The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024138	Escherichia coli strain 14EC020 chromosome, complete genome	4914884	55432	131190	4914884	integrase,transposase	Stx2-converting_phage(27.27%)	57	66463:66477	131307:131321
AUK04414.1|55432_56706_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	2.8e-175
AUK04415.1|56854_58903_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	33.5	1.1e-11
AUK04416.1|61463_61655_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
AUK04417.1|62633_63200_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AUK04418.1|63457_64030_+	hypothetical protein	NA	NA	NA	NA	NA
AUK04419.1|64098_64335_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AUK04420.1|64600_65149_+	hypothetical protein	NA	NA	NA	NA	NA
AUK04421.1|65167_65647_-	proQ/FINO family protein	NA	Q2A0A1	Sodalis_phage	42.5	3.5e-09
66463:66477	attL	GAAAAATGTGATACA	NA	NA	NA	NA
AUK04422.1|66546_66981_+	DNA-binding protein	NA	NA	NA	NA	NA
AUK04423.1|69446_70331_+	hemolysin E	NA	NA	NA	NA	NA
AUK04424.1|71570_72092_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AUK04425.1|72088_73042_+	protein FecR	NA	NA	NA	NA	NA
AUK04426.1|73128_75453_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUK04427.1|75497_76400_+	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AUK04428.1|76396_77395_+	iron-dicitrate transporter permease subunit	NA	NA	NA	NA	NA
AUK04429.1|77391_78348_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AUK04430.1|78348_79116_+	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AUK04431.1|79673_80087_-	hypothetical protein	NA	NA	NA	NA	NA
AUK04432.1|80928_82080_-|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AUK04433.1|84066_84414_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	4.4e-46
AUK04434.1|84413_85064_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	42.7	3.4e-15
AUK04435.1|85145_85325_-	hypothetical protein	NA	NA	NA	NA	NA
AUK04436.1|85355_86720_-	phosphoglycerate transporter PgtP	NA	NA	NA	NA	NA
AUK04437.1|87064_88336_+	phosphoglycerate transport regulator PgtC	NA	NA	NA	NA	NA
AUK04438.1|88332_90342_+	two-component system sensor histidine kinase PgtB	NA	NA	NA	NA	NA
AUK08860.1|90331_91579_+	two-component system response regulator PgtA	NA	NA	NA	NA	NA
AUK04439.1|91707_92235_+	hypothetical protein	NA	NA	NA	NA	NA
AUK08861.1|92252_92501_-	osmoprotectant transport activator ProQ	NA	Q2A0A1	Sodalis_phage	39.1	6.4e-07
AUK04440.1|92569_92761_-	osmoprotectant transport activator ProQ	NA	NA	NA	NA	NA
AUK04441.1|93356_94376_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	4.3e-17
AUK08862.1|94633_95077_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
AUK04442.1|95155_95428_+	PTS mannitol transporter subunit IIB	NA	NA	NA	NA	NA
AUK04443.1|95450_96839_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
AUK04444.1|96835_97666_+	transketolase	NA	NA	NA	NA	NA
AUK04445.1|97658_98612_+	transketolase	NA	NA	NA	NA	NA
AUK04446.1|99191_99389_-	hypothetical protein	NA	NA	NA	NA	NA
AUK04447.1|99838_100999_+	immunoglobulin-binding protein	NA	Q9MCI8	Enterobacteria_phage	76.1	4.8e-20
AUK08863.1|101291_101516_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AUK04448.1|101872_102211_-	lysozyme inhibitor	NA	NA	NA	NA	NA
AUK04449.1|102715_103405_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
AUK04450.1|104953_105700_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AUK04451.1|105714_107256_-|transposase	IS21 family transposase ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AUK04452.1|107370_107586_-	hypothetical protein	NA	NA	NA	NA	NA
AUK04453.1|107712_108537_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AUK04454.1|108693_110037_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
AUK04455.1|110156_111430_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AUK04456.1|112867_114184_-	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
AUK04457.1|116527_118498_+	ligand-gated channel	NA	NA	NA	NA	NA
AUK04458.1|118516_119308_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
AUK04459.1|119552_119726_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUK08864.1|119887_120268_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
AUK04460.1|120264_120612_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	4.8e-61
AUK04461.1|120707_122300_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	1.9e-181
AUK04462.1|122330_122681_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.2e-40
AUK04463.1|122677_123103_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AUK04464.1|125315_128813_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.8	2.7e-98
AUK04465.1|130005_131190_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	69.9	2.6e-162
131307:131321	attR	TGTATCACATTTTTC	NA	NA	NA	NA
>prophage 2
CP024138	Escherichia coli strain 14EC020 chromosome, complete genome	4914884	1155681	1162821	4914884		Escherichia_phage(83.33%)	6	NA	NA
AUK05411.1|1155681_1156320_-	class II aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.8e-82
AUK05412.1|1156316_1157579_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AUK05413.1|1157575_1158484_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
AUK05414.1|1158679_1159447_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	7.4e-70
AUK05415.1|1159497_1160154_-	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	4.3e-50
AUK05416.1|1160259_1162821_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	7.8e-31
>prophage 3
CP024138	Escherichia coli strain 14EC020 chromosome, complete genome	4914884	1526282	1583616	4914884	integrase,portal,capsid,holin,plate,tail,terminase,transposase,tRNA	Enterobacteria_phage(85.11%)	74	1533176:1533190	1581233:1581247
AUK05745.1|1526282_1528289_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AUK05746.1|1528447_1529668_+	3-oxoacyl-ACP synthase I	NA	NA	NA	NA	NA
AUK08914.1|1529769_1529991_-	hypothetical protein	NA	NA	NA	NA	NA
AUK05747.1|1529932_1531111_+	arabinose transporter	NA	NA	NA	NA	NA
AUK05748.1|1531107_1532103_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AUK05749.1|1532360_1533254_-	type VI secretion protein	NA	NA	NA	NA	NA
1533176:1533190	attL	TATGTTCAGTTGCTG	NA	NA	NA	NA
AUK05750.1|1533258_1533591_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AUK05751.1|1534103_1534931_-	hypothetical protein	NA	NA	NA	NA	NA
AUK05752.1|1535346_1535487_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
AUK05753.1|1535492_1535681_+	hypothetical protein	NA	Q7Y2U2	Escherichia_phage	61.9	5.3e-06
AUK05754.1|1535677_1535938_-	hypothetical protein	NA	NA	NA	NA	NA
AUK05755.1|1535980_1537090_-	late control protein	NA	A0A0A7NQ97	Enterobacteria_phage	93.8	5.3e-194
AUK05756.1|1537247_1538432_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	4.7e-225
AUK05757.1|1538431_1538944_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
AUK05758.1|1538998_1539364_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
AUK05759.1|1539291_1539528_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	8.7e-22
AUK05760.1|1539514_1542322_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	93.4	0.0e+00
AUK05761.1|1542328_1542823_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	97.0	3.1e-85
AUK05762.1|1543011_1543557_+	transferase	NA	NA	NA	NA	NA
AUK05763.1|1543520_1544138_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	80.9	6.6e-85
AUK05764.1|1544137_1546138_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	98.6	1.8e-112
AUK05765.1|1546140_1546671_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	5.1e-94
AUK05766.1|1546663_1547560_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.1e-154
AUK05767.1|1547563_1547914_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
AUK05768.1|1547910_1548492_-|plate	baseplate assembly protein	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	7.3e-102
AUK05769.1|1548488_1549124_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	97.6	2.9e-112
AUK05770.1|1549116_1549584_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.7	1.3e-85
AUK08915.1|1549570_1549750_-	hypothetical protein	NA	NA	NA	NA	NA
AUK05771.1|1549721_1550129_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.1	4.6e-63
AUK05772.1|1550125_1550518_-	peptidase M15	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.3e-70
AUK05773.1|1550514_1550838_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
AUK05774.1|1550840_1551041_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
AUK05775.1|1551040_1551535_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	98.2	4.6e-89
AUK05776.1|1551637_1552438_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.0	4.2e-124
AUK05777.1|1552483_1553536_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	96.9	2.1e-192
AUK05778.1|1553559_1554396_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	3.0e-149
AUK05779.1|1554550_1556302_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
AUK05780.1|1556301_1557348_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
AUK05781.1|1557623_1557803_-	hypothetical protein	NA	A0A0A7NQ80	Enterobacteria_phage	96.2	5.4e-08
AUK08916.1|1557732_1557984_+	hypothetical protein	NA	NA	NA	NA	NA
AUK05782.1|1557874_1558405_+	hypothetical protein	NA	NA	NA	NA	NA
AUK05783.1|1558495_1558879_-	hypothetical protein	NA	Q5G8U8	Enterobacteria_phage	57.9	2.6e-31
AUK05784.1|1558942_1559254_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	96.1	2.2e-49
AUK05785.1|1559258_1560218_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	100.0	2.0e-181
AUK08917.1|1560294_1562979_-	replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	96.3	0.0e+00
AUK05786.1|1563123_1563489_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
AUK05787.1|1563561_1563792_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	96.1	2.6e-31
AUK05788.1|1563848_1564064_+	hypothetical protein	NA	NA	NA	NA	NA
AUK05789.1|1564114_1564414_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.8	1.8e-40
AUK05790.1|1564410_1564656_-	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	97.5	1.3e-39
AUK05791.1|1564652_1564856_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
AUK05792.1|1565052_1565295_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AUK05793.1|1565306_1565594_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	3.9e-32
AUK05794.1|1565604_1565946_-	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	2.3e-55
AUK05795.1|1566198_1566405_-	hypothetical protein	NA	NA	NA	NA	NA
AUK05796.1|1566411_1566699_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
AUK08918.1|1566812_1567133_+	XRE family transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
AUK05797.1|1567229_1568234_+|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	4.5e-99
AUK05798.1|1568392_1569550_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	8.7e-22
AUK05799.1|1569615_1570629_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUK05800.1|1570628_1571441_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AUK05801.1|1571523_1572183_+	hypothetical protein	NA	NA	NA	NA	NA
AUK05802.1|1572338_1573253_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
AUK05803.1|1573322_1574591_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AUK05804.1|1574580_1575231_+	cell division protein DedD	NA	NA	NA	NA	NA
AUK05805.1|1575489_1575978_+	colicin V production protein	NA	NA	NA	NA	NA
AUK05806.1|1576014_1577532_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
AUK05807.1|1577626_1578196_+	3-octaprenyl-4-hydroxybenzoate carboxy-lyase partner protein	NA	NA	NA	NA	NA
AUK05808.1|1578461_1579244_+	lysine/arginine/ornithine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUK05809.1|1579464_1580247_+	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
AUK05810.1|1580336_1581023_+	histidine ABC transporter permease	NA	NA	NA	NA	NA
AUK05811.1|1581019_1581736_+	histidine ABC transporter permease HisM	NA	NA	NA	NA	NA
1581233:1581247	attR	TATGTTCAGTTGCTG	NA	NA	NA	NA
AUK05812.1|1581743_1582517_+	histidine transport ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
AUK05813.1|1582713_1583616_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	44.2	1.8e-67
>prophage 4
CP024138	Escherichia coli strain 14EC020 chromosome, complete genome	4914884	1777487	1786932	4914884		Enterobacteria_phage(85.71%)	10	NA	NA
AUK05988.1|1777487_1778414_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
AUK05989.1|1778418_1779150_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AUK05990.1|1779130_1779238_-	hypothetical protein	NA	NA	NA	NA	NA
AUK05991.1|1779297_1780029_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AUK05992.1|1780250_1781936_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AUK05993.1|1781932_1782652_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUK05994.1|1782698_1783169_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AUK05995.1|1783209_1783671_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AUK05996.1|1783828_1785799_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.5	0.0e+00
AUK05997.1|1785795_1786932_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	3.6e-161
>prophage 5
CP024138	Escherichia coli strain 14EC020 chromosome, complete genome	4914884	2003658	2076484	4914884	integrase,portal,protease,capsid,holin,head,tail,terminase	Escherichia_phage(34.69%)	89	2065880:2065897	2081574:2081591
AUK06159.1|2003658_2004921_-|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.8	2.6e-72
AUK08926.1|2005258_2006056_-	protein MtfA	NA	NA	NA	NA	NA
AUK06160.1|2006291_2007317_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	57.6	5.8e-102
AUK06161.1|2007316_2007520_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AUK06162.1|2007578_2010050_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	3.2e-58
AUK06163.1|2010142_2010334_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUK06164.1|2010330_2010519_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AUK06165.1|2011087_2011306_-	hypothetical protein	NA	NA	NA	NA	NA
AUK06166.1|2011335_2011506_-	hypothetical protein	NA	NA	NA	NA	NA
AUK08927.1|2011465_2011621_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AUK06167.1|2011918_2012338_-	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
AUK06168.1|2012417_2012672_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
AUK06169.1|2012668_2013094_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUK06170.1|2013165_2014236_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.2	1.9e-63
AUK06171.1|2014276_2014702_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	93.3	4.1e-62
AUK06172.1|2014876_2015542_+	hypothetical protein	NA	NA	NA	NA	NA
AUK06173.1|2015722_2015935_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
AUK06174.1|2016102_2016381_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
AUK06175.1|2016382_2017441_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	48.9	3.1e-90
AUK06176.1|2017441_2017807_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	3.2e-39
AUK06177.1|2017803_2018493_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.6	1.8e-59
AUK06178.1|2018523_2018646_+	antiterminator	NA	NA	NA	NA	NA
AUK06179.1|2019305_2019521_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
AUK06180.1|2019525_2019876_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	92.9	5.4e-36
AUK06181.1|2019939_2020473_+	lysozyme	NA	Q08J98	Stx2-converting_phage	91.5	3.8e-97
AUK06182.1|2020689_2020872_+	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	75.0	2.7e-15
AUK06183.1|2020976_2021327_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	90.4	1.9e-57
AUK06184.1|2021462_2021978_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	48.8	6.3e-33
AUK06185.1|2022206_2022689_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	96.9	7.4e-84
AUK06186.1|2022688_2024446_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	98.9	0.0e+00
AUK06187.1|2024593_2025820_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.8	4.1e-203
AUK06188.1|2025812_2026412_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
AUK06189.1|2026426_2027644_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	67.4	6.1e-151
AUK06190.1|2027720_2028038_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
AUK06191.1|2028046_2028385_+|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
AUK06192.1|2028381_2028831_+	hypothetical protein	NA	S4TR46	Salmonella_phage	80.5	1.0e-63
AUK06193.1|2028827_2029172_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
AUK06194.1|2029232_2029937_+|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	94.4	3.7e-116
AUK06195.1|2029936_2030323_+|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
AUK08928.1|2030364_2030625_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	1.6e-40
AUK06196.1|2030671_2033899_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.9	0.0e+00
AUK06197.1|2033876_2034233_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
AUK06198.1|2034232_2034931_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	95.7	1.1e-128
AUK06199.1|2034936_2035680_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	4.1e-150
AUK06200.1|2035577_2036225_+|tail	phage tail protein	tail	A5LH42	Enterobacteria_phage	98.1	7.8e-113
AUK06201.1|2036285_2039984_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	74.8	0.0e+00
AUK06202.1|2040051_2040651_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	4.2e-105
AUK06203.1|2040715_2042782_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	66.9	8.4e-161
AUK06204.1|2042778_2043057_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	7.9e-22
AUK06205.1|2043066_2043357_+	hypothetical protein	NA	NA	NA	NA	NA
AUK06206.1|2043856_2044570_+	toxin	NA	A5LH52	Enterobacteria_phage	100.0	2.9e-137
AUK06207.1|2044566_2045388_+	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	100.0	1.5e-153
AUK06208.1|2045384_2045957_+	toxin	NA	A5LH54	Enterobacteria_phage	98.9	5.3e-105
AUK06209.1|2046661_2046991_-	hypothetical protein	NA	NA	NA	NA	NA
AUK06210.1|2047026_2047677_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
AUK06211.1|2047933_2048569_-	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AUK06212.1|2048569_2049574_-	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AUK06213.1|2049682_2050096_-	5-hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AUK08929.1|2050228_2050900_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	1.4e-32
AUK06214.1|2050899_2052258_+	two-component sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	3.0e-05
AUK06215.1|2052365_2053217_-	protein deglycase HchA	NA	NA	NA	NA	NA
AUK06216.1|2053808_2054867_-	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	49.3	6.6e-93
AUK06217.1|2055835_2056531_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
AUK06218.1|2056597_2058016_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.6	1.4e-101
AUK06219.1|2057996_2058467_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.6e-33
AUK06220.1|2058455_2059376_-	EamA family transporter	NA	NA	NA	NA	NA
AUK06221.1|2059548_2060466_+	hypothetical protein	NA	NA	NA	NA	NA
AUK06222.1|2060544_2060727_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AUK08930.1|2060788_2060977_+	hypothetical protein	NA	NA	NA	NA	NA
AUK06223.1|2062588_2063404_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
AUK06224.1|2063702_2063930_-	DUF2525 domain-containing protein	NA	NA	NA	NA	NA
AUK08931.1|2063917_2064106_+	hypothetical protein	NA	NA	NA	NA	NA
AUK06225.1|2064038_2064281_+	DsrB protein	NA	NA	NA	NA	NA
AUK06226.1|2064324_2064948_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AUK06227.1|2065237_2066023_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
2065880:2065897	attL	CATTGCCAGCCCCAGTTT	NA	NA	NA	NA
AUK06228.1|2066031_2066301_-	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
AUK06229.1|2066310_2067048_-	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
AUK06230.1|2067047_2067413_-	flagellar biosynthesis protein FliO	NA	NA	NA	NA	NA
AUK06231.1|2067415_2067829_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AUK06232.1|2067825_2068830_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AUK06233.1|2068834_2069299_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
AUK06234.1|2069403_2070531_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
AUK06235.1|2070527_2070971_-	flagellar protein FliJ	NA	NA	NA	NA	NA
AUK06236.1|2070989_2072363_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
AUK06237.1|2072362_2073049_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AUK06238.1|2073041_2074037_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AUK06239.1|2074029_2075688_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
AUK08932.1|2075902_2076217_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
AUK06240.1|2076304_2076484_-|integrase	integrase	integrase	NA	NA	NA	NA
2081574:2081591	attR	CATTGCCAGCCCCAGTTT	NA	NA	NA	NA
>prophage 6
CP024138	Escherichia coli strain 14EC020 chromosome, complete genome	4914884	2405890	2469588	4914884	integrase,portal,protease,lysis,tail	Enterobacteria_phage(41.67%)	74	2413467:2413482	2442773:2442788
AUK06568.1|2405890_2406712_-|protease	serine protease	protease	NA	NA	NA	NA
AUK06569.1|2406811_2406895_-	hypothetical protein	NA	NA	NA	NA	NA
AUK06570.1|2406987_2407323_-	acid shock protein	NA	NA	NA	NA	NA
AUK06571.1|2407720_2408974_-	MFS transporter	NA	NA	NA	NA	NA
AUK06572.1|2409080_2409974_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUK06573.1|2410108_2411329_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
AUK06574.1|2411453_2412149_+	dethiobiotin synthase	NA	NA	NA	NA	NA
AUK08950.1|2412101_2413394_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2413467:2413482	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
AUK06575.1|2413551_2414166_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	1.1e-28
AUK06576.1|2414208_2415063_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AUK06577.1|2415064_2415682_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AUK06578.1|2418176_2420603_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	3.8e-213
AUK06579.1|2420801_2421107_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AUK08951.1|2421214_2421925_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AUK06580.1|2421927_2422488_-	spermidine acetyltransferase	NA	NA	NA	NA	NA
AUK06581.1|2422522_2422864_-	hypothetical protein	NA	NA	NA	NA	NA
AUK06582.1|2422998_2423325_+	hypothetical protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
AUK06583.1|2423361_2423550_+	hypothetical protein	NA	NA	NA	NA	NA
AUK06584.1|2423530_2424745_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AUK06585.1|2424756_2425776_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	3.3e-17
AUK06586.1|2425833_2425962_+	transporter	NA	NA	NA	NA	NA
AUK06587.1|2425963_2427259_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	1.5e-155
AUK06588.1|2427278_2427530_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	48.7	1.9e-14
AUK06589.1|2427602_2430074_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
AUK06590.1|2430167_2430359_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUK06591.1|2430355_2430544_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AUK06592.1|2430959_2431247_+	hypothetical protein	NA	NA	NA	NA	NA
AUK08952.1|2431215_2431581_-	hypothetical protein	NA	NA	NA	NA	NA
AUK06593.1|2431592_2431745_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
AUK06594.1|2431913_2432321_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
AUK06595.1|2432401_2432629_+	transcriptional regulator	NA	NA	NA	NA	NA
AUK06596.1|2432612_2433134_+	hypothetical protein	NA	NA	NA	NA	NA
AUK06597.1|2433060_2434080_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	3.6e-56
AUK06598.1|2434120_2434522_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	92.5	6.0e-63
AUK06599.1|2435055_2436081_+	hypothetical protein	NA	A0A1B0VBT5	Salmonella_phage	28.2	3.2e-28
AUK06600.1|2436396_2436600_+	hypothetical protein	NA	NA	NA	NA	NA
AUK06601.1|2436758_2436971_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	95.7	3.9e-29
AUK06602.1|2437187_2437439_+	hypothetical protein	NA	NA	NA	NA	NA
AUK06603.1|2437505_2437784_+	hypothetical protein	NA	NA	NA	NA	NA
AUK06604.1|2437785_2438835_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	57.3	1.3e-112
AUK06605.1|2438848_2439601_+	antitermination protein	NA	Q8SBE4	Shigella_phage	95.2	2.5e-131
AUK06606.1|2440276_2440492_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	76.5	7.7e-25
AUK06607.1|2441245_2441461_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AUK06608.1|2441465_2441777_+	hypothetical protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AUK06609.1|2441773_2442307_+	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AUK06610.1|2442303_2442801_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2442773:2442788	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
AUK06611.1|2443164_2443377_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AUK06612.1|2443387_2443576_+	cold-shock protein	NA	NA	NA	NA	NA
AUK08953.1|2443723_2443879_+	hypothetical protein	NA	NA	NA	NA	NA
AUK06613.1|2444374_2444785_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
AUK06614.1|2444985_2445192_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
AUK06615.1|2445745_2446240_+	DUF1441 domain-containing protein	NA	A0A291AWV8	Escherichia_phage	99.4	8.4e-83
AUK06616.1|2446239_2448342_+	DNA packaging protein	NA	K7PH40	Enterobacteria_phage	99.6	0.0e+00
AUK06617.1|2448338_2448551_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AUK06618.1|2448550_2450059_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	2.9e-288
AUK06619.1|2450003_2452031_+	peptidase S14	NA	A5LH30	Enterobacteria_phage	99.7	0.0e+00
AUK06620.1|2452072_2452441_+	DUF2190 domain-containing protein	NA	A5LH31	Enterobacteria_phage	100.0	9.7e-52
AUK06621.1|2452433_2452709_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	97.8	7.2e-44
AUK06622.1|2452720_2453299_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	6.1e-101
AUK08955.1|2453295_2453697_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
AUK06623.1|2453708_2454452_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
AUK08954.1|2454512_2454899_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
AUK06624.1|2454907_2455237_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AUK06625.1|2455208_2458274_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.4	0.0e+00
AUK06626.1|2458273_2458603_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
AUK06627.1|2458612_2459311_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.3e-134
AUK06628.1|2459316_2460060_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	2.4e-150
AUK06629.1|2459957_2460605_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.7	2.3e-112
AUK06630.1|2460665_2464079_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
AUK06631.1|2464148_2464748_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	1.1e-108
AUK06632.1|2464812_2467773_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.9	1.1e-55
AUK06633.1|2467772_2468375_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.3	1.4e-103
AUK06634.1|2468445_2469036_-	DNA invertase	NA	A0A219Y9V9	Aeromonas_phage	35.9	2.1e-24
AUK06635.1|2469354_2469588_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
>prophage 7
CP024138	Escherichia coli strain 14EC020 chromosome, complete genome	4914884	3244003	3299653	4914884	integrase,portal,capsid,lysis,head,holin,tail,transposase,terminase	Enterobacteria_phage(55.38%)	77	3250670:3250686	3307599:3307615
AUK07341.1|3244003_3244585_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	4.7e-101
AUK07342.1|3244584_3247986_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	38.2	8.2e-12
AUK07343.1|3248050_3248650_-	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	4.1e-108
AUK07344.1|3248720_3252218_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	98.2	0.0e+00
3250670:3250686	attL	CGGAAGATGGCAGCGTG	NA	NA	NA	NA
AUK07345.1|3252278_3252920_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.0	6.6e-96
AUK07346.1|3252817_3253561_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	4.3e-147
AUK07347.1|3253566_3254265_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
AUK07348.1|3254264_3254594_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AUK07349.1|3254590_3257152_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	89.4	0.0e+00
AUK07350.1|3257144_3257579_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
AUK07351.1|3257560_3257983_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	2.6e-69
AUK08992.1|3257998_3258739_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	8.9e-129
AUK07352.1|3258746_3259142_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	5.0e-70
AUK07353.1|3259138_3259717_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	96.9	3.9e-79
AUK07354.1|3259728_3260082_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
AUK07355.1|3260093_3260489_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	8.2e-57
AUK07356.1|3261475_3262639_+	DUF262 domain-containing protein	NA	A0A0R6PJX3	Moraxella_phage	28.9	9.6e-21
AUK07357.1|3262643_3263192_+	hypothetical protein	NA	NA	NA	NA	NA
AUK07358.1|3263255_3263450_-	hypothetical protein	NA	NA	NA	NA	NA
AUK07359.1|3263695_3264079_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AUK07360.1|3264090_3264432_-|head	head decoration protein	head	NA	NA	NA	NA
AUK07361.1|3264441_3265482_-|capsid	capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.1	5.7e-65
AUK07362.1|3265699_3266149_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AUK07363.1|3266160_3266403_-	hypothetical protein	NA	NA	NA	NA	NA
AUK07364.1|3266692_3268444_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.6	2.2e-93
AUK07365.1|3268440_3268740_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AUK07366.1|3268757_3268979_-	hypothetical protein	NA	NA	NA	NA	NA
AUK07367.1|3268979_3269171_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	59.3	1.1e-11
AUK07368.1|3269170_3269356_-	hypothetical protein	NA	NA	NA	NA	NA
AUK07369.1|3269348_3269960_-	hypothetical protein	NA	NA	NA	NA	NA
AUK07370.1|3270392_3270929_+	hypothetical protein	NA	NA	NA	NA	NA
AUK07371.1|3270998_3271226_-	hypothetical protein	NA	NA	NA	NA	NA
AUK07372.1|3271227_3272463_-|integrase	integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	44.9	1.1e-99
AUK08993.1|3272595_3272865_-|capsid	capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	100.0	5.3e-39
AUK07373.1|3272926_3273259_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
AUK07374.1|3273268_3274588_-|capsid	capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	98.9	1.4e-233
AUK07375.1|3274568_3276170_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.3	1.4e-307
AUK07376.1|3276166_3276373_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AUK07377.1|3276369_3278295_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
AUK07378.1|3278269_3278815_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AUK07379.1|3279203_3279398_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
AUK07380.1|3279759_3280053_+	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
AUK07381.1|3280084_3280546_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.7	3.5e-75
AUK07382.1|3280542_3281040_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	95.8	7.9e-89
AUK07383.1|3281039_3281255_-|holin	holin	holin	A5LH82	Enterobacteria_phage	100.0	2.6e-33
AUK07384.1|3281827_3282925_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	77.1	6.7e-157
AUK07385.1|3283114_3283498_-	antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
AUK07386.1|3283583_3283724_-	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
AUK07387.1|3283720_3284083_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.8	3.6e-59
AUK07388.1|3284289_3284673_-	protein ninX	NA	Q76H72	Enterobacteria_phage	95.7	6.3e-62
AUK07389.1|3284633_3284810_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
AUK07390.1|3284806_3285334_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
AUK07391.1|3285330_3285789_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.3e-81
AUK07392.1|3285844_3286135_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
AUK07393.1|3286131_3286833_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
AUK07394.1|3286829_3287729_-	Replication protein O	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	1.1e-173
AUK07395.1|3287761_3288055_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
AUK07396.1|3288173_3288374_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
AUK07397.1|3288474_3289188_+	LexA family transcriptional repressor	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
AUK08994.1|3289354_3290173_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	46.2	3.3e-36
AUK08995.1|3290654_3290978_+	antitermination protein	NA	K7P718	Enterobacteria_phage	100.0	1.0e-52
AUK07398.1|3290970_3291465_-	hypothetical protein	NA	K7P861	Enterobacteria_phage	99.4	1.4e-85
AUK07399.1|3291693_3292967_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AUK07400.1|3293057_3293426_+	lambda prophage-derived protein ea10	NA	M1FPD2	Enterobacteria_phage	99.2	7.6e-65
AUK07401.1|3293505_3293775_+	host cell division inhibitory peptide Kil	NA	M1FN78	Enterobacteria_phage	95.5	2.8e-40
AUK07402.1|3293729_3294146_+	Host-nuclease inhibitor protein gam	NA	C6ZCV5	Enterobacteria_phage	98.6	5.1e-73
AUK07403.1|3294151_3294937_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	99.2	4.1e-148
AUK07404.1|3294933_3295614_+	exonuclease	NA	Q6H9Z0	Enterobacteria_phage	100.0	1.2e-132
AUK07405.1|3295610_3295793_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	96.7	2.8e-28
AUK07406.1|3295765_3295957_+	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
AUK07407.1|3295967_3296249_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
AUK07408.1|3296347_3296569_+	conjugal transfer protein TraR	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
AUK07409.1|3296565_3297114_+	hypothetical protein	NA	K7PKY4	Enterobacterial_phage	58.2	7.7e-45
AUK07410.1|3297244_3297943_+	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	81.0	1.6e-100
AUK07411.1|3298179_3298347_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
AUK07412.1|3298386_3298605_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AUK07413.1|3298582_3299653_+|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	1.5e-201
3307599:3307615	attR	CACGCTGCCATCTTCCG	NA	NA	NA	NA
>prophage 8
CP024138	Escherichia coli strain 14EC020 chromosome, complete genome	4914884	4638440	4674633	4914884	integrase,portal,capsid,lysis,holin,head,plate,tail,terminase	Escherichia_phage(42.22%)	47	4638283:4638329	4671845:4671891
4638283:4638329	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
AUK08600.1|4638440_4638695_-	transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AUK08601.1|4638740_4639904_-	hypothetical protein	NA	Q7Y4C6	Escherichia_virus	97.9	6.3e-206
AUK08602.1|4639903_4640383_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	1.1e-84
AUK08603.1|4640397_4642845_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.8	0.0e+00
AUK09056.1|4642837_4642957_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	4.0e-15
AUK08604.1|4642989_4643265_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AUK08605.1|4643321_4643840_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AUK08606.1|4643852_4645043_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
AUK08607.1|4645362_4646262_-	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	99.3	2.0e-167
AUK08608.1|4646477_4647005_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	88.6	5.1e-86
AUK08609.1|4647006_4649028_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	64.6	9.2e-261
AUK08610.1|4649038_4649569_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	98.9	4.3e-101
AUK08611.1|4649561_4650470_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.3	5.7e-162
AUK08612.1|4650474_4650822_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	98.3	3.2e-57
AUK08613.1|4650818_4651454_-|plate	baseplate assembly protein	plate	U5N3F0	Enterobacteria_phage	98.1	3.8e-112
AUK08614.1|4651537_4652323_+	hypothetical protein	NA	NA	NA	NA	NA
AUK08615.1|4652394_4652847_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	5.3e-76
AUK08616.1|4652839_4653307_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	99.4	3.0e-82
AUK08617.1|4653269_4653443_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	1.3e-22
AUK08618.1|4653414_4653840_-	protein lysB	NA	Q858W0	Yersinia_virus	97.2	8.0e-66
AUK08619.1|4653827_4654253_-	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	94.3	1.4e-57
AUK08620.1|4654267_4654765_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	99.4	6.9e-93
AUK08621.1|4654764_4655046_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AUK08622.1|4655049_4655253_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
AUK08623.1|4655252_4655762_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AUK08624.1|4655861_4656605_-|terminase	terminase	terminase	Q858W5	Yersinia_virus	99.6	4.9e-127
AUK08625.1|4656608_4657682_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.4	1.5e-201
AUK08626.1|4657740_4658595_-|capsid	capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
AUK08627.1|4658768_4660541_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
AUK08628.1|4660540_4661575_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.7	4.2e-201
AUK08629.1|4661990_4663064_+	hypothetical protein	NA	Q7Y4B3	Escherichia_virus	100.0	1.2e-203
AUK08630.1|4663056_4664094_+	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	100.0	4.6e-200
AUK08631.1|4664090_4665029_-	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	100.0	3.1e-187
AUK08632.1|4665271_4665478_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	97.0	2.4e-31
AUK08633.1|4665477_4665930_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.7	1.0e-79
AUK08634.1|4665929_4668215_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.2	0.0e+00
AUK08635.1|4668204_4668480_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
AUK08636.1|4668476_4668701_-	hypothetical protein	NA	A0A0F7LDG9	Escherichia_phage	98.6	5.0e-35
AUK08637.1|4668700_4669003_-	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	99.0	2.2e-46
AUK08638.1|4669002_4669227_-	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AUK08639.1|4669290_4669791_-	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
AUK08640.1|4669960_4670233_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
AUK08641.1|4670385_4670679_+	transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
AUK08642.1|4670748_4671729_+|integrase	integrase	integrase	U5N0A8	Enterobacteria_phage	99.7	2.3e-185
AUK09057.1|4671914_4672415_-	periplasmic protein CpxP	NA	NA	NA	NA	NA
4671845:4671891	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
AUK08643.1|4672564_4673263_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AUK08644.1|4673259_4674633_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 1
CP024140	Escherichia coli strain 14EC020 plasmid p14EC020b, complete sequence	166233	17717	55466	166233	integrase,transposase	Escherichia_phage(40.0%)	41	39803:39862	51404:52225
AUK09156.1|17717_18509_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
AUK09157.1|18505_19195_-	hypothetical protein	NA	NA	NA	NA	NA
AUK09158.1|19238_19589_-	hypothetical protein	NA	NA	NA	NA	NA
AUK09159.1|20270_21266_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AUK09160.1|21269_22202_+	hypothetical protein	NA	NA	NA	NA	NA
AUK09161.1|22499_23588_+	transcriptional regulator	NA	NA	NA	NA	NA
AUK09162.1|23589_24459_+	hypothetical protein	NA	NA	NA	NA	NA
AUK09163.1|24515_26081_-	AAA family ATPase	NA	NA	NA	NA	NA
AUK09305.1|26273_26411_+	toxin-antitoxin system, antitoxin component, AbrB family protein	NA	NA	NA	NA	NA
AUK09164.1|26388_26619_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AUK09165.1|26615_27032_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AUK09166.1|27193_29332_-	AAA family ATPase	NA	NA	NA	NA	NA
AUK09167.1|29685_29943_+	hypothetical protein	NA	NA	NA	NA	NA
AUK09168.1|29942_30533_+	hypothetical protein	NA	NA	NA	NA	NA
AUK09169.1|30795_32352_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AUK09170.1|32541_33159_+	proQ/FINO family protein	NA	NA	NA	NA	NA
AUK09171.1|33451_34531_-	permease	NA	NA	NA	NA	NA
AUK09172.1|34635_34959_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUK09173.1|35119_35602_+	hypothetical protein	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.5	2.9e-40
AUK09174.1|35492_36209_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.1e-139
AUK09175.1|37656_38361_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUK09176.1|38900_39716_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
39803:39862	attL	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
AUK09177.1|39866_40571_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUK09178.1|40831_41695_+	short-chain dehydrogenase/reductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
AUK09179.1|41732_41978_+	hypothetical protein	NA	NA	NA	NA	NA
AUK09306.1|42128_42356_+	hypothetical protein	NA	NA	NA	NA	NA
AUK09180.1|42446_43238_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
AUK09181.1|44092_44278_-	hypothetical protein	NA	NA	NA	NA	NA
AUK09182.1|44928_45633_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUK09183.1|45702_46185_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	6.6e-16
AUK09184.1|46331_47231_+|integrase	integrase/recombinase	integrase	A0A1P8DJJ6	Virus_Rctr41k	42.8	9.0e-59
AUK09185.1|47277_47982_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
AUK09186.1|47872_48466_-	resolvase	NA	A0A1B0V7I5	Salmonella_phage	92.7	3.3e-33
AUK09187.1|48591_49206_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AUK09188.1|49144_50158_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUK09307.1|50324_51167_+	putative esterase EstX	NA	NA	NA	NA	NA
AUK09189.1|51467_52172_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUK09190.1|52205_52697_-	hypothetical protein	NA	NA	NA	NA	NA
51404:52225	attR	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCG	NA	NA	NA	NA
AUK09191.1|52803_53541_+	resolvase	NA	NA	NA	NA	NA
AUK09192.1|53537_53762_+	hypothetical protein	NA	NA	NA	NA	NA
AUK09193.1|53972_55466_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP024140	Escherichia coli strain 14EC020 plasmid p14EC020b, complete sequence	166233	65195	113911	166233	protease,transposase	Stx2-converting_phage(33.33%)	55	NA	NA
AUK09204.1|65195_65900_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUK09205.1|65936_67064_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
AUK09206.1|67114_67360_-	hypothetical protein	NA	NA	NA	NA	NA
AUK09207.1|67365_67557_+	hypothetical protein	NA	NA	NA	NA	NA
AUK09208.1|68038_68581_-	tunicamycin resistance protein	NA	NA	NA	NA	NA
AUK09209.1|68593_69454_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AUK09210.1|70550_71255_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AUK09211.1|71313_74313_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
AUK09212.1|74507_74942_+	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AUK09213.1|75337_75802_-	mRNA interferase PemK	NA	NA	NA	NA	NA
AUK09214.1|76021_76675_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUK09215.1|77396_77822_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AUK09216.1|77818_78169_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.2e-40
AUK09217.1|78199_79792_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	1.9e-181
AUK09218.1|79887_80235_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	4.8e-61
AUK09309.1|80231_80612_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
AUK09219.1|80773_80947_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUK09220.1|81388_82246_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AUK09221.1|82238_82733_-	hypothetical protein	NA	NA	NA	NA	NA
AUK09310.1|82713_82788_-	positive regulator of RepFIC repA1 expression	NA	NA	NA	NA	NA
AUK09222.1|82866_82998_+	replication protein RepA	NA	NA	NA	NA	NA
AUK09223.1|83019_83277_-	transcriptional regulator	NA	NA	NA	NA	NA
AUK09311.1|83560_83710_-	Hok/Gef family protein	NA	NA	NA	NA	NA
AUK09224.1|83765_83975_+	hypothetical protein	NA	NA	NA	NA	NA
AUK09225.1|84390_84603_-	hypothetical protein	NA	NA	NA	NA	NA
AUK09226.1|84738_85299_-	conjugal transfer protein	NA	NA	NA	NA	NA
AUK09227.1|85401_86262_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
AUK09228.1|86320_87067_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.7	8.7e-07
AUK09229.1|87086_92357_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
AUK09230.1|92435_92666_+	antitoxin	NA	NA	NA	NA	NA
AUK09231.1|92665_93064_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AUK09232.1|93072_95226_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
AUK09312.1|95478_96213_-	complement resistance protein TraT	NA	NA	NA	NA	NA
AUK09233.1|96241_96739_-	entry exclusion protein	NA	NA	NA	NA	NA
AUK09234.1|96754_99577_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AUK09235.1|99573_100950_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
AUK09236.1|100946_101360_-	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
AUK09237.1|101313_101655_-	protein TrbJ	NA	NA	NA	NA	NA
AUK09238.1|101584_102130_-	protein TrbB	NA	NA	NA	NA	NA
AUK09239.1|102116_102401_-	protein TraQ	NA	NA	NA	NA	NA
AUK09240.1|102481_102796_+	toxin ArtA	NA	NA	NA	NA	NA
AUK09241.1|102797_103145_-	protein TrbA	NA	NA	NA	NA	NA
AUK09242.1|103160_103934_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
AUK09243.1|103896_104157_-	protein TrbE	NA	NA	NA	NA	NA
AUK09244.1|104180_105989_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
AUK09245.1|105985_106624_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
AUK09246.1|106632_107625_-	protein TraU	NA	NA	NA	NA	NA
AUK09247.1|107621_108254_-	protein TraW	NA	NA	NA	NA	NA
AUK09248.1|108250_108637_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
AUK09249.1|108633_111261_-	conjugal transfer protein TraC	NA	NA	NA	NA	NA
AUK09250.1|111420_111642_-	protein TraR	NA	A2I309	Vibrio_virus	40.8	3.3e-07
AUK09251.1|111776_112292_-	type IV conjugative transfer system protein TraV	NA	NA	NA	NA	NA
AUK09252.1|112288_112540_-	protein TrbG	NA	NA	NA	NA	NA
AUK09253.1|112551_112701_-	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
AUK09254.1|112697_113911_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
