The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	262324	268103	5199281	transposase	Stx2-converting_phage(50.0%)	7	NA	NA
AUK09551.1|262324_263005_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
AUK09552.1|262997_264479_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
AUK09553.1|264723_265155_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AUK14119.1|265412_265793_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
AUK09554.1|265789_266137_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AUK09555.1|266186_267725_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	6.0e-297
AUK09556.1|267785_268103_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	7.4e-16
>prophage 2
CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	1068023	1081983	5199281		Escherichia_phage(40.0%)	12	NA	NA
AUK10304.1|1068023_1068785_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
AUK10305.1|1068778_1069405_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AUK10306.1|1069544_1070684_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AUK10307.1|1070746_1071739_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AUK10308.1|1071832_1073197_-	GntP family transporter	NA	NA	NA	NA	NA
AUK10309.1|1073285_1074062_-	hypothetical protein	NA	NA	NA	NA	NA
AUK10310.1|1074066_1074705_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AUK10311.1|1074701_1075964_-	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	61.2	6.3e-135
AUK10312.1|1075960_1076869_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AUK10313.1|1077064_1077832_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
AUK10314.1|1078659_1079316_-	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	45.3	5.6e-50
AUK10315.1|1079421_1081983_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	2.3e-30
>prophage 3
CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	1464071	1558606	5199281	coat,holin,tRNA,transposase,portal,integrase,terminase,lysis,head,tail	Enterobacteria_phage(59.52%)	117	1537392:1537411	1557473:1557492
AUK10643.1|1464071_1465233_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AUK10644.1|1466201_1467137_+	DNA-binding transcriptional regulator DsdC	NA	NA	NA	NA	NA
AUK10645.1|1467320_1467521_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AUK10646.1|1467652_1467832_-	Eag protein	NA	K7PL40	Enterobacteria_phage	100.0	2.5e-29
AUK10647.1|1467928_1468696_-	hypothetical protein	NA	A0A222YWE8	Escherichia_phage	91.7	1.6e-56
AUK10648.1|1468706_1469462_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	93.2	6.5e-143
AUK10649.1|1469463_1469871_-	hypothetical protein	NA	A0A125RPT9	Escherichia_phage	98.5	8.7e-70
AUK10650.1|1469872_1470172_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	99.0	1.3e-57
AUK10651.1|1470168_1470336_-	DUF2737 domain-containing protein	NA	Q716F2	Shigella_phage	96.4	3.6e-22
AUK10652.1|1470352_1470667_-	hypothetical protein	NA	K7P7J8	Enterobacteria_phage	98.1	1.3e-49
AUK10653.1|1470678_1471161_-	hypothetical protein	NA	K7P6T5	Enterobacteria_phage	96.9	3.5e-78
AUK10654.1|1471144_1472056_-	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	99.3	3.7e-169
AUK10655.1|1472052_1472361_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	97.1	4.8e-52
AUK10656.1|1472445_1472721_-	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	96.7	4.2e-44
AUK10657.1|1472810_1473281_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
AUK10658.1|1473359_1473548_-	hypothetical protein	NA	K7PMF8	Enterobacteria_phage	88.6	3.3e-16
AUK10659.1|1473606_1473879_-	antitermination protein N	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
AUK10660.1|1474225_1474921_-	phage repressor	NA	A0A0N7BTS4	Escherichia_phage	96.1	8.3e-129
AUK10661.1|1474996_1475212_+	XRE family transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
AUK10662.1|1475352_1475649_+	hypothetical protein	NA	Q9MCQ0	Enterobacteria_phage	100.0	1.8e-48
AUK10663.1|1475681_1475828_+	hypothetical protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
AUK10664.1|1475820_1476720_+	DNA replication protein	NA	A0A0N7C1Z7	Escherichia_phage	99.3	1.0e-163
AUK10665.1|1476694_1478146_+	helicase DnaB	NA	Q08J37	Stx2-converting_phage	100.0	7.7e-278
AUK10666.1|1478204_1478663_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.6e-80
AUK10667.1|1478659_1479187_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	98.9	1.8e-99
AUK10668.1|1479183_1479360_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
AUK10669.1|1479362_1479722_+	DUF2591 domain-containing protein	NA	K7PH48	Enterobacterial_phage	74.2	2.6e-41
AUK10670.1|1479714_1479891_+	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
AUK10671.1|1479883_1480153_+	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	98.9	9.3e-44
AUK10672.1|1480152_1480443_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
AUK10673.1|1480439_1480802_+	hypothetical protein	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
AUK10674.1|1480798_1480987_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
AUK10675.1|1480983_1481502_+	antiterminator	NA	A0A192Y911	Salmonella_phage	98.8	5.9e-95
AUK10676.1|1481963_1482287_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AUK10677.1|1482270_1482747_+	lysozyme	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
AUK10678.1|1482743_1483181_+|lysis	lysis protein	lysis	Q716B4	Shigella_phage	97.9	5.5e-70
AUK10679.1|1483168_1483321_+	hypothetical protein	NA	K7PHR3	Enterobacteria_phage	96.0	8.1e-21
AUK10680.1|1483524_1484043_+	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	100.0	3.2e-93
AUK10681.1|1484395_1484638_+	hypothetical protein	NA	A0A0M4R322	Salmonella_phage	98.8	1.7e-36
AUK14161.1|1484673_1485162_+	DNA-packaging protein	NA	G8EYI7	Enterobacteria_phage	100.0	1.4e-90
AUK10682.1|1485139_1486636_+|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	93.6	1.8e-282
AUK10683.1|1486635_1488837_+|portal	portal protein	portal	A5VW74	Enterobacteria_phage	96.7	0.0e+00
AUK10684.1|1488927_1489821_+	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	98.7	1.7e-129
AUK10685.1|1489839_1491093_+|coat	coat protein	coat	A5VW72	Enterobacteria_phage	98.3	6.5e-233
AUK10686.1|1491134_1491323_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
AUK10687.1|1491303_1491765_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
AUK10688.1|1491774_1493193_+	hypothetical protein	NA	Q716G7	Shigella_phage	98.7	1.5e-273
AUK10689.1|1493192_1493894_+|tail	phage tail protein	tail	G5DA78	Enterobacteria_phage	97.9	7.4e-117
AUK10690.1|1493893_1494349_+	hypothetical protein	NA	A0A2D1GLX4	Escherichia_phage	100.0	1.8e-87
AUK10691.1|1494351_1495044_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
AUK10692.1|1495053_1496394_+	DNA injection protein	NA	Q9AYZ0	Salmonella_phage	74.4	4.0e-172
AUK10693.1|1496393_1498562_+	DNA transfer protein	NA	Q9AYY9	Salmonella_phage	93.2	0.0e+00
AUK14162.1|1498562_1498892_-	hypothetical protein	NA	Q9AYY8	Salmonella_phage	99.1	1.7e-52
AUK10694.1|1499048_1500035_+	hypothetical protein	NA	A9YX09	Burkholderia_phage	47.6	2.7e-72
AUK10695.1|1500050_1500302_-	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	50.0	7.6e-08
AUK10696.1|1500416_1500569_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AUK10697.1|1500565_1500748_+	hypothetical protein	NA	NA	NA	NA	NA
AUK10698.1|1500810_1501713_+	phage antirepressor Ant	NA	Q0H8C7	Salmonella_phage	97.7	2.2e-169
AUK10699.1|1503863_1505759_-	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	48.3	4.8e-78
AUK10700.1|1505962_1506940_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	40.8	7.0e-57
AUK10701.1|1507066_1507456_+	DNA polymerase V	NA	K7P6F7	Enterobacteria_phage	86.7	7.8e-60
AUK10702.1|1507462_1508620_-|integrase	integrase	integrase	A5VW56	Enterobacteria_phage	99.5	4.1e-221
AUK10703.1|1508931_1509864_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.4	2.3e-166
AUK10704.1|1509961_1510132_+	hypothetical protein	NA	NA	NA	NA	NA
AUK10705.1|1510157_1510913_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AUK10706.1|1512519_1513860_-	long-chain fatty acid transporter	NA	NA	NA	NA	NA
AUK10707.1|1513895_1514147_+	hypothetical protein	NA	NA	NA	NA	NA
AUK10708.1|1514231_1514516_+	hypothetical protein	NA	NA	NA	NA	NA
AUK10709.1|1514696_1516007_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AUK10710.1|1516006_1518151_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AUK10711.1|1518353_1518839_+	phosphohistidine phosphatase	NA	NA	NA	NA	NA
AUK10712.1|1519522_1520086_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AUK10713.1|1522831_1523584_+	fimbrial protein	NA	NA	NA	NA	NA
AUK10714.1|1523600_1524107_+	hypothetical protein	NA	NA	NA	NA	NA
AUK10715.1|1524103_1524583_+	fimbrial protein	NA	NA	NA	NA	NA
AUK10716.1|1524579_1525131_+	fimbrial protein	NA	NA	NA	NA	NA
AUK10717.1|1525132_1525957_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
AUK10718.1|1526082_1526634_-	endonuclease SmrB	NA	NA	NA	NA	NA
AUK10719.1|1526799_1527732_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUK10720.1|1527766_1528852_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
AUK10721.1|1528855_1529680_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AUK10722.1|1529679_1530489_+	hypothetical protein	NA	NA	NA	NA	NA
AUK10723.1|1530488_1531037_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AUK10724.1|1531070_1531349_+	hypothetical protein	NA	NA	NA	NA	NA
AUK10725.1|1531469_1533476_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AUK10726.1|1533634_1534855_+	3-oxoacyl-ACP synthase I	NA	NA	NA	NA	NA
AUK14163.1|1534956_1535178_-	hypothetical protein	NA	NA	NA	NA	NA
AUK10727.1|1535119_1536298_+	MFS transporter	NA	NA	NA	NA	NA
AUK10728.1|1536294_1537290_-	flagella biosynthesis regulator	NA	NA	NA	NA	NA
1537392:1537411	attL	AAAATCCTTGTTGATGAAAA	NA	NA	NA	NA
AUK10729.1|1537557_1538451_-	type VI secretion protein	NA	NA	NA	NA	NA
AUK10730.1|1538455_1538788_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AUK10731.1|1539049_1539190_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
AUK10732.1|1539380_1539641_-	hypothetical protein	NA	NA	NA	NA	NA
AUK10733.1|1539832_1540855_+	hypothetical protein	NA	NA	NA	NA	NA
AUK10734.1|1540975_1542085_-	late control protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	6.3e-195
AUK10735.1|1542242_1543427_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	4.7e-225
AUK10736.1|1543426_1543939_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
AUK10737.1|1543993_1544359_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.9e-55
AUK10738.1|1544286_1544523_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	3.9e-22
AUK10739.1|1544509_1547317_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.9	0.0e+00
AUK10740.1|1547323_1547818_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	2.1e-86
AUK10741.1|1547844_1548444_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	2.6e-86
AUK10742.1|1548515_1548983_+|tail	phage tail protein	tail	Q9MCR6	Enterobacteria_phage	64.8	1.7e-48
AUK10743.1|1549153_1549858_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUK10744.1|1552158_1552524_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.0	2.1e-59
AUK10745.1|1552596_1552827_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	96.1	2.6e-31
AUK10746.1|1553149_1553449_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	87.9	1.4e-40
AUK10747.1|1553445_1553712_-	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	76.1	8.9e-31
AUK10748.1|1553708_1553912_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
AUK10749.1|1554108_1554351_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AUK10750.1|1554362_1554650_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	6.0e-33
AUK10751.1|1554660_1555002_-	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	91.4	1.1e-54
AUK10752.1|1555254_1555461_-	hypothetical protein	NA	NA	NA	NA	NA
AUK10753.1|1555467_1555755_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
AUK14164.1|1555868_1556189_+	XRE family transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
AUK10754.1|1556285_1557290_+|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.4	9.9e-99
AUK10755.1|1557448_1558606_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	6.0e-23
1557473:1557492	attR	AAAATCCTTGTTGATGAAAA	NA	NA	NA	NA
>prophage 4
CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	1767950	1804803	5199281	integrase,holin,lysis,transposase	Enterobacteria_phage(34.69%)	54	1770425:1770444	1798968:1798987
AUK10938.1|1767950_1768877_+	ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
AUK10939.1|1768881_1769613_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AUK10940.1|1769593_1769701_-	hypothetical protein	NA	NA	NA	NA	NA
AUK10941.1|1769760_1770447_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.8e-102
1770425:1770444	attL	CACGCGCGTAACGTGACAGG	NA	NA	NA	NA
AUK10942.1|1770482_1771769_-|integrase	site-specific integrase	integrase	A0A0N7KZF5	Stx2-converting_phage	99.8	2.9e-252
AUK10943.1|1771802_1772057_-	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
AUK10944.1|1772075_1772210_-	hypothetical protein	NA	H6WZF8	Escherichia_phage	100.0	2.2e-22
AUK10945.1|1772213_1772456_-	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	100.0	1.2e-37
AUK10946.1|1772543_1773047_-	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	43.0	1.0e-56
AUK10947.1|1773048_1773735_-	hypothetical protein	NA	H6WZG2	Escherichia_phage	85.2	1.9e-117
AUK10948.1|1773731_1773953_-	conjugal transfer protein TraR	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
AUK10949.1|1774051_1774333_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
AUK10950.1|1774343_1774535_-	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
AUK14171.1|1774507_1774690_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
AUK10951.1|1774686_1775367_-	exonuclease	NA	A0A0N6WET1	Escherichia_phage	99.1	4.6e-132
AUK10952.1|1775363_1776149_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	99.6	3.1e-148
AUK10953.1|1776154_1776451_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AUK10954.1|1776419_1776572_-	host-nuclease inhibitor protein Gam	NA	Q08J51	Stx2-converting_phage	98.0	4.7e-21
AUK10955.1|1776526_1776796_-	host cell division inhibitory peptide Kil	NA	G3CFI2	Escherichia_phage	97.8	3.3e-41
AUK10956.1|1776875_1777244_-	DUF2528 domain-containing protein	NA	A0A1U9AJB3	Stx1_converting_phage	99.2	2.6e-65
AUK10957.1|1777424_1778048_-	hypothetical protein	NA	A0A2D1GLY1	Escherichia_phage	97.1	9.5e-108
AUK10958.1|1778109_1778493_-	antitermination protein	NA	A0A0P0ZBT9	Stx2-converting_phage	100.0	2.3e-64
AUK10959.1|1779000_1779621_-	hypothetical protein	NA	A4KWT4	Enterobacteria_phage	99.5	6.2e-51
AUK10960.1|1779617_1780052_-	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	100.0	1.2e-77
AUK10961.1|1780122_1780464_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
AUK10962.1|1780524_1781229_-	XRE family transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
AUK10963.1|1781342_1781576_+	transcriptional regulator	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
AUK10964.1|1781714_1782011_+	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
AUK10965.1|1782911_1783613_+	Replication protein P	NA	C1JJ58	Enterobacteria_phage	100.0	3.4e-130
AUK10966.1|1783609_1783900_+	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
AUK10967.1|1783970_1784249_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
AUK10968.1|1784381_1784597_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
AUK10969.1|1784607_1784844_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
AUK10970.1|1784800_1785247_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	99.3	2.1e-80
AUK10971.1|1785243_1785771_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	2.8e-100
AUK10972.1|1785767_1785950_+	NinE family protein	NA	Q4A1A6	Enterobacteria_phage	100.0	4.3e-29
AUK10973.1|1786453_1788226_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.3	0.0e+00
AUK10974.1|1788789_1789356_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
AUK10975.1|1789330_1789933_+	protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	3.9e-90
AUK10976.1|1789929_1790601_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.6	9.2e-133
AUK10977.1|1790591_1791080_+	antiterminator	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
AUK14172.1|1792072_1792186_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AUK10978.1|1792337_1792466_+	hypothetical protein	NA	NA	NA	NA	NA
AUK10979.1|1792514_1794365_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
AUK10980.1|1794647_1794872_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.0e-32
AUK10981.1|1795264_1795798_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	1.4e-99
AUK10982.1|1796071_1796767_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
AUK14173.1|1796995_1797463_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	94.2	2.0e-73
AUK14174.1|1797492_1797693_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	76.9	5.0e-10
AUK10983.1|1797837_1798531_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	1.1e-133
AUK10984.1|1799256_1800942_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
1798968:1798987	attR	CACGCGCGTAACGTGACAGG	NA	NA	NA	NA
AUK10985.1|1800938_1801658_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUK10986.1|1801704_1802175_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AUK10987.1|1802802_1804803_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
>prophage 5
CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	1898711	1906307	5199281		Enterobacteria_phage(33.33%)	8	NA	NA
AUK11060.1|1898711_1900106_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	3.7e-19
AUK11061.1|1900262_1901258_+	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
AUK11062.1|1901500_1902394_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AUK11063.1|1902430_1902694_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11064.1|1902766_1903852_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	3.9e-101
AUK11065.1|1903851_1904721_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.3	6.6e-107
AUK11066.1|1904717_1905125_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
AUK11067.1|1905203_1906307_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.5	2.4e-37
>prophage 6
CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	1942599	1957419	5199281	integrase,transposase	Escherichia_phage(41.67%)	18	1941094:1941108	1954073:1954087
1941094:1941108	attL	AAAAACTCCTGACCG	NA	NA	NA	NA
AUK11104.1|1942599_1943382_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.2	1.3e-138
AUK11105.1|1943378_1944401_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
AUK11106.1|1944414_1944528_-|integrase	integrase	integrase	NA	NA	NA	NA
AUK11107.1|1944629_1945843_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	1.6e-167
AUK11108.1|1947258_1948608_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.0	4.0e-111
AUK11109.1|1948610_1949824_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
AUK14179.1|1949958_1950162_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11110.1|1950161_1950536_-	toxin	NA	NA	NA	NA	NA
AUK11111.1|1950625_1951102_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AUK11112.1|1951156_1951378_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AUK14180.1|1951440_1951887_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11113.1|1951932_1952406_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
AUK11114.1|1952442_1954056_-|transposase	IS66 family transposase ISEc23	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AUK11115.1|1954086_1954437_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
1954073:1954087	attR	CGGTCAGGAGTTTTT	NA	NA	NA	NA
AUK11116.1|1954433_1954796_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	100.0	5.6e-36
AUK11117.1|1954858_1956071_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	1.6e-167
AUK11118.1|1956253_1956601_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11119.1|1956600_1957419_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	1.6e-46
>prophage 7
CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	2021856	2079313	5199281	tRNA,holin,transposase,portal,integrase,terminase,lysis,head,capsid,tail	Enterobacteria_phage(34.0%)	71	2003658:2003674	2032849:2032865
2003658:2003674	attL	ATCAGTCGTGAAGAGGC	NA	NA	NA	NA
AUK11163.1|2021856_2023119_-|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	1.2e-72
AUK14182.1|2023456_2024254_-	protein MtfA	NA	NA	NA	NA	NA
AUK11164.1|2024489_2025515_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	57.3	6.4e-101
AUK11165.1|2025514_2025718_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AUK11166.1|2025776_2028248_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	1.5e-55
AUK11167.1|2028343_2028532_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUK11168.1|2028528_2028717_-	cell division inhibitor	NA	NA	NA	NA	NA
AUK11169.1|2029206_2029359_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
AUK11170.1|2029677_2030154_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
AUK11171.1|2030278_2030602_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
AUK11172.1|2030585_2031011_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUK11173.1|2031033_2032002_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	52.1	7.6e-72
AUK11174.1|2032008_2032755_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.4	9.0e-113
AUK11175.1|2032776_2033547_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
2032849:2032865	attR	ATCAGTCGTGAAGAGGC	NA	NA	NA	NA
AUK11176.1|2033562_2033976_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
AUK11177.1|2034327_2035101_-	iroE	NA	NA	NA	NA	NA
AUK11178.1|2035661_2036735_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.8	3.0e-08
AUK11179.1|2036806_2036962_+	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AUK14183.1|2037129_2037408_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
AUK11180.1|2037409_2038456_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	3.2e-108
AUK11181.1|2038468_2038828_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	3.0e-37
AUK11182.1|2038836_2039367_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
AUK11183.1|2039485_2039806_+	lipoprotein	NA	S5MQK8	Escherichia_phage	97.4	2.5e-35
AUK11184.1|2039956_2041006_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	6.8e-199
AUK11185.1|2043148_2043415_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11186.1|2043559_2043688_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11187.1|2043736_2045587_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
AUK11188.1|2045710_2045872_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11189.1|2045870_2046086_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
AUK11190.1|2046048_2046393_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11191.1|2046341_2046578_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11192.1|2046546_2046741_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11193.1|2046773_2047307_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
AUK11194.1|2047527_2047641_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
AUK11195.1|2047642_2048110_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	87.0	2.7e-67
AUK11196.1|2048192_2048333_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11197.1|2048575_2048890_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AUK11198.1|2048971_2049196_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
AUK11199.1|2049597_2050107_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AUK11200.1|2050078_2052007_+|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	65.6	1.3e-259
AUK11201.1|2051990_2052197_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AUK11202.1|2052193_2053786_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	61.0	1.0e-182
AUK11203.1|2053775_2055281_+	scaffolding protein	NA	A0A2I6TC87	Escherichia_phage	54.2	1.6e-100
AUK11204.1|2055317_2055665_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
AUK11205.1|2055722_2056751_+|capsid	major capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.7e-114
AUK11206.1|2056754_2057177_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11207.1|2057169_2057523_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	4.3e-41
AUK11208.1|2057538_2058114_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.3	1.3e-50
AUK11209.1|2058110_2058506_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AUK11210.1|2058513_2059266_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	4.6e-133
AUK11211.1|2059279_2059711_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
AUK11212.1|2059737_2060151_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
AUK11213.1|2060131_2062711_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.9	0.0e+00
AUK11214.1|2062707_2063037_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
AUK11215.1|2063036_2063735_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.7	3.1e-131
AUK11216.1|2063740_2064484_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.3e-145
AUK11217.1|2064381_2065062_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.2	4.1e-112
AUK11218.1|2065015_2065222_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11219.1|2065252_2065780_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
AUK11220.1|2065913_2069390_+|tail	phage tail protein	tail	Q6H9T2	Enterobacteria_phage	95.6	0.0e+00
AUK14184.1|2069458_2070082_+	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	1.9e-68
AUK11221.1|2070146_2071460_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.3	1.2e-75
AUK11222.1|2071461_2071731_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	1.9e-44
AUK11223.1|2072492_2073128_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
AUK11224.1|2073255_2074314_-	type III effector	NA	NA	NA	NA	NA
AUK11225.1|2074392_2075043_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	40.7	1.1e-37
AUK11226.1|2075226_2075817_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
AUK11227.1|2076062_2076311_-	damage-inducible protein DinI	NA	K7PLW4	Enterobacteria_phage	93.9	3.8e-36
AUK14185.1|2076466_2076583_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
AUK11228.1|2076664_2077231_-	isochorismatase	NA	NA	NA	NA	NA
AUK11229.1|2077540_2079313_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 8
CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	2351756	2419240	5199281	transposase,protease,integrase,portal,terminase,lysis,head,capsid,tail	Enterobacteria_phage(43.75%)	79	2359332:2359347	2392109:2392124
AUK11492.1|2351756_2352578_-|protease	serine protease	protease	NA	NA	NA	NA
AUK11493.1|2352677_2352761_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11494.1|2352853_2353189_-	acid shock protein	NA	NA	NA	NA	NA
AUK11495.1|2353585_2354839_-	MFS transporter	NA	NA	NA	NA	NA
AUK11496.1|2354945_2355839_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUK11497.1|2355973_2357194_+	protein mlc	NA	NA	NA	NA	NA
AUK11498.1|2357318_2358014_+	dethiobiotin synthase	NA	NA	NA	NA	NA
AUK14199.1|2357966_2359259_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2359332:2359347	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
AUK11499.1|2359417_2360032_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AUK11500.1|2360074_2360929_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AUK11501.1|2360930_2361548_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AUK11502.1|2364043_2365153_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	47.2	4.1e-85
AUK11503.1|2365378_2366758_+|integrase	integrase	integrase	NA	NA	NA	NA
AUK11504.1|2367281_2367650_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11505.1|2368030_2369122_+	AP2 domain-containing protein	NA	NA	NA	NA	NA
AUK11506.1|2369121_2369334_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11507.1|2369447_2369939_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11508.1|2370044_2371031_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11509.1|2371629_2373108_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.1	3.0e-120
AUK11510.1|2373306_2373612_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AUK14200.1|2373719_2374430_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AUK11511.1|2374432_2374993_-	spermidine acetyltransferase	NA	NA	NA	NA	NA
AUK11512.1|2375027_2375369_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11513.1|2375503_2375830_+	hypothetical protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
AUK11514.1|2375866_2376055_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11515.1|2376035_2377250_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AUK11516.1|2377261_2378281_+	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AUK11517.1|2378338_2378467_+	transporter	NA	NA	NA	NA	NA
AUK11518.1|2378468_2379764_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	2.5e-155
AUK11519.1|2379783_2380035_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AUK11520.1|2382165_2382345_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11521.1|2382319_2382502_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
AUK11522.1|2382679_2383993_+|transposase	transposase	transposase	NA	NA	NA	NA
AUK11523.1|2384429_2384762_-	protein FlxA	NA	NA	NA	NA	NA
AUK11524.1|2384964_2385270_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11525.1|2385294_2385534_+	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AUK11526.1|2385533_2385821_+	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AUK11527.1|2385892_2386048_+	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AUK11528.1|2386264_2386516_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11529.1|2386582_2386861_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11530.1|2386862_2387912_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	6.3e-112
AUK11531.1|2387925_2388678_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.4	2.7e-133
AUK11532.1|2389099_2389312_-	cold-shock protein CspF	NA	NA	NA	NA	NA
AUK11533.1|2389612_2389828_+	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AUK11534.1|2390581_2390797_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AUK11535.1|2390801_2391113_+	hypothetical protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AUK11536.1|2391109_2391643_+	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AUK11537.1|2391639_2392137_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.2e-06
2392109:2392124	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
AUK11538.1|2392500_2392713_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AUK11539.1|2392723_2392912_+	cold-shock protein	NA	NA	NA	NA	NA
AUK14201.1|2393059_2393215_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11540.1|2393386_2393566_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
AUK11541.1|2393717_2394128_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	78.7	1.6e-55
AUK11542.1|2394185_2394419_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	82.5	5.6e-21
AUK11543.1|2394807_2395353_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	8.1e-95
AUK11544.1|2395327_2397253_+|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
AUK11545.1|2397249_2397456_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AUK11546.1|2397452_2399054_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.9e-309
AUK11547.1|2399034_2400354_+|capsid	capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	98.9	1.6e-234
AUK11548.1|2400363_2400696_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
AUK11549.1|2400751_2401777_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	99.1	2.3e-191
AUK11550.1|2401818_2402214_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	4.5e-55
AUK11551.1|2402225_2402579_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
AUK11552.1|2402590_2403169_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	1.7e-79
AUK11553.1|2403165_2403561_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
AUK14202.1|2403568_2404309_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	4.0e-129
AUK11554.1|2404324_2404747_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	6.9e-70
AUK11555.1|2404728_2405163_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
AUK11556.1|2405155_2407735_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.5	0.0e+00
AUK11557.1|2407731_2408061_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AUK11558.1|2408060_2408759_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
AUK11559.1|2408764_2409508_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	8.6e-148
AUK11560.1|2409405_2410047_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.5	1.0e-96
AUK11561.1|2410107_2413587_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.3	0.0e+00
AUK11562.1|2413655_2414255_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	96.5	6.3e-109
AUK11563.1|2414319_2417427_+|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	59.9	3.1e-82
AUK11564.1|2417426_2418002_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	1.8e-105
AUK11565.1|2418099_2418690_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
AUK11566.1|2419006_2419240_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
>prophage 9
CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	2528821	2586981	5199281	transposase,portal,terminase,capsid,tail	Escherichia_phage(25.0%)	59	NA	NA
AUK11653.1|2528821_2529958_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AUK14206.1|2530285_2530384_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	84.4	2.3e-08
AUK14207.1|2530405_2530615_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11654.1|2530812_2535021_-	RHS element protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.0	3.2e-21
AUK11655.1|2535088_2537197_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.8e-26
AUK11656.1|2538017_2538230_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11657.1|2538305_2538923_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AUK11658.1|2539189_2540689_+	L-asparagine permease	NA	NA	NA	NA	NA
AUK11659.1|2540801_2541863_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11660.1|2541945_2542071_+	tonB-dependent receptor yncD	NA	NA	NA	NA	NA
AUK14208.1|2542010_2542190_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11661.1|2542104_2544207_+	TonB-dependent siderophore receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.8e-134
AUK11662.1|2544242_2544908_-	colanic acid/biofilm transcriptional regulator	NA	NA	NA	NA	NA
AUK11663.1|2545105_2546143_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AUK11664.1|2546323_2546842_+	L-amino acid N-acyltransferase MnaT	NA	NA	NA	NA	NA
AUK11665.1|2546838_2547288_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11666.1|2547288_2547522_-	DUF2526 domain-containing protein	NA	NA	NA	NA	NA
AUK11667.1|2547607_2547829_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
AUK14209.1|2547799_2547979_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11668.1|2547975_2548071_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
AUK11669.1|2548472_2549282_-	acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	40.4	5.0e-16
AUK11670.1|2549491_2550916_-	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
AUK11671.1|2550937_2551732_-	ABC transporter permease	NA	NA	NA	NA	NA
AUK11672.1|2551721_2552663_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AUK11673.1|2552663_2553677_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
AUK11674.1|2553694_2554840_-	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUK11675.1|2555081_2556491_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUK14210.1|2556569_2556695_-	transcriptional regulator	NA	NA	NA	NA	NA
AUK11676.1|2556725_2556998_+	hypothetical protein	NA	A0A1D7XF78	Escherichia_phage	52.2	1.8e-18
AUK11677.1|2557047_2557434_+	hypothetical protein	NA	C4MZ15	Escherichia_phage	47.3	7.9e-12
AUK11678.1|2557742_2558162_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11679.1|2558225_2559905_+	recombinase family protein	NA	Q6V7T7	Burkholderia_virus	27.8	7.9e-40
AUK11680.1|2559894_2560167_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11681.1|2560249_2560447_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11682.1|2560439_2560793_-	serine/threonine protein kinase	NA	A0A2K9VAY0	Citrobacter_phage	62.6	5.0e-37
AUK11683.1|2560802_2561150_-	hypothetical protein	NA	NA	NA	NA	NA
AUK14211.1|2561188_2561482_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11684.1|2562063_2562342_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11685.1|2566641_2567001_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11686.1|2567000_2567435_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11687.1|2567466_2568237_-	hypothetical protein	NA	A0A193GZN1	Shigella_phage	35.3	8.1e-08
AUK14212.1|2568311_2568881_-	DUF2163 domain-containing protein	NA	NA	NA	NA	NA
AUK11688.1|2568964_2569525_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11689.1|2569575_2572005_-	hypothetical protein	NA	A0A0M3LS69	Mannheimia_phage	33.6	1.8e-21
AUK11690.1|2572016_2572358_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11691.1|2572387_2572696_-	cytochrome	NA	NA	NA	NA	NA
AUK11692.1|2572778_2573249_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11693.1|2573365_2573590_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11694.1|2573605_2573911_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11695.1|2573913_2574210_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11696.1|2574292_2575405_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUK11697.1|2575597_2579128_-|tail	phage tail protein	tail	K7DVC6	Escherichia_phage	46.9	5.0e-04
AUK11698.1|2579201_2580035_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11699.1|2580044_2580467_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11700.1|2580450_2580741_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11701.1|2580932_2582939_-|capsid	major capsid protein	capsid	A0A2I5ARA4	Synechococcus_phage	23.6	3.1e-27
AUK11702.1|2582984_2584496_-|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	27.0	1.1e-32
AUK11703.1|2584506_2585001_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11704.1|2585073_2586981_-|terminase	terminase	terminase	D6PFE7	uncultured_phage	30.4	2.8e-33
>prophage 10
CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	2744724	2815075	5199281	holin,transposase,protease,portal,integrase,terminase,head,capsid,lysis,tail	Enterobacteria_phage(38.46%)	83	2812978:2812992	2818907:2818921
AUK11843.1|2744724_2745774_-|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
AUK11844.1|2745993_2746752_+	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	1.5e-06
AUK11845.1|2746748_2747339_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AUK11846.1|2747378_2748254_-	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AUK11847.1|2748466_2750362_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
AUK11848.1|2750389_2751010_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AUK11849.1|2751006_2751888_-	phosphatase	NA	NA	NA	NA	NA
AUK14218.1|2752025_2752070_+	trp operon leader peptide	NA	NA	NA	NA	NA
AUK11850.1|2752161_2753724_+	anthranilate synthase component I	NA	NA	NA	NA	NA
AUK11851.1|2753723_2755319_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AUK14219.1|2755322_2756681_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
AUK11852.1|2756692_2757886_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AUK11853.1|2757885_2758692_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AUK11854.1|2759072_2759252_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11855.1|2759337_2759838_+	YciE/YciF family protein	NA	NA	NA	NA	NA
AUK11856.1|2759883_2760390_+	YciE/YciF family protein	NA	NA	NA	NA	NA
AUK11857.1|2760759_2761035_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
AUK11858.1|2761031_2761589_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
AUK11859.1|2762000_2762270_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
AUK14220.1|2762368_2762995_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUK11860.1|2762939_2763077_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AUK11861.1|2763049_2763634_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
AUK11862.1|2763633_2766660_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	84.7	2.2e-48
AUK11863.1|2766811_2767411_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	96.5	2.0e-107
AUK11864.1|2767478_2770958_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
AUK11865.1|2771118_2771304_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11866.1|2771435_2772077_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	5.6e-95
AUK11867.1|2771974_2772718_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	2.0e-144
AUK11868.1|2772722_2773421_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
AUK11869.1|2773420_2773750_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AUK11870.1|2773749_2776320_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	85.3	0.0e+00
AUK11871.1|2776300_2776714_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
AUK11872.1|2776740_2777172_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
AUK11873.1|2777185_2777938_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
AUK11874.1|2777945_2778341_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AUK11875.1|2778337_2778913_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	2.1e-48
AUK11876.1|2778927_2779281_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	3.0e-42
AUK11877.1|2779273_2779642_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11878.1|2779693_2780722_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	60.4	2.8e-112
AUK11879.1|2780779_2781127_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
AUK11880.1|2781163_2782669_-	scaffolding protein	NA	A0A0K2FI53	Enterobacteria_phage	53.1	7.9e-100
AUK11881.1|2782658_2784251_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	1.0e-182
AUK11882.1|2784247_2784454_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	55.4	3.9e-10
AUK11883.1|2784437_2786366_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	9.7e-260
AUK11884.1|2786337_2786754_-	DNA packaging protein	NA	A0A0U2S671	Escherichia_phage	93.6	3.9e-41
AUK11885.1|2786825_2788038_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.3	1.4e-163
AUK11886.1|2788610_2789678_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11887.1|2789619_2790240_-	hypothetical protein	NA	A0A0U2RXY7	Escherichia_phage	53.7	5.1e-53
AUK11888.1|2790656_2791094_-|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	93.8	5.7e-67
AUK11889.1|2791392_2791926_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.4	2.4e-99
AUK11890.1|2791989_2792340_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.4e-37
AUK11891.1|2792344_2792560_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
AUK11892.1|2792709_2794563_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
AUK11893.1|2795103_2795325_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11894.1|2795837_2796887_-	DNA adenine methylase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
AUK11895.1|2796950_2798564_-|transposase	IS66 family transposase ISEc23	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AUK11896.1|2798594_2798945_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AUK11897.1|2798941_2799367_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AUK11898.1|2799577_2799775_-	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
AUK11899.1|2800001_2800823_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
AUK11900.1|2800819_2801194_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
AUK11901.1|2801206_2802253_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	1.3e-109
AUK11902.1|2802254_2802533_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	9.7e-12
AUK11903.1|2802599_2802851_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11904.1|2803067_2803280_-	hypothetical protein	NA	A0A0U2QV81	Escherichia_phage	92.9	3.1e-26
AUK11905.1|2803438_2803675_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11906.1|2803965_2804661_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11907.1|2804673_2805327_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AUK11908.1|2805641_2806541_-	regulator	NA	NA	NA	NA	NA
AUK11909.1|2806793_2807216_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	91.8	4.8e-63
AUK11910.1|2807256_2808276_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.8e-56
AUK11911.1|2808202_2808724_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11912.1|2808707_2808935_-	transcriptional regulator	NA	NA	NA	NA	NA
AUK11913.1|2808961_2809420_+	transcriptional regulator	NA	I6PD69	Cronobacter_phage	46.2	2.8e-24
AUK11914.1|2809612_2809768_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AUK11915.1|2809727_2809898_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11916.1|2809927_2810146_+	hypothetical protein	NA	NA	NA	NA	NA
AUK11917.1|2810149_2810458_-	hypothetical protein	NA	NA	NA	NA	NA
AUK11918.1|2810713_2810902_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AUK11919.1|2810898_2811090_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUK11920.1|2811182_2813654_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
2812978:2812992	attL	TCCCGAACAAGGAGT	NA	NA	NA	NA
AUK11921.1|2813718_2813967_+	excisionase	NA	NA	NA	NA	NA
AUK11922.1|2813944_2815075_+|integrase	integrase	integrase	O21940	Phage_21	51.1	2.2e-102
2818907:2818921	attR	TCCCGAACAAGGAGT	NA	NA	NA	NA
>prophage 11
CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	2920555	2991715	5199281	tRNA,holin,transposase,portal,integrase,terminase,head,capsid,lysis,tail	Enterobacteria_phage(42.19%)	102	2929626:2929641	3003071:3003086
AUK12019.1|2920555_2921662_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUK14230.1|2921697_2922339_+	lysogenization protein HflD	NA	NA	NA	NA	NA
AUK12020.1|2922342_2923713_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
AUK12021.1|2923880_2924552_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AUK12022.1|2924551_2926012_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
AUK12023.1|2926613_2926895_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12024.1|2927151_2927694_-|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
AUK12025.1|2927899_2928313_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
AUK12026.1|2928325_2928661_-|head	head decoration protein	head	NA	NA	NA	NA
AUK12027.1|2928673_2929729_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
2929626:2929641	attL	AACAGCGTGGTAAACA	NA	NA	NA	NA
AUK12028.1|2929728_2929935_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12029.1|2930186_2930411_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12030.1|2930452_2930581_-	trigger factor	NA	NA	NA	NA	NA
AUK12031.1|2930537_2930810_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AUK12032.1|2930820_2931231_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AUK12033.1|2931227_2931479_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12034.1|2931679_2933080_-	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	9.6e-116
AUK12035.1|2933076_2933376_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AUK12036.1|2933381_2933615_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12037.1|2933607_2934072_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12038.1|2934061_2934274_-	hypothetical protein	NA	NA	NA	NA	NA
AUK14231.1|2934266_2934464_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AUK12039.1|2935268_2935457_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
AUK12040.1|2935821_2937051_-|integrase	integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
AUK12041.1|2937299_2938421_+	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AUK12042.1|2938469_2939696_-	peptidase T	NA	NA	NA	NA	NA
AUK12043.1|2939751_2939967_+	hypothetical protein	NA	NA	NA	NA	NA
AUK12044.1|2939945_2941082_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
AUK12045.1|2941065_2941929_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AUK12046.1|2941959_2942172_+	hypothetical protein	NA	NA	NA	NA	NA
AUK12047.1|2942292_2943654_+	type III secretion protein GogB	NA	Q9MBM1	Phage_Gifsy-1	29.4	2.1e-51
AUK12048.1|2943716_2943992_+	secretion protein EspO	NA	NA	NA	NA	NA
AUK12049.1|2944071_2945052_-	non-LEE encoded effector protein NleB	NA	Q8HAB2	Salmonella_phage	49.5	1.0e-87
AUK12050.1|2945228_2945498_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
AUK12051.1|2946876_2947476_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	3.7e-109
AUK12052.1|2947542_2951022_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.5	0.0e+00
AUK12053.1|2951082_2951754_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	97.3	6.0e-100
AUK12054.1|2951651_2952395_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	3.4e-144
AUK12055.1|2952399_2953098_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
AUK12056.1|2953097_2953427_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AUK12057.1|2953423_2955985_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	86.8	0.0e+00
AUK12058.1|2955965_2956379_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	79.2	8.6e-41
AUK12059.1|2956405_2956837_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
AUK12060.1|2956850_2957603_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	4.6e-133
AUK12061.1|2957610_2958006_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AUK12062.1|2958002_2958536_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.2e-58
AUK12063.1|2958551_2958905_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	5.7e-41
AUK12064.1|2958897_2959281_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
AUK12065.1|2959332_2960361_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
AUK12066.1|2960418_2960766_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	6.8e-23
AUK12067.1|2960802_2962308_-	scaffolding protein	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
AUK12068.1|2962297_2963890_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
AUK12069.1|2963886_2964093_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AUK12070.1|2964076_2966005_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	1.4e-261
AUK14232.1|2965976_2966483_-	DNA-packaging protein	NA	O64316	Escherichia_phage	47.9	1.5e-34
AUK12071.1|2966909_2967134_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
AUK12072.1|2967215_2967530_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AUK12073.1|2967772_2967913_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12074.1|2967995_2968463_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	87.7	3.6e-67
AUK12075.1|2968464_2968578_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
AUK12076.1|2968798_2969332_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	1.4e-99
AUK12077.1|2969364_2969559_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12078.1|2969527_2969764_+	hypothetical protein	NA	NA	NA	NA	NA
AUK12079.1|2969712_2970057_+	hypothetical protein	NA	NA	NA	NA	NA
AUK12080.1|2970019_2970235_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
AUK12081.1|2970233_2970380_+	hypothetical protein	NA	NA	NA	NA	NA
AUK12082.1|2970674_2972525_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
AUK12083.1|2972573_2972702_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12084.1|2972846_2973113_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12085.1|2973003_2973435_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
AUK12086.1|2973885_2974599_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUK12087.1|2974733_2974931_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	1.4e-28
AUK12088.1|2975046_2975226_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.3e-06
AUK12089.1|2975191_2976405_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.0e-166
AUK12090.1|2976468_2977023_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	66.9	3.0e-65
AUK12091.1|2977031_2977391_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.3	4.3e-36
AUK12092.1|2977390_2977633_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	97.5	1.6e-34
AUK12093.1|2977644_2979045_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	94.8	5.4e-252
AUK12094.1|2979041_2979932_-	AAA family ATPase	NA	Q8W641	Enterobacteria_phage	63.3	2.6e-82
AUK12095.1|2979949_2980843_-	DNA-binding protein	NA	C5IHL2	Burkholderia_virus	45.9	2.1e-60
AUK12096.1|2980829_2981063_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	50.0	9.5e-13
AUK12097.1|2981059_2981254_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12098.1|2981250_2981913_-	hypothetical protein	NA	Q8W643	Enterobacteria_phage	83.2	4.2e-98
AUK14233.1|2982021_2982729_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	97.4	1.3e-124
AUK12099.1|2982848_2983142_+	hypothetical protein	NA	NA	NA	NA	NA
AUK12100.1|2983212_2983485_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	89.6	2.1e-35
AUK12101.1|2983618_2984308_+	hypothetical protein	NA	A0A1B5FPF4	Escherichia_phage	87.8	8.0e-116
AUK12102.1|2984452_2985145_+	transcriptional regulator	NA	A0A1B5FPB8	Escherichia_phage	69.2	1.1e-40
AUK12103.1|2985150_2985351_+	hypothetical protein	NA	NA	NA	NA	NA
AUK12104.1|2985550_2985910_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	73.1	1.4e-42
AUK12105.1|2985909_2986125_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	63.4	1.2e-17
AUK12106.1|2986096_2986315_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	75.0	3.1e-21
AUK12107.1|2986311_2986704_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	57.9	4.7e-36
AUK12108.1|2986764_2986953_+	hypothetical protein	NA	NA	NA	NA	NA
AUK12109.1|2987321_2987693_+	hypothetical protein	NA	Q8W655	Enterobacteria_phage	98.4	3.8e-64
AUK12110.1|2987724_2987967_+	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	92.5	2.4e-35
AUK12111.1|2987970_2988117_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	3.1e-22
AUK12112.1|2988125_2988362_+	excisionase	NA	Q8W657	Enterobacteria_phage	98.7	8.4e-41
AUK12113.1|2988417_2989731_+|integrase	integrase	integrase	Q8W658	Enterobacteria_phage	97.0	2.8e-250
AUK12114.1|2989712_2990483_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
AUK12115.1|2990535_2990931_+	hypothetical protein	NA	NA	NA	NA	NA
AUK12116.1|2990971_2991715_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
3003071:3003086	attR	AACAGCGTGGTAAACA	NA	NA	NA	NA
>prophage 12
CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	3049178	3132551	5199281	holin,transposase,integrase,terminase,head,capsid,lysis,tail	Enterobacteria_phage(30.51%)	105	3114468:3114488	3141038:3141058
AUK12174.1|3049178_3049457_+|integrase	integrase	integrase	A0A286S1S8	Klebsiella_phage	51.1	8.5e-08
AUK14235.1|3049376_3049691_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
AUK12175.1|3049735_3049930_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12176.1|3049905_3051564_+	flagellar M-ring protein	NA	NA	NA	NA	NA
AUK12177.1|3051556_3052552_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AUK12178.1|3052544_3053231_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AUK12179.1|3053230_3054604_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
AUK12180.1|3054622_3055066_+	flagellar protein FliJ	NA	NA	NA	NA	NA
AUK12181.1|3055062_3056190_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
AUK12182.1|3056294_3056759_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
AUK12183.1|3056763_3057768_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AUK12184.1|3057764_3058178_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AUK12185.1|3058180_3058546_+	flagellar protein FliO	NA	NA	NA	NA	NA
AUK12186.1|3058545_3059283_+	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
AUK12187.1|3059292_3059562_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
AUK12188.1|3059569_3060355_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
AUK12189.1|3060644_3061268_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AUK12190.1|3061311_3061554_-	DsrB protein	NA	NA	NA	NA	NA
AUK12191.1|3061486_3061675_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12192.1|3061662_3061890_+	DUF2525 domain-containing protein	NA	NA	NA	NA	NA
AUK12193.1|3062187_3063003_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
AUK12194.1|3062999_3064694_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
AUK12195.1|3064614_3064803_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12196.1|3064931_3065114_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AUK12197.1|3065192_3066110_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12198.1|3066282_3067203_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AUK12199.1|3067191_3067662_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	4.4e-33
AUK12200.1|3067642_3069061_-	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	4.0e-101
AUK12201.1|3071169_3072528_-	two-component sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
AUK14236.1|3072527_3073199_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
AUK12202.1|3073331_3073745_+	5-hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AUK12203.1|3073853_3074858_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AUK12204.1|3074858_3075494_+	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AUK12205.1|3075750_3076401_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AUK12206.1|3076436_3076766_+	hypothetical protein	NA	NA	NA	NA	NA
AUK12207.1|3077845_3078415_-	type III effector	NA	NA	NA	NA	NA
AUK12208.1|3079543_3079675_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
AUK12209.1|3079697_3079961_-	T3SS effector NleC domain protein	NA	NA	NA	NA	NA
AUK12210.1|3080021_3081002_-	non-LEE encoded effector protein NleB	NA	Q8HAB2	Salmonella_phage	49.5	2.5e-86
AUK12211.1|3081178_3081448_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	5.4e-44
AUK12212.1|3081449_3082763_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	99.1	9.7e-78
AUK14237.1|3082827_3083451_-	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	1.9e-68
AUK12213.1|3083519_3086996_-|tail	phage tail protein	tail	Q6H9T2	Enterobacteria_phage	95.7	0.0e+00
AUK12214.1|3087129_3087657_+	superoxide dismutase	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
AUK12215.1|3087687_3087894_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12216.1|3087847_3088528_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.2	4.1e-112
AUK12217.1|3088425_3089169_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.3e-145
AUK12218.1|3089174_3089873_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.7	3.1e-131
AUK12219.1|3089872_3090214_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
AUK12220.1|3090206_3093449_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	98.5	0.0e+00
AUK12221.1|3093576_3094086_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	9.4e-13
AUK12222.1|3093991_3094198_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12223.1|3094212_3094494_-|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
AUK12224.1|3094517_3094892_-|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
AUK12225.1|3094897_3095614_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
AUK12226.1|3095680_3096025_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AUK12227.1|3096021_3096468_-	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AUK12228.1|3096464_3096815_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AUK12229.1|3096824_3097151_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
AUK12230.1|3099677_3099899_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	91.8	5.1e-32
AUK12231.1|3099943_3101881_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	98.6	0.0e+00
AUK12232.1|3101944_3103606_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
AUK12233.1|3103602_3104166_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	91.4	2.2e-79
AUK12234.1|3104454_3104820_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
AUK12235.1|3104861_3105089_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
AUK12236.1|3105457_3105682_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12237.1|3105678_3106173_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	100.0	1.7e-83
AUK12238.1|3106471_3107005_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	3.6e-100
AUK12239.1|3107055_3107400_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
AUK14238.1|3107404_3107620_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
AUK12240.1|3107913_3109764_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
AUK12241.1|3110335_3110767_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	95.8	2.1e-66
AUK12242.1|3111074_3111449_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUK12243.1|3111509_3111770_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AUK12244.1|3111877_3112942_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	90.8	2.6e-190
AUK12245.1|3113093_3113291_-	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
AUK12246.1|3113517_3114339_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
AUK12247.1|3114335_3114710_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	3.2e-34
3114468:3114488	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
AUK12248.1|3114722_3115772_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	9.4e-108
AUK12249.1|3115773_3116052_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
AUK12250.1|3116219_3116432_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
AUK12251.1|3116618_3116723_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12252.1|3116832_3117396_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	93.9	2.9e-47
AUK12253.1|3117522_3117834_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
AUK12254.1|3117830_3118019_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	45.3	1.7e-07
AUK12255.1|3118015_3118372_-	eae-like protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
AUK12256.1|3118368_3118593_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
AUK12257.1|3118614_3119313_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.1	4.7e-71
AUK12258.1|3119347_3120010_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	95.4	2.3e-83
AUK12259.1|3120696_3120897_+	hypothetical protein	NA	NA	NA	NA	NA
AUK12260.1|3120907_3121333_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUK12261.1|3121329_3121557_-	cell division protein	NA	NA	NA	NA	NA
AUK12262.1|3121651_3122299_+	XRE family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.9e-06
AUK12263.1|3122574_3122727_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
AUK12264.1|3123216_3123405_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AUK12265.1|3123401_3123593_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUK12266.1|3123685_3126157_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.7	1.1e-58
AUK12267.1|3126218_3126488_+	excisionase	NA	NA	NA	NA	NA
AUK12268.1|3126456_3127575_+|integrase	integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
AUK12269.1|3127741_3128536_+	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AUK12270.1|3128532_3129579_+	spermidine/putrescine-binding periplasmic protein	NA	NA	NA	NA	NA
AUK12271.1|3129636_3130053_+	hypothetical protein	NA	NA	NA	NA	NA
AUK12272.1|3130134_3130560_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AUK12273.1|3130556_3130907_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AUK12274.1|3130937_3132551_+|transposase	IS66 family transposase ISEc23	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
3141038:3141058	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 13
CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	3498541	3546109	5199281	holin,portal,integrase,terminase,head,capsid,lysis,tail	Enterobacteria_phage(58.62%)	68	3490918:3490932	3554595:3554609
3490918:3490932	attL	CAGGCCATCTTCCAG	NA	NA	NA	NA
AUK12609.1|3498541_3499423_-	T3SS effector protein NleH	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
AUK14256.1|3499591_3499753_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
AUK12610.1|3500248_3501241_-	peptidase M85	NA	NA	NA	NA	NA
AUK12611.1|3501301_3502282_-	non-LEE encoded effector protein NleB	NA	Q8HAB2	Salmonella_phage	49.5	2.5e-86
AUK12612.1|3502458_3502728_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	5.4e-44
AUK12613.1|3502729_3504043_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	99.1	9.7e-78
AUK12614.1|3504107_3504707_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	97.5	1.7e-109
AUK12615.1|3504773_3508172_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	87.8	0.0e+00
AUK12616.1|3508232_3508904_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.8	2.2e-102
AUK12617.1|3508801_3509545_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	1.9e-147
AUK12618.1|3509549_3510248_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
AUK12619.1|3510247_3510577_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AUK12620.1|3510573_3513153_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.7	0.0e+00
AUK12621.1|3513572_3514004_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
AUK12622.1|3514017_3514770_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	1.4e-126
AUK12623.1|3514777_3515173_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
AUK12624.1|3515169_3515703_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.3e-57
AUK12625.1|3515717_3516071_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.5e-41
AUK12626.1|3516063_3516447_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
AUK12627.1|3516498_3517527_-|capsid	major capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.9	2.3e-114
AUK12628.1|3517584_3517932_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
AUK12629.1|3517968_3519474_-	scaffolding protein	NA	A0A2I6TC87	Escherichia_phage	54.5	9.3e-101
AUK12630.1|3519463_3521056_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	2.2e-185
AUK12631.1|3521052_3521259_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AUK12632.1|3521242_3523171_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.9e-261
AUK12633.1|3523142_3523652_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AUK12634.1|3524046_3524241_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
AUK12635.1|3524320_3524461_+	hypothetical protein	NA	NA	NA	NA	NA
AUK12636.1|3524428_3525046_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.4	1.2e-91
AUK12637.1|3525195_3525633_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	99.3	8.5e-71
AUK12638.1|3525629_3526127_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	1.3e-91
AUK12639.1|3526126_3526342_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AUK12640.1|3526340_3526502_+	hypothetical protein	NA	NA	NA	NA	NA
AUK12641.1|3526780_3528631_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
AUK12642.1|3529173_3529890_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12643.1|3530101_3530791_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
AUK12644.1|3530805_3530928_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12645.1|3531266_3532226_+	DUF2219 domain-containing protein	NA	NA	NA	NA	NA
AUK12646.1|3532437_3533103_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.4	4.4e-127
AUK12647.1|3533099_3533711_-	recombination protein NinG	NA	Q716C3	Shigella_phage	99.0	1.3e-98
AUK12648.1|3533703_3533874_-	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	98.2	1.2e-25
AUK12649.1|3533870_3534053_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
AUK12650.1|3534049_3534577_-	phage N-6-adenine-methyltransferase	NA	Q8H9Z7	Enterobacteria_phage	99.4	3.6e-100
AUK12651.1|3534573_3535032_-	recombination protein NinB	NA	Q8H9Z8	Enterobacteria_phage	100.0	4.3e-81
AUK12652.1|3535087_3535378_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
AUK12653.1|3535374_3536076_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
AUK12654.1|3536072_3536972_-	Replication protein O	NA	M1FN81	Enterobacteria_phage	99.3	1.4e-173
AUK12655.1|3537006_3537285_-	hypothetical protein	NA	K7P7A2	Enterobacteria_phage	100.0	1.6e-43
AUK12656.1|3537393_3537579_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
AUK12657.1|3537659_3538310_+	LexA family transcriptional repressor	NA	K7PM82	Enterobacteria_phage	98.6	4.1e-122
AUK12658.1|3538623_3538896_+	hypothetical protein	NA	K7PH69	Enterobacterial_phage	95.6	1.1e-25
AUK12659.1|3538954_3539425_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
AUK12660.1|3539575_3539944_+	DUF2528 domain-containing protein	NA	M1FPD2	Enterobacteria_phage	98.4	2.2e-64
AUK12661.1|3540023_3540293_+	host cell division inhibitory peptide Kil	NA	M1FN78	Enterobacteria_phage	98.9	3.0e-42
AUK12662.1|3540247_3540400_+	host-nuclease inhibitor protein Gam	NA	Q08J51	Stx2-converting_phage	94.0	5.8e-19
AUK12663.1|3540368_3540665_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AUK12664.1|3540670_3541456_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AUK12665.1|3541452_3542133_+	exonuclease	NA	A0A0N6WET1	Escherichia_phage	97.8	2.5e-130
AUK12666.1|3542129_3542288_+	DUF1317 domain-containing protein	NA	M1FJ61	Enterobacteria_phage	98.1	4.0e-23
AUK12667.1|3542284_3543037_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	99.6	1.9e-150
AUK12668.1|3543044_3543260_+	cell division protein ZapA	NA	M1FPM2	Enterobacteria_phage	97.2	8.5e-32
AUK12669.1|3543358_3543580_+	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
AUK12670.1|3543790_3544321_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12671.1|3544211_3544463_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12672.1|3544517_3544703_-	hypothetical protein	NA	NA	NA	NA	NA
AUK12673.1|3544635_3544803_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
AUK12674.1|3544842_3545061_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AUK12675.1|3545038_3546109_+|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
3554595:3554609	attR	CAGGCCATCTTCCAG	NA	NA	NA	NA
>prophage 1
CP024136	Escherichia coli strain 14EC017 plasmid p14EC017b, complete sequence	93781	14959	63183	93781	integrase,transposase,protease	Escherichia_phage(30.77%)	48	20137:20154	66691:66708
AUK14404.1|14959_16330_-|transposase	IS1182 family transposase ISCfr1	transposase	NA	NA	NA	NA
AUK14405.1|16444_17581_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
AUK14406.1|17631_17877_-	hypothetical protein	NA	NA	NA	NA	NA
AUK14407.1|17882_18074_+	hypothetical protein	NA	NA	NA	NA	NA
AUK14408.1|18555_19098_-	tunicamycin resistance protein	NA	NA	NA	NA	NA
AUK14409.1|19110_19971_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
20137:20154	attL	AAACGGCACTGTTGCAAA	NA	NA	NA	NA
AUK14410.1|20203_20908_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUK14411.1|21320_22112_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AUK14412.1|22204_23464_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
AUK14477.1|23725_24517_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AUK14413.1|24662_25676_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUK14414.1|25614_26229_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AUK14415.1|26404_26965_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
AUK14416.1|29979_30222_+	relaxase	NA	NA	NA	NA	NA
AUK14417.1|30253_30931_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUK14418.1|31009_32209_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
AUK14419.1|32240_33125_-	EamA family transporter	NA	NA	NA	NA	NA
AUK14478.1|33262_33655_-	cysteine hydrolase	NA	NA	NA	NA	NA
AUK14420.1|35642_36050_-	hypothetical protein	NA	NA	NA	NA	NA
AUK14421.1|36111_36309_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
AUK14422.1|36695_37400_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUK14423.1|37810_37996_-	hypothetical protein	NA	NA	NA	NA	NA
AUK14424.1|38155_38281_+	ABC transporter	NA	NA	NA	NA	NA
AUK14425.1|39596_40568_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	38.1	2.4e-49
AUK14426.1|40863_41049_+	hypothetical protein	NA	NA	NA	NA	NA
AUK14427.1|41903_42695_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
AUK14479.1|42785_43013_-	hypothetical protein	NA	NA	NA	NA	NA
AUK14428.1|43163_43409_-	hypothetical protein	NA	NA	NA	NA	NA
AUK14429.1|43446_44310_-	short-chain dehydrogenase/reductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
AUK14480.1|44455_44695_-	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
AUK14430.1|44767_45472_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUK14431.1|45821_46286_-	mRNA interferase PemK	NA	NA	NA	NA	NA
AUK14432.1|46505_47159_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AUK14433.1|47348_47735_-	hypothetical protein	NA	NA	NA	NA	NA
AUK14434.1|48096_48966_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AUK14481.1|48946_49021_-	positive regulator of RepFIC repA1 expression	NA	NA	NA	NA	NA
AUK14482.1|49050_49215_+	replication protein RepA	NA	NA	NA	NA	NA
AUK14435.1|49258_49513_-	replication regulatory protein repA2	NA	NA	NA	NA	NA
AUK14436.1|49752_50343_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AUK14437.1|50381_50525_-	hypothetical protein	NA	NA	NA	NA	NA
AUK14438.1|51306_51867_-	conjugal transfer protein	NA	NA	NA	NA	NA
AUK14439.1|51921_52668_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.6	1.2e-08
AUK14440.1|52687_57958_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
AUK14483.1|60396_61131_-	complement resistance protein TraT	NA	NA	NA	NA	NA
AUK14441.1|61159_61663_-	surface exclusion protein	NA	NA	NA	NA	NA
AUK14484.1|61677_61893_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AUK14442.1|61917_62622_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUK14443.1|62655_63183_-|integrase	integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	35.9	3.1e-19
66691:66708	attR	AAACGGCACTGTTGCAAA	NA	NA	NA	NA
>prophage 2
CP024136	Escherichia coli strain 14EC017 plasmid p14EC017b, complete sequence	93781	86786	93667	93781	transposase	Escherichia_phage(33.33%)	9	NA	NA
AUK14468.1|86786_86957_+	pilus assembly protein	NA	A0A2L1IV26	Escherichia_phage	83.9	2.6e-07
AUK14469.1|87690_88014_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUK14470.1|88119_89253_+	permease	NA	NA	NA	NA	NA
AUK14471.1|89395_90100_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUK14472.1|90076_90391_+	hypothetical protein	NA	U5P0U6	Shigella_phage	100.0	5.4e-35
AUK14473.1|90384_90693_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	50.6	8.8e-14
AUK14474.1|90836_91268_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AUK14475.1|91518_92994_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AUK14476.1|92986_93667_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
>prophage 1
CP024137	Escherichia coli strain 14EC017 plasmid p14EC017c, complete sequence	107279	4636	72492	107279	transposase	Stx2-converting_phage(30.43%)	52	NA	NA
AUK14490.1|4636_5041_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
AUK14491.1|5037_5385_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AUK14492.1|5433_6972_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	1.3e-294
AUK14571.1|7206_10950_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	38.9	6.1e-218
AUK14493.1|11735_12948_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.3	1.4e-163
AUK14494.1|12914_13016_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	96.2	5.7e-07
AUK14495.1|14897_15185_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	5.8e-20
AUK14496.1|15181_15433_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AUK14497.1|15638_15827_+	hypothetical protein	NA	NA	NA	NA	NA
AUK14498.1|16198_16402_-	hypothetical protein	NA	NA	NA	NA	NA
AUK14499.1|16363_17576_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
AUK14500.1|18400_18802_-	lipoprotein, PulS/OutS family	NA	NA	NA	NA	NA
AUK14501.1|18895_19729_-	prepilin peptidase	NA	NA	NA	NA	NA
AUK14502.1|19780_20296_-	type II secretion system protein M	NA	NA	NA	NA	NA
AUK14503.1|20282_21455_-	type II secretion system protein GspL	NA	NA	NA	NA	NA
AUK14504.1|21493_22471_-	pullulanase	NA	NA	NA	NA	NA
AUK14505.1|22467_23067_-	type II secretion system protein GspJ	NA	NA	NA	NA	NA
AUK14572.1|23063_23411_-	type II secretion system protein GspI	NA	NA	NA	NA	NA
AUK14506.1|23425_23977_-	type II secretion system protein GspH	NA	NA	NA	NA	NA
AUK14507.1|23973_24408_-	type II secretion system protein GspG	NA	NA	NA	NA	NA
AUK14508.1|24438_25662_-	type II secretion system protein GspF	NA	NA	NA	NA	NA
AUK14509.1|25663_27166_-	type II secretion system protein GspE	NA	NA	NA	NA	NA
AUK14573.1|27162_29076_-	type II secretion system protein GspD	NA	A7BJX1	Enterobacteria_phage	27.6	1.9e-26
AUK14510.1|29133_30009_-	type II secretion system protein GspC	NA	NA	NA	NA	NA
AUK14511.1|30092_32753_-	peptidase M66	NA	NA	NA	NA	NA
AUK14512.1|33101_33353_-	hypothetical protein	NA	NA	NA	NA	NA
AUK14513.1|33349_33628_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	34.2	8.8e-05
AUK14514.1|33748_34962_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
AUK14515.1|35140_37351_+	Catalase-peroxidase 2	NA	NA	NA	NA	NA
AUK14516.1|37394_37784_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
AUK14517.1|37895_39108_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.0e-166
AUK14574.1|39158_39656_+	resolvase	NA	A0A1S6L009	Salmonella_phage	52.7	3.5e-28
AUK14518.1|42651_43977_+	hypothetical protein	NA	H6WZN2	Escherichia_phage	84.1	5.5e-222
AUK14519.1|44963_46177_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.0e-166
AUK14520.1|47142_47385_+	hypothetical protein	NA	NA	NA	NA	NA
AUK14521.1|47651_48473_+	carbohydrate transporter	NA	NA	NA	NA	NA
AUK14522.1|48472_49579_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AUK14523.1|49672_51394_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
AUK14524.1|51467_52466_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AUK14525.1|54920_55271_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	6.9e-39
AUK14526.1|55267_55693_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AUK14527.1|55707_56847_-	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	98.9	3.2e-202
AUK14528.1|56896_57244_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AUK14575.1|57240_57621_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
AUK14529.1|57770_58331_-	fertility inhibition protein	NA	NA	NA	NA	NA
AUK14530.1|58433_59294_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
AUK14531.1|59352_60099_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	1.2e-08
AUK14532.1|60118_65389_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
AUK14533.1|65388_67668_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
AUK14534.1|67921_68653_-	complement resistance protein TraT	NA	NA	NA	NA	NA
AUK14535.1|68666_69101_-	conjugal transfer protein TraS	NA	NA	NA	NA	NA
AUK14536.1|71278_72492_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.0e-166
