5060393	integrase	Enterobacteria_phage(28.21%)	41	1776259:1776279	1804801:1804821
AUJ90576.1|1773784_1774711_+	ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
AUJ90577.1|1774715_1775447_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AUJ90578.1|1775427_1775535_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ90579.1|1775594_1776281_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.8e-102
1776259:1776279	attL	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
AUJ90580.1|1776316_1777603_-|integrase	site-specific integrase	integrase	A0A0N7KZF5	Stx2-converting_phage	99.8	2.9e-252
AUJ90581.1|1777636_1777891_-	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
AUJ90582.1|1777909_1778044_-	hypothetical protein	NA	H6WZF8	Escherichia_phage	100.0	2.2e-22
AUJ90583.1|1778047_1778290_-	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	100.0	1.2e-37
AUJ90584.1|1778377_1778881_-	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	43.0	1.0e-56
AUJ90585.1|1778882_1779569_-	hypothetical protein	NA	H6WZG2	Escherichia_phage	85.2	1.9e-117
AUJ90586.1|1779565_1779787_-	conjugal transfer protein TraR	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
AUJ90587.1|1779885_1780167_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
AUJ90588.1|1780177_1780369_-	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
AUJ93627.1|1780341_1780524_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
AUJ90589.1|1780520_1781201_-	exonuclease	NA	Q6H9Z0	Enterobacteria_phage	99.1	1.0e-131
AUJ90590.1|1781197_1781983_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	99.6	3.1e-148
AUJ90591.1|1781988_1782285_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AUJ90592.1|1782253_1782406_-	host-nuclease inhibitor protein Gam	NA	Q08J51	Stx2-converting_phage	98.0	4.7e-21
AUJ90593.1|1782360_1782630_-	host cell division inhibitory peptide Kil	NA	G3CFI2	Escherichia_phage	97.8	3.3e-41
AUJ90594.1|1782709_1783078_-	DUF2528 domain-containing protein	NA	A0A1U9AJB3	Stx1_converting_phage	99.2	2.6e-65
AUJ90595.1|1783258_1783882_-	hypothetical protein	NA	A0A2D1GLY1	Escherichia_phage	97.1	9.5e-108
AUJ90596.1|1783943_1784327_-	antitermination protein	NA	A0A0P0ZBT9	Stx2-converting_phage	100.0	2.3e-64
AUJ90597.1|1784834_1785455_-	hypothetical protein	NA	A4KWT4	Enterobacteria_phage	99.5	6.2e-51
AUJ90598.1|1785451_1785886_-	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	100.0	1.2e-77
AUJ90599.1|1785956_1786298_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
AUJ90600.1|1786358_1787063_-	XRE family transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
AUJ90601.1|1787176_1787410_+	transcriptional regulator	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
AUJ90602.1|1787548_1787845_+	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
AUJ90603.1|1788745_1789447_+	Replication protein P	NA	Q6H9X6	Enterobacteria_phage	100.0	4.5e-130
AUJ90604.1|1789443_1789734_+	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
AUJ90605.1|1789804_1790083_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
AUJ90606.1|1790215_1790431_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
AUJ90607.1|1790441_1790678_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
AUJ90608.1|1790634_1791081_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	99.3	2.1e-80
AUJ90609.1|1791077_1791605_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	2.8e-100
AUJ90610.1|1791601_1791784_+	NinE family protein	NA	Q4A1A6	Enterobacteria_phage	100.0	4.3e-29
AUJ90611.1|1792287_1794060_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.3	0.0e+00
AUJ90612.1|1794628_1795195_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
AUJ90613.1|1795169_1795772_+	protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	3.9e-90
AUJ90614.1|1795768_1796440_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.6	9.2e-133
AUJ90615.1|1796430_1796919_+	antiterminator	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
1804801:1804821	attR	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
>prophage 5
CP024155	Escherichia coli strain 14EC047 chromosome, complete genome	5060393	1800483	1808510	5060393	transposase,holin,lysis	Enterobacteria_phage(60.0%)	11	NA	NA
AUJ90617.1|1800483_1800699_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AUJ90618.1|1800703_1801048_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	5.0e-58
AUJ90619.1|1801098_1801632_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	1.4e-99
AUJ90620.1|1801905_1802601_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
AUJ93629.1|1802828_1803296_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	94.2	2.0e-73
AUJ93630.1|1803325_1803526_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	76.9	5.0e-10
AUJ90621.1|1803670_1804364_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	1.1e-133
AUJ90622.1|1805089_1806775_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AUJ90623.1|1806771_1807491_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ90624.1|1807537_1808008_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AUJ90625.1|1808048_1808510_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
>prophage 6
CP024155	Escherichia coli strain 14EC047 chromosome, complete genome	5060393	1902745	1913091	5060393	transposase	Enterobacteria_phage(33.33%)	11	NA	NA
AUJ90694.1|1902745_1904140_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.8	3.7e-19
AUJ90695.1|1904314_1905208_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AUJ90696.1|1905244_1905508_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ90697.1|1905580_1906666_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	4.2e-103
AUJ90698.1|1906665_1907565_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
AUJ90699.1|1907622_1908501_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.1e-106
AUJ90700.1|1908505_1909054_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.5	4.2e-51
AUJ90701.1|1909060_1910134_+	glycosyltransferase WbsX family protein	NA	A0A1V0SDW6	Indivirus	25.8	7.8e-25
AUJ90702.1|1910126_1910858_+	hypothetical protein	NA	M1HJ62	Paramecium_bursaria_Chlorella_virus	35.1	1.7e-07
AUJ90703.1|1910850_1912338_+	O115 family O-antigen flippase	NA	NA	NA	NA	NA
AUJ90704.1|1912397_1913091_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	88.3	1.3e-121
>prophage 7
CP024155	Escherichia coli strain 14EC047 chromosome, complete genome	5060393	1966227	2089458	5060393	terminase,capsid,transposase,head,tail,tRNA,integrase,portal,holin,lysis	Escherichia_phage(26.42%)	110	2016127:2016148	2065850:2065871
AUJ90754.1|1966227_1967379_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	2.0e-42
AUJ90755.1|1969781_1969922_+	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
AUJ90756.1|1970055_1970601_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AUJ90757.1|1970597_1971341_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
AUJ90758.1|1971352_1972432_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
AUJ90759.1|1972496_1973429_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AUJ90760.1|1973886_1974804_+	nitrogen assimilation regulatory protein nac	NA	NA	NA	NA	NA
AUJ90761.1|1974905_1975856_+	transcriptional regulator Cbl	NA	NA	NA	NA	NA
AUJ90762.1|1976129_1977617_+	FMN/FAD transporter	NA	NA	NA	NA	NA
AUJ90763.1|1978244_1978961_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUJ90764.1|1979303_1980758_-	AMP nucleosidase	NA	NA	NA	NA	NA
AUJ90765.1|1980859_1982176_-	MFS transporter	NA	NA	NA	NA	NA
AUJ90766.1|1982490_1983543_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90767.1|1983670_1985809_-	autotransporter	NA	NA	NA	NA	NA
AUJ90768.1|1985720_1986572_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ90769.1|1987164_1989144_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUJ90770.1|1990896_1991700_-	thioesterase	NA	NA	NA	NA	NA
AUJ90771.1|2002369_2008477_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.3	4.0e-33
AUJ90772.1|2008667_2009627_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ90773.1|2011581_2013384_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	7.9e-22
AUJ90774.1|2013376_2014657_+	MFS transporter	NA	NA	NA	NA	NA
AUJ90775.1|2014684_2015989_+	salicylate synthase	NA	NA	NA	NA	NA
2016127:2016148	attL	AACCACCTCCTGTGGAGGTGGT	NA	NA	NA	NA
AUJ93642.1|2017781_2018579_-	protein MtfA	NA	NA	NA	NA	NA
AUJ90776.1|2018814_2019840_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	57.6	2.2e-101
AUJ90777.1|2019839_2020043_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AUJ90778.1|2022667_2022856_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUJ90779.1|2022852_2023041_-	cell division inhibitor	NA	NA	NA	NA	NA
AUJ90780.1|2023530_2023683_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
AUJ90781.1|2024001_2024478_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
AUJ90782.1|2024602_2024926_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
AUJ90783.1|2024909_2025335_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUJ90784.1|2025356_2026325_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	52.1	7.6e-72
AUJ90785.1|2026331_2027078_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.4	9.0e-113
AUJ90786.1|2027099_2027870_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	65.6	1.1e-81
AUJ90787.1|2027885_2028299_+	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	87.6	1.4e-59
AUJ90788.1|2028650_2029424_-	iroE	NA	NA	NA	NA	NA
AUJ90789.1|2029984_2031058_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.8	3.0e-08
AUJ90790.1|2031129_2031285_+	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AUJ93643.1|2031452_2031731_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
AUJ90791.1|2031732_2032779_+	hypothetical protein	NA	U5P0K4	Shigella_phage	54.2	7.2e-108
AUJ90792.1|2032791_2033151_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	3.0e-37
AUJ90793.1|2033159_2033690_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
AUJ90794.1|2033808_2034129_+	lipoprotein	NA	S5MQK8	Escherichia_phage	97.4	2.5e-35
AUJ90795.1|2034279_2035329_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	6.8e-199
AUJ90796.1|2036122_2036389_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90797.1|2036532_2036661_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90798.1|2038840_2039056_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
AUJ90799.1|2039018_2039363_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ90800.1|2039311_2039548_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ90801.1|2039516_2039711_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90802.1|2039743_2040277_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	1.4e-99
AUJ90803.1|2040496_2040610_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
AUJ90804.1|2040611_2041079_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	87.0	2.7e-67
AUJ90805.1|2041161_2041302_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90806.1|2041544_2041859_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ90807.1|2041940_2042165_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
AUJ90808.1|2042566_2043076_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AUJ90809.1|2043077_2043392_+|terminase	terminase	terminase	K7PGW7	Enterobacteria_phage	72.9	2.8e-23
AUJ90810.1|2044956_2045163_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AUJ90811.1|2045159_2046752_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	61.0	1.0e-182
AUJ90812.1|2046741_2048247_+	scaffolding protein	NA	A0A2I6TC87	Escherichia_phage	54.2	1.6e-100
AUJ90813.1|2048283_2048631_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
AUJ90814.1|2048688_2049717_+|capsid	major capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.7e-114
AUJ90815.1|2049767_2050142_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90816.1|2050502_2051078_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.3	1.3e-50
AUJ90817.1|2051074_2051470_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AUJ90818.1|2051477_2052230_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	4.6e-133
AUJ90819.1|2052243_2052675_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
AUJ90820.1|2053094_2055674_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.9	0.0e+00
AUJ90821.1|2055670_2056000_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
AUJ90822.1|2055999_2056698_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.7	3.1e-131
AUJ90823.1|2056703_2057447_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	8.0e-146
AUJ90824.1|2057344_2058025_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.2	4.1e-112
AUJ90825.1|2057978_2058185_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90826.1|2058874_2062351_+|tail	phage tail protein	tail	Q6H9T2	Enterobacteria_phage	95.7	0.0e+00
AUJ93644.1|2062419_2063043_+	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	1.9e-68
AUJ90827.1|2063107_2064421_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.3	1.2e-75
AUJ90828.1|2064422_2064692_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
AUJ90829.1|2064868_2065849_+	non-LEE encoded effector protein NleB	NA	Q8HAB2	Salmonella_phage	49.5	1.0e-87
AUJ90830.1|2065928_2066204_-	secretion protein EspO	NA	NA	NA	NA	NA
2065850:2065871	attR	AACCACCTCCTGTGGAGGTGGT	NA	NA	NA	NA
AUJ90831.1|2066266_2067628_-	type III secretion protein GogB	NA	Q9MBM1	Phage_Gifsy-1	29.4	2.1e-51
AUJ90832.1|2067748_2067961_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ90833.1|2067991_2068855_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AUJ90834.1|2068838_2069975_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
AUJ90835.1|2069953_2070169_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ90836.1|2070224_2071454_+	peptidase T	NA	NA	NA	NA	NA
AUJ90837.1|2071599_2072721_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AUJ90838.1|2074561_2074750_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
AUJ93645.1|2075554_2075752_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AUJ90839.1|2075744_2075957_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90840.1|2075946_2076411_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90841.1|2076403_2076637_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90842.1|2076642_2076942_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AUJ90843.1|2076938_2078339_+	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	9.6e-116
AUJ90844.1|2078538_2078790_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90845.1|2078786_2079197_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AUJ90846.1|2079207_2079480_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ90847.1|2079436_2079565_+	trigger factor	NA	NA	NA	NA	NA
AUJ90848.1|2079606_2079831_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ93646.1|2080082_2080289_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90849.1|2080288_2081344_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
AUJ90850.1|2081355_2081691_+|head	head decoration protein	head	NA	NA	NA	NA
AUJ90851.1|2081702_2082116_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
AUJ90852.1|2082321_2082864_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
AUJ90853.1|2083119_2083401_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90854.1|2084001_2085462_-	sensor protein PhoQ	NA	NA	NA	NA	NA
AUJ90855.1|2085461_2086133_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AUJ90856.1|2086300_2087671_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.6e-107
AUJ93647.1|2087674_2088316_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AUJ90857.1|2088351_2089458_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 8
CP024155	Escherichia coli strain 14EC047 chromosome, complete genome	5060393	2192637	2261698	5060393	terminase,capsid,transposase,head,tail,integrase,portal,protease,holin,lysis	Enterobacteria_phage(34.78%)	74	2192452:2192498	2247886:2247932
2192452:2192498	attL	AACATGTCAGTCTGGTACATGGATATCGATACCACCGCCAATTATAA	NA	NA	NA	NA
AUJ90953.1|2192637_2193768_-|integrase	integrase	integrase	O21940	Phage_21	51.1	2.2e-102
AUJ90954.1|2193745_2193994_-	excisionase	NA	NA	NA	NA	NA
AUJ90955.1|2194058_2196530_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	1.6e-57
AUJ90956.1|2196622_2196814_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUJ90957.1|2196810_2196999_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AUJ90958.1|2197552_2197771_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ90959.1|2197800_2197971_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ90960.1|2197930_2198086_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AUJ90961.1|2198278_2198737_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	46.2	2.8e-24
AUJ90962.1|2198763_2198991_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ90963.1|2198974_2199496_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90964.1|2199422_2200442_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.8e-56
AUJ90965.1|2200482_2200905_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	91.8	4.8e-63
AUJ90966.1|2201157_2202057_+	regulator	NA	NA	NA	NA	NA
AUJ93659.1|2202371_2203025_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AUJ90967.1|2204799_2205036_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90968.1|2205194_2205407_+	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
AUJ90969.1|2205623_2205875_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90970.1|2205941_2206220_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90971.1|2206221_2207268_+	hypothetical protein	NA	U5P0K4	Shigella_phage	54.8	5.0e-109
AUJ90972.1|2207280_2207655_+	hypothetical protein	NA	V5URS4	Shigella_phage	62.7	8.4e-35
AUJ90973.1|2207651_2208473_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.4	1.0e-80
AUJ90974.1|2208699_2208897_+	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
AUJ90975.1|2209107_2209590_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.7e-48
AUJ90976.1|2209528_2209879_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AUJ90977.1|2209909_2211523_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	2.6e-181
AUJ90978.1|2211586_2212636_+	DNA adenine methylase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
AUJ90979.1|2213148_2213370_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90980.1|2213910_2215764_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	90.2	0.0e+00
AUJ90981.1|2215913_2216129_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
AUJ90982.1|2216133_2216484_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.4e-37
AUJ90983.1|2216547_2217081_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.4	2.4e-99
AUJ90984.1|2217379_2217817_+|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	93.8	5.7e-67
AUJ90985.1|2218233_2218854_+	hypothetical protein	NA	A0A0U2RXY7	Escherichia_phage	53.7	5.1e-53
AUJ90986.1|2218795_2219863_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ90987.1|2220434_2221648_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.3	1.4e-163
AUJ90988.1|2221719_2222136_+	DNA packaging protein	NA	A0A0U2S671	Escherichia_phage	93.6	3.9e-41
AUJ90989.1|2222065_2222854_+|terminase	large terminase	terminase	O64317	Escherichia_phage	70.6	5.3e-79
AUJ90990.1|2224017_2224224_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	55.4	3.9e-10
AUJ90991.1|2224220_2225813_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	1.0e-182
AUJ90992.1|2225802_2226102_+|tail	phage tail protein	tail	E4WL22	Enterobacteria_phage	53.2	7.0e-16
AUJ90993.1|2227342_2227690_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
AUJ90994.1|2227747_2228776_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	60.4	2.8e-112
AUJ90995.1|2228826_2229195_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ90996.1|2229187_2229541_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	3.0e-42
AUJ90997.1|2230126_2230522_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AUJ90998.1|2230529_2231282_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	4.6e-133
AUJ90999.1|2231295_2231727_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
AUJ91000.1|2231753_2232167_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
AUJ91001.1|2232147_2234718_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	85.3	0.0e+00
AUJ91002.1|2235045_2235744_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	8.1e-132
AUJ91003.1|2241049_2241649_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	96.5	3.5e-107
AUJ91004.1|2241800_2244827_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	84.7	2.2e-48
AUJ91005.1|2244826_2245411_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	95.4	4.6e-104
AUJ91006.1|2245383_2245521_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AUJ93660.1|2245465_2246092_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ91007.1|2246190_2246460_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
AUJ91008.1|2246871_2247429_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
AUJ91009.1|2247425_2247701_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
AUJ91010.1|2248070_2248577_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2247886:2247932	attR	AACATGTCAGTCTGGTACATGGATATCGATACCACCGCCAATTATAA	NA	NA	NA	NA
AUJ91011.1|2248622_2249123_-	YciE/YciF family protein	NA	NA	NA	NA	NA
AUJ91012.1|2249208_2249388_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ91013.1|2249768_2250575_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AUJ91014.1|2250574_2251768_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AUJ93661.1|2251779_2253138_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	5.6e-36
AUJ91015.1|2253141_2254737_-	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AUJ91016.1|2254736_2256299_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AUJ93662.1|2256390_2256435_-	trp operon leader peptide	NA	NA	NA	NA	NA
AUJ91017.1|2256572_2257454_+	phosphatase	NA	NA	NA	NA	NA
AUJ91018.1|2257450_2258071_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AUJ91019.1|2258171_2259044_+	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AUJ91020.1|2259083_2259674_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AUJ91021.1|2259670_2260429_-	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
AUJ91022.1|2260648_2261698_+|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 9
CP024155	Escherichia coli strain 14EC047 chromosome, complete genome	5060393	2546538	2602906	5060393	terminase,capsid,head,transposase,tail,integrase,portal,lysis	Enterobacteria_phage(36.0%)	73	2567020:2567035	2606242:2606257
AUJ91264.1|2546538_2546772_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	87.0	4.1e-32
AUJ91265.1|2547088_2547679_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	2.8e-24
AUJ91266.1|2547776_2548352_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	97.4	4.1e-105
AUJ91267.1|2548351_2551507_-|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	58.6	8.0e-94
AUJ91268.1|2551571_2552171_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	96.5	6.3e-109
AUJ91269.1|2552238_2555718_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.2	0.0e+00
AUJ91270.1|2555778_2556420_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.5	1.0e-96
AUJ91271.1|2557065_2557764_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
AUJ91272.1|2558088_2560668_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.5	0.0e+00
AUJ91273.1|2560660_2561095_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
AUJ91274.1|2561076_2561499_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	6.9e-70
AUJ93672.1|2561514_2562255_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	4.0e-129
AUJ91275.1|2562262_2562658_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
AUJ91276.1|2563243_2563597_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
AUJ91277.1|2563608_2564004_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	4.5e-55
AUJ91278.1|2564045_2565071_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	99.1	2.3e-191
AUJ91279.1|2565126_2565459_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
AUJ91280.1|2565468_2566788_-|capsid	capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	98.9	1.6e-234
AUJ91281.1|2566768_2568370_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
2567020:2567035	attL	CGGAGCCTATCCAGTC	NA	NA	NA	NA
AUJ91282.1|2568366_2568573_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AUJ91283.1|2568569_2570495_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
AUJ91284.1|2570469_2571015_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.1e-94
AUJ93673.1|2571154_2571298_-	DNA-packaging protein	NA	NA	NA	NA	NA
AUJ91285.1|2571403_2571637_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
AUJ91286.1|2571693_2572104_+	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	79.4	7.2e-56
AUJ91287.1|2572255_2572435_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
AUJ93674.1|2572606_2572762_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ93675.1|2572909_2573098_-	cold-shock protein	NA	NA	NA	NA	NA
AUJ91288.1|2573108_2573321_-	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.6e-22
AUJ91289.1|2573684_2574182_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ91290.1|2574178_2574712_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
AUJ91291.1|2574708_2575020_-	hypothetical protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
AUJ91292.1|2575024_2575240_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AUJ91293.1|2575992_2576208_-	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AUJ91294.1|2576508_2576721_+	cold-shock protein CspF	NA	NA	NA	NA	NA
AUJ91295.1|2577142_2577895_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.4	2.7e-133
AUJ91296.1|2577908_2578958_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	6.3e-112
AUJ91297.1|2578959_2579238_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	38.7	4.6e-06
AUJ91298.1|2579304_2579556_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ91299.1|2579772_2579928_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AUJ91300.1|2579999_2580287_-	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AUJ91301.1|2580286_2580526_-	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AUJ91302.1|2580550_2580856_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ91303.1|2581825_2583139_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ91304.1|2583316_2583499_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	76.6	7.4e-13
AUJ91305.1|2583473_2583653_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ93676.1|2584508_2584889_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
AUJ91306.1|2584885_2585233_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AUJ91307.1|2585282_2586821_+|transposase	IS66 family transposase ISEc8	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
AUJ91308.1|2587255_2587612_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
AUJ91309.1|2587608_2588031_-	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	1.3e-63
AUJ91310.1|2588071_2589091_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	4.7e-56
AUJ91311.1|2589017_2589539_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ91312.1|2589522_2589753_-	division inhibition gene dicB repressor	NA	NA	NA	NA	NA
AUJ91313.1|2590409_2590565_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AUJ91314.1|2590524_2590695_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ91315.1|2590724_2590943_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ93677.1|2590959_2591148_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ91316.1|2591486_2591675_+	division inhibition protein DicB	NA	NA	NA	NA	NA
AUJ91317.1|2591671_2591863_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUJ91318.1|2591956_2594428_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
AUJ91319.1|2594500_2594752_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AUJ91320.1|2594771_2596067_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	1.5e-155
AUJ91321.1|2596086_2596197_-	transporter	NA	NA	NA	NA	NA
AUJ91322.1|2596254_2597274_-	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	26.2	5.7e-17
AUJ91323.1|2597285_2598500_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AUJ91324.1|2598480_2598669_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ91325.1|2598705_2599032_-	hypothetical protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AUJ91326.1|2599166_2599508_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ91327.1|2599542_2600103_+	spermidine acetyltransferase	NA	NA	NA	NA	NA
AUJ93678.1|2600105_2600816_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AUJ91328.1|2600923_2601229_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AUJ91329.1|2601427_2602906_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	4.0e-120
2606242:2606257	attR	GACTGGATAGGCTCCG	NA	NA	NA	NA
>prophage 10
CP024155	Escherichia coli strain 14EC047 chromosome, complete genome	5060393	2857815	2955831	5060393	capsid,head,tail,tRNA,integrase,protease,holin,portal	Enterobacteria_phage(38.98%)	112	2877688:2877703	2951522:2951537
AUJ91574.1|2857815_2858697_-|protease	protease HtpX	protease	NA	NA	NA	NA
AUJ91575.1|2858888_2860937_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
AUJ91576.1|2860956_2861655_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AUJ91577.1|2861751_2862249_-	Free methionine-R-sulfoxide reductase	NA	NA	NA	NA	NA
AUJ91578.1|2862378_2863662_+	paraquat-inducible membrane protein A	NA	NA	NA	NA	NA
AUJ91579.1|2863630_2866264_+	MCE family protein	NA	NA	NA	NA	NA
AUJ93687.1|2866343_2867783_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AUJ91580.1|2867900_2868137_+	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
AUJ93688.1|2868241_2868433_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUJ91581.1|2868433_2869090_-	serine/threonine-protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
AUJ91582.1|2869485_2869827_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AUJ91583.1|2869839_2870712_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ91584.1|2870715_2871090_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AUJ91585.1|2871228_2871459_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
AUJ91586.1|2871560_2872217_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AUJ91587.1|2872240_2872903_+	DNA polymerase III subunit epsilon	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
AUJ91588.1|2872899_2874960_-	oligopeptidase B	NA	NA	NA	NA	NA
AUJ91589.1|2875168_2875828_-	DUF533 domain-containing protein	NA	NA	NA	NA	NA
AUJ91590.1|2876154_2876511_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ91591.1|2876577_2876868_-	damage-inducible protein YebG	NA	NA	NA	NA	NA
AUJ91592.1|2877001_2878180_+	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
2877688:2877703	attL	CTACCGTGAATCCTGG	NA	NA	NA	NA
AUJ91593.1|2878235_2878877_-	KHG/KDPG aldolase	NA	NA	NA	NA	NA
AUJ91594.1|2878913_2880725_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AUJ91595.1|2880959_2882435_-	glucose-6-phosphate 1-dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
AUJ91596.1|2882772_2883642_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ91597.1|2883769_2885212_+	pyruvate kinase	NA	NA	NA	NA	NA
AUJ91598.1|2885342_2886314_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AUJ91599.1|2886433_2887756_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
AUJ93689.1|2887771_2888704_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ91600.1|2888782_2889538_+	Mn2+/Zn2+ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
AUJ91601.1|2889534_2890320_+	zinc ABC transporter permease	NA	NA	NA	NA	NA
AUJ91602.1|2890466_2891477_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AUJ91603.1|2891485_2892097_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AUJ93690.1|2892235_2892301_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ91604.1|2892371_2892974_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ91605.1|2892975_2893497_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
AUJ91606.1|2893531_2894272_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUJ91607.1|2894300_2894753_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AUJ91608.1|2894745_2896518_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AUJ91609.1|2896827_2897394_+	hydrolase	NA	NA	NA	NA	NA
AUJ93691.1|2897475_2897592_-	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
AUJ91610.1|2897747_2897996_+	damage-inducible protein DinI	NA	K7PLW4	Enterobacteria_phage	93.9	3.8e-36
AUJ91611.1|2898241_2898832_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
AUJ91612.1|2899015_2899684_+	T3SS effector protein NleG8	NA	B6ETE1	Enterobacteria_phage	40.7	1.1e-37
AUJ91613.1|2900928_2901564_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
AUJ91614.1|2902325_2902595_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	1.9e-44
AUJ91615.1|2903970_2904570_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	97.5	4.1e-108
AUJ91616.1|2904636_2908116_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
AUJ91617.1|2908176_2908848_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	97.3	6.0e-100
AUJ91618.1|2908745_2909489_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	3.4e-144
AUJ91619.1|2909493_2910192_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
AUJ91620.1|2910191_2910521_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AUJ91621.1|2913058_2913394_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	78.4	1.3e-26
AUJ91622.1|2913497_2913929_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
AUJ91623.1|2913942_2914695_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	4.6e-133
AUJ91624.1|2915093_2915627_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.2e-58
AUJ91625.1|2915642_2915996_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	5.7e-41
AUJ91626.1|2915988_2916372_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
AUJ91627.1|2916422_2917451_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
AUJ91628.1|2917508_2917856_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	6.8e-23
AUJ91629.1|2917892_2919398_-	scaffolding protein	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
AUJ91630.1|2919387_2920980_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
AUJ91631.1|2920976_2921183_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AUJ91632.1|2923063_2923441_-	DNA packaging protein	NA	NA	NA	NA	NA
AUJ91633.1|2923431_2923674_-	hypothetical protein	NA	O64316	Escherichia_phage	73.2	1.3e-09
AUJ91634.1|2923994_2924219_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
AUJ91635.1|2924300_2924615_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ91636.1|2924856_2924997_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ91637.1|2925547_2925661_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
AUJ91638.1|2925881_2926415_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
AUJ91639.1|2926447_2926642_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ91640.1|2926610_2926847_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ91641.1|2927101_2927317_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
AUJ91642.1|2927315_2927462_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ91643.1|2929653_2929782_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ91644.1|2929926_2930193_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ91645.1|2930083_2930515_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
AUJ91646.1|2930965_2931679_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ91647.1|2931813_2932011_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	1.4e-28
AUJ91648.1|2932235_2932790_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	66.9	3.0e-65
AUJ91649.1|2932798_2933158_-	hypothetical protein	NA	V5URS4	Shigella_phage	60.3	7.3e-36
AUJ93692.1|2933157_2933400_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	97.5	1.6e-34
AUJ91650.1|2934807_2935698_-	AAA family ATPase	NA	Q8W641	Enterobacteria_phage	63.3	2.6e-82
AUJ91651.1|2935715_2936609_-	DNA-binding protein	NA	C5IHL2	Burkholderia_virus	45.9	2.1e-60
AUJ91652.1|2936595_2936829_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	50.0	9.5e-13
AUJ91653.1|2936825_2937020_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ91654.1|2937016_2937679_-	hypothetical protein	NA	Q8W643	Enterobacteria_phage	83.2	4.2e-98
AUJ93693.1|2937787_2938495_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	97.4	1.3e-124
AUJ91655.1|2938614_2938908_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ91656.1|2938978_2939251_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	89.6	2.1e-35
AUJ91657.1|2939384_2940074_+	hypothetical protein	NA	A0A1B5FPF4	Escherichia_phage	87.8	8.0e-116
AUJ91658.1|2940218_2940911_+	transcriptional regulator	NA	A0A1B5FPB8	Escherichia_phage	69.2	1.1e-40
AUJ91659.1|2940916_2941117_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ91660.1|2941316_2941676_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	73.1	1.4e-42
AUJ91661.1|2941675_2941891_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	63.4	1.2e-17
AUJ91662.1|2941862_2942081_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	75.0	3.1e-21
AUJ91663.1|2942077_2942470_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	57.9	4.7e-36
AUJ91664.1|2942530_2942719_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ91665.1|2943087_2943459_+	hypothetical protein	NA	Q8W655	Enterobacteria_phage	98.4	3.8e-64
AUJ91666.1|2943490_2943733_+	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	92.5	2.4e-35
AUJ91667.1|2943736_2943883_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	3.1e-22
AUJ91668.1|2943891_2944128_+	excisionase	NA	Q8W657	Enterobacteria_phage	98.7	8.4e-41
AUJ91669.1|2944183_2945497_+|integrase	integrase	integrase	Q8W658	Enterobacteria_phage	97.0	2.8e-250
AUJ91670.1|2945478_2946249_+	hypothetical protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
AUJ91671.1|2946301_2946697_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ91672.1|2946737_2947481_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
AUJ91673.1|2947477_2948449_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AUJ91674.1|2948613_2951043_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
AUJ91675.1|2951067_2952168_-	cytochrome C	NA	NA	NA	NA	NA
2951522:2951537	attR	CCAGGATTCACGGTAG	NA	NA	NA	NA
AUJ91676.1|2952555_2953302_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AUJ91677.1|2953315_2953882_-	VOC family protein	NA	NA	NA	NA	NA
AUJ91678.1|2954097_2955831_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 11
CP024155	Escherichia coli strain 14EC047 chromosome, complete genome	5060393	3036943	3088301	5060393	terminase,transposase,head,tail,integrase,lysis	Stx2-converting_phage(29.27%)	56	3070220:3070240	3096791:3096811
AUJ91766.1|3036943_3037213_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	96.6	3.5e-43
AUJ93696.1|3038589_3039213_-	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	1.9e-68
AUJ91767.1|3043446_3043653_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ91768.1|3044934_3045633_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	1.5e-130
AUJ91769.1|3045632_3045974_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
AUJ91770.1|3049335_3049845_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	9.4e-13
AUJ91771.1|3049750_3049957_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ91772.1|3049971_3050253_-|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
AUJ91773.1|3050276_3050651_-|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
AUJ91774.1|3050656_3051373_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
AUJ91775.1|3051439_3051784_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AUJ91776.1|3051780_3052227_-	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AUJ91777.1|3052223_3052574_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AUJ91778.1|3052583_3052910_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
AUJ91779.1|3057699_3059361_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
AUJ91780.1|3059357_3059921_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	91.4	2.2e-79
AUJ91781.1|3060209_3060575_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
AUJ91782.1|3060616_3060844_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
AUJ91783.1|3061212_3061437_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ91784.1|3061433_3061928_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	100.0	1.7e-83
AUJ91785.1|3062226_3062760_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	3.6e-100
AUJ93697.1|3062810_3063155_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
AUJ91786.1|3063666_3065517_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
AUJ91787.1|3066088_3066520_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	95.8	2.1e-66
AUJ91788.1|3066826_3067201_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUJ91789.1|3067261_3067522_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUJ91790.1|3067629_3068694_-	DNA adenine methylase	NA	Q8W637	Enterobacteria_phage	90.8	2.0e-190
AUJ91791.1|3068844_3069042_-	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
AUJ91792.1|3069269_3070091_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
AUJ91793.1|3070087_3070462_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	3.2e-34
3070220:3070240	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
AUJ91794.1|3070474_3071524_-	hypothetical protein	NA	U5P0K4	Shigella_phage	53.4	6.1e-107
AUJ91795.1|3071970_3072183_-	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	2.0e-25
AUJ91796.1|3072369_3072474_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ91797.1|3072583_3073147_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	93.9	2.9e-47
AUJ91798.1|3073273_3073585_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
AUJ91799.1|3073571_3073769_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	45.3	2.3e-07
AUJ91800.1|3073765_3074122_-	eae-like protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
AUJ91801.1|3074118_3074343_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
AUJ91802.1|3074364_3075063_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.1	4.7e-71
AUJ91803.1|3075097_3075760_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	95.4	2.3e-83
AUJ91804.1|3076446_3076647_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ91805.1|3076657_3077083_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUJ91806.1|3077079_3077307_-	cell division protein	NA	NA	NA	NA	NA
AUJ91807.1|3077401_3078049_+	XRE family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.9e-06
AUJ91808.1|3078324_3078477_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
AUJ91809.1|3078966_3079155_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AUJ91810.1|3079151_3079343_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUJ91811.1|3079435_3081907_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.0	2.5e-58
AUJ91812.1|3081968_3082238_+	excisionase	NA	NA	NA	NA	NA
AUJ91813.1|3082206_3083325_+|integrase	integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
AUJ91814.1|3083491_3084286_+	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AUJ91815.1|3084282_3085329_+	spermidine/putrescine-binding periplasmic protein	NA	NA	NA	NA	NA
AUJ91816.1|3085386_3085803_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ91817.1|3085884_3086310_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AUJ91818.1|3086360_3086657_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	63.3	2.2e-30
AUJ91819.1|3086687_3088301_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	2.6e-181
3096791:3096811	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 12
CP024155	Escherichia coli strain 14EC047 chromosome, complete genome	5060393	3453934	3500468	5060393	terminase,capsid,head,tail,integrase,holin,portal,lysis	Enterobacteria_phage(58.82%)	62	3467376:3467391	3511013:3511028
AUJ93715.1|3453934_3454096_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
AUJ92155.1|3454591_3455584_-	peptidase M85	NA	NA	NA	NA	NA
AUJ92156.1|3455644_3456625_-	non-LEE encoded effector protein NleB	NA	Q8HAB2	Salmonella_phage	49.5	2.5e-86
AUJ92157.1|3456801_3457071_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	5.4e-44
AUJ92158.1|3458449_3459049_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	97.0	6.3e-109
AUJ92159.1|3462573_3463245_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.8	2.2e-102
AUJ92160.1|3463890_3464589_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	8.1e-132
AUJ92161.1|3464588_3464918_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AUJ92162.1|3464914_3467494_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.7	0.0e+00
3467376:3467391	attL	GTTTTTCTGGCGTCAG	NA	NA	NA	NA
AUJ92163.1|3467913_3468345_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
AUJ92164.1|3468358_3469111_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	1.4e-126
AUJ92165.1|3469118_3469514_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
AUJ92166.1|3469510_3470044_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.3e-57
AUJ92167.1|3470058_3470412_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.5e-41
AUJ92168.1|3470404_3470788_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
AUJ92169.1|3470839_3471868_-|capsid	major capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.9	2.3e-114
AUJ92170.1|3471925_3472273_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
AUJ92171.1|3472309_3473536_-|tail	phage tail protein	tail	A0A2I6TC87	Escherichia_phage	54.9	1.7e-76
AUJ92172.1|3473514_3473814_-|tail	phage tail protein	tail	E4WL22	Enterobacteria_phage	53.2	5.3e-16
AUJ92173.1|3473803_3475396_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	2.2e-185
AUJ92174.1|3475392_3475599_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AUJ92175.1|3477481_3477991_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AUJ92176.1|3478112_3478280_-	DNA-packaging protein	NA	NA	NA	NA	NA
AUJ92177.1|3478385_3478580_+	hypothetical protein	NA	A0A0K2FIR8	Escherichia_phage	95.2	2.8e-26
AUJ92178.1|3478659_3478800_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ92179.1|3479533_3479971_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.1e-70
AUJ92180.1|3479967_3480465_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	98.2	1.4e-90
AUJ92181.1|3480464_3480680_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AUJ92182.1|3480678_3480840_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ92183.1|3481118_3482969_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
AUJ92184.1|3483511_3484228_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ92185.1|3485142_3485265_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ92186.1|3485602_3486562_+	DUF2219 domain-containing protein	NA	NA	NA	NA	NA
AUJ92187.1|3486773_3487439_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.4	4.4e-127
AUJ92188.1|3487435_3488047_-	recombination protein NinG	NA	Q716C3	Shigella_phage	99.0	1.3e-98
AUJ92189.1|3488039_3488210_-	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	98.2	1.2e-25
AUJ92190.1|3488206_3488389_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
AUJ92191.1|3488385_3488913_-	phage N-6-adenine-methyltransferase	NA	Q8H9Z7	Enterobacteria_phage	99.4	3.6e-100
AUJ92192.1|3488909_3489368_-	recombination protein NinB	NA	Q8H9Z8	Enterobacteria_phage	100.0	4.3e-81
AUJ92193.1|3489423_3489714_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
AUJ92194.1|3489710_3490412_-	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	98.3	9.3e-128
AUJ92195.1|3491341_3491620_-	hypothetical protein	NA	K7P7A2	Enterobacteria_phage	100.0	1.6e-43
AUJ92196.1|3491728_3491914_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
AUJ92197.1|3491994_3492645_+	LexA family transcriptional repressor	NA	K7PM82	Enterobacteria_phage	98.6	4.1e-122
AUJ92198.1|3492958_3493231_+	hypothetical protein	NA	K7PH69	Enterobacterial_phage	95.6	1.1e-25
AUJ92199.1|3493289_3493760_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
AUJ92200.1|3493910_3494279_+	DUF2528 domain-containing protein	NA	M1FPD2	Enterobacteria_phage	98.4	2.2e-64
AUJ92201.1|3494358_3494628_+	host cell division inhibitory peptide Kil	NA	M1FN78	Enterobacteria_phage	98.9	3.0e-42
AUJ92202.1|3494582_3494735_+	host-nuclease inhibitor protein Gam	NA	Q08J51	Stx2-converting_phage	94.0	5.8e-19
AUJ92203.1|3494703_3495000_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	1.1e-48
AUJ92204.1|3495005_3495791_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AUJ92205.1|3495787_3496468_+	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.3	7.4e-130
AUJ92206.1|3496464_3496623_+	DUF1317 domain-containing protein	NA	M1FJ61	Enterobacteria_phage	98.1	4.0e-23
AUJ92207.1|3496619_3497372_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	99.6	1.9e-150
AUJ92208.1|3497379_3497595_+	cell division protein ZapA	NA	M1FPM2	Enterobacteria_phage	97.2	8.5e-32
AUJ92209.1|3497693_3497915_+	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
AUJ92210.1|3498125_3498680_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ92211.1|3498570_3498822_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ92212.1|3498876_3499062_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ92213.1|3498994_3499162_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
AUJ92214.1|3499201_3499420_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AUJ92215.1|3499397_3500468_+|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
3511013:3511028	attR	GTTTTTCTGGCGTCAG	NA	NA	NA	NA
>prophage 13
CP024155	Escherichia coli strain 14EC047 chromosome, complete genome	5060393	4363615	4411094	5060393	transposase,integrase	Enterobacteria_phage(41.67%)	31	4377856:4377872	4419535:4419551
AUJ92964.1|4363615_4364888_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.7	1.8e-174
AUJ93751.1|4365291_4365513_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	65.2	1.6e-17
AUJ92965.1|4365728_4366985_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
AUJ92966.1|4366997_4367285_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
AUJ92967.1|4367300_4367744_-	PTS mannitol transporter subunit IIA	NA	NA	NA	NA	NA
AUJ92968.1|4368014_4369046_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	8.0e-19
AUJ93752.1|4369572_4370379_-	maturase	NA	NA	NA	NA	NA
AUJ93753.1|4370396_4370831_-	reverse transcriptase/maturase	NA	NA	NA	NA	NA
AUJ92969.1|4371865_4372057_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ92970.1|4372274_4372619_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ92971.1|4374342_4375260_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
AUJ92972.1|4375271_4376468_-	CoA transferase	NA	NA	NA	NA	NA
AUJ92973.1|4376704_4378618_+	RNA polymerase subunit sigma-54	NA	NA	NA	NA	NA
4377856:4377872	attL	TCCGGAAACCCTGCTGG	NA	NA	NA	NA
AUJ92974.1|4380206_4381820_-|transposase	IS66 family transposase ISEc23	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AUJ92975.1|4381850_4382201_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AUJ92976.1|4382197_4382623_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AUJ92977.1|4383297_4384510_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
AUJ92978.1|4384919_4385246_+|transposase	IS3 family transposase	transposase	Q6H9S4	Enterobacteria_phage	97.2	7.0e-54
AUJ92979.1|4385242_4386178_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	96.1	3.7e-156
AUJ92980.1|4386917_4387307_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ92981.1|4387557_4387920_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
AUJ92982.1|4390889_4395404_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
AUJ92983.1|4395403_4396138_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ92984.1|4396124_4399268_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ92985.1|4399270_4400170_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ92986.1|4400169_4402620_-	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	25.5	7.7e-20
AUJ93754.1|4402632_4405413_-	helicase SNF2	NA	A0A2H4J643	uncultured_Caudovirales_phage	43.0	2.6e-08
AUJ92987.1|4406005_4407139_-	DGQHR domain-containing protein	NA	NA	NA	NA	NA
AUJ93755.1|4408458_4409352_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ92988.1|4409513_4409747_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ92989.1|4409849_4411094_-|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	42.2	1.1e-83
4419535:4419551	attR	TCCGGAAACCCTGCTGG	NA	NA	NA	NA
>prophage 1
CP024157	Escherichia coli strain 14EC047 plasmid p14EC047b, complete sequence	88736	35327	63324	88736	protease,integrase,transposase	Salmonella_phage(40.0%)	28	40092:40106	63374:63388
AUJ93860.1|35327_35981_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUJ93861.1|36200_36665_+	mRNA interferase PemK	NA	NA	NA	NA	NA
40092:40106	attL	TTTGCAACAGTGCCA	NA	NA	NA	NA
AUJ93920.1|40125_40365_+	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
AUJ93862.1|40510_41374_+	short-chain dehydrogenase/reductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
AUJ93863.1|41411_41657_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ93921.1|41807_42035_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ93864.1|42125_42917_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
AUJ93865.1|43771_43957_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ93866.1|44096_44429_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
AUJ93867.1|44598_45390_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AUJ93868.1|45482_46742_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
AUJ93869.1|47003_47795_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AUJ93870.1|48202_48700_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AUJ93871.1|48844_49858_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
AUJ93872.1|49796_50411_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AUJ93873.1|50586_51147_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
AUJ93874.1|51150_54117_+|transposase	Tn3 family transposase TnAs1	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
AUJ93875.1|54174_54417_+	relaxase	NA	NA	NA	NA	NA
AUJ93876.1|54448_55102_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ93877.1|55180_56380_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AUJ93878.1|56646_56952_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ93879.1|56979_58194_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
AUJ93880.1|58410_59295_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AUJ93881.1|59325_60819_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AUJ93882.1|61029_61254_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ93883.1|61250_61988_-	resolvase	NA	NA	NA	NA	NA
AUJ93884.1|62094_62586_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ93885.1|62619_63324_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
63374:63388	attR	TTTGCAACAGTGCCA	NA	NA	NA	NA
>prophage 1
CP024158	Escherichia coli strain 14EC047 plasmid p14EC047c, complete sequence	106324	0	69875	106324	integrase,protease,transposase	Escherichia_phage(29.41%)	48	10936:10954	84402:84420
AUJ93924.1|169_1168_+	hypothetical protein	NA	H6WZH1	Escherichia_phage	100.0	4.1e-153
AUJ93925.1|1176_1455_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	34.2	8.8e-05
AUJ93926.1|4778_5654_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
AUJ93927.1|9123_10347_+	type II secretion system protein GspF	NA	NA	NA	NA	NA
10936:10954	attL	TCTGCAGGCGCAGCTGGAT	NA	NA	NA	NA
AUJ93984.1|11372_11720_+	type II secretion system protein GspI	NA	NA	NA	NA	NA
AUJ93928.1|13324_14497_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
AUJ93929.1|14483_14999_+	type II secretion system protein M	NA	NA	NA	NA	NA
AUJ93930.1|15976_16378_+	lipoprotein, PulS/OutS family	NA	NA	NA	NA	NA
AUJ93931.1|17946_18030_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	9.4e-08
AUJ93932.1|17995_19209_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
AUJ93933.1|19745_19934_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ93934.1|20139_20391_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AUJ93935.1|20387_20675_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	5.8e-20
AUJ93936.1|20950_22164_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.3	1.4e-163
AUJ93985.1|22949_26693_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	38.9	6.1e-218
AUJ93937.1|26927_28466_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	1.3e-294
AUJ93938.1|28514_28862_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AUJ93939.1|33145_33562_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AUJ93940.1|33558_33789_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AUJ93941.1|34392_34743_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ93942.1|34786_35476_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ93943.1|35472_36264_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
AUJ93944.1|36414_36795_+	colicin transporter	NA	NA	NA	NA	NA
AUJ93945.1|36844_37660_-	colicin	NA	NA	NA	NA	NA
AUJ93946.1|37903_38431_+	colicin-B	NA	NA	NA	NA	NA
AUJ93947.1|38788_39070_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ93948.1|40770_41001_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ93949.1|41096_41408_+	colicin V	NA	NA	NA	NA	NA
AUJ93950.1|46602_46809_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ93951.1|46958_47222_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ93952.1|47587_47977_-|protease	outer membrane protease	protease	NA	NA	NA	NA
AUJ93953.1|49122_49407_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ93954.1|49465_50575_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
AUJ93955.1|50637_51546_+	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
AUJ93956.1|51919_52108_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AUJ93957.1|52228_52969_+	recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
AUJ93958.1|53253_54231_-	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
AUJ93959.1|54552_54933_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ93960.1|56894_57086_+	prephenate dehydratase	NA	NA	NA	NA	NA
AUJ93961.1|58120_58948_+	manganese/iron transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
AUJ93962.1|59797_60655_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AUJ93963.1|61667_61862_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ93964.1|61937_62417_-	peptidase M14	NA	NA	NA	NA	NA
AUJ93965.1|62534_62984_+	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	67.1	5.0e-42
AUJ93966.1|63608_65111_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ93967.1|66261_67428_+	protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
AUJ93968.1|67427_68399_+	plasmid-partitioning protein	NA	I3WF22	Macacine_betaherpesvirus	99.1	5.9e-173
AUJ93969.1|68662_69875_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.0e-166
84402:84420	attR	TCTGCAGGCGCAGCTGGAT	NA	NA	NA	NA
>prophage 2
CP024158	Escherichia coli strain 14EC047 plasmid p14EC047c, complete sequence	106324	81024	86212	106324		Stx2-converting_phage(66.67%)	7	NA	NA
AUJ93971.1|81024_81771_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
AUJ93972.1|82800_83352_+	conjugal transfer protein	NA	NA	NA	NA	NA
AUJ93973.1|83511_83892_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
AUJ93974.1|83888_84236_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AUJ93975.1|84285_85425_+	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	99.4	2.9e-203
AUJ93976.1|85439_85865_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AUJ93977.1|85861_86212_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	6.9e-39
>prophage 3
CP024158	Escherichia coli strain 14EC047 plasmid p14EC047c, complete sequence	106324	97148	98474	106324		Escherichia_phage(100.0%)	1	NA	NA
AUJ93981.1|97148_98474_-	hypothetical protein	NA	H6WZN2	Escherichia_phage	84.1	5.5e-222
>prophage 4
CP024158	Escherichia coli strain 14EC047 plasmid p14EC047c, complete sequence	106324	102024	103238	106324	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
AUJ93983.1|102024_103238_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.0e-166
