The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028783	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 chromosome, complete genome	5413765	446270	515648	5413765	head,protease,portal,tRNA,terminase,tail,capsid,integrase	uncultured_Caudovirales_phage(61.11%)	75	463878:463895	479873:479890
AWA50180.1|446270_447218_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
AWA50181.1|447232_447742_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
AWA50182.1|447870_448995_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AWA50183.1|448966_449440_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AWA50184.1|449465_450008_+	hypothetical protein	NA	NA	NA	NA	NA
AWA50185.1|450012_450585_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
AWA50186.1|450588_451407_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AWA50187.1|451403_451661_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AWA54786.1|451636_452191_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AWA50188.1|457986_458208_-	hypothetical protein	NA	NA	NA	NA	NA
AWA50189.1|458501_461612_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AWA50190.1|461624_462764_-	MexX family efflux pump subunit	NA	NA	NA	NA	NA
AWA50191.1|463142_463793_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
463878:463895	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AWA50192.1|464068_465295_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
AWA50193.1|465387_466329_+	hypothetical protein	NA	NA	NA	NA	NA
AWA50194.1|466510_466795_+	transcriptional regulator	NA	NA	NA	NA	NA
AWA50195.1|466805_467585_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
AWA50196.1|467708_467903_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AWA54787.1|468036_468306_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
AWA50197.1|468298_468487_+	hypothetical protein	NA	NA	NA	NA	NA
AWA50198.1|468479_468794_+	hypothetical protein	NA	NA	NA	NA	NA
AWA50199.1|468790_469159_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
AWA50200.1|469155_469521_+	hypothetical protein	NA	NA	NA	NA	NA
AWA50201.1|469520_471656_+	DNA primase	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AWA50202.1|471998_472334_+	hypothetical protein	NA	NA	NA	NA	NA
AWA50203.1|472382_472895_-	hypothetical protein	NA	NA	NA	NA	NA
AWA50204.1|473158_474325_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
AWA50205.1|474376_474937_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
AWA50206.1|474938_476180_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
AWA50207.1|476176_476512_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
AWA50208.1|476508_476808_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
AWA50209.1|476807_477251_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
AWA50210.1|477377_477569_+|terminase	terminase	terminase	NA	NA	NA	NA
AWA50211.1|477526_477883_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AWA50212.1|477866_479528_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
AWA50213.1|479530_479722_+	hypothetical protein	NA	NA	NA	NA	NA
AWA50214.1|479875_480172_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
479873:479890	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AWA50215.1|480196_481162_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AWA50216.1|481319_481514_-	hypothetical protein	NA	NA	NA	NA	NA
AWA50217.1|481519_482401_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AWA50218.1|482412_483864_-	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AWA50219.1|483853_484096_-	hypothetical protein	NA	NA	NA	NA	NA
AWA50220.1|484206_485556_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AWA50221.1|485566_486034_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AWA50222.1|486056_486509_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AWA50223.1|486732_487341_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AWA50224.1|487340_488342_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AWA50225.1|488570_488762_+	hypothetical protein	NA	NA	NA	NA	NA
AWA50226.1|488841_490782_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AWA50227.1|490903_491110_-	hypothetical protein	NA	NA	NA	NA	NA
AWA50228.1|491087_492131_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AWA50229.1|492201_493194_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AWA50230.1|493193_493682_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AWA50231.1|493689_494271_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AWA50232.1|494273_495743_+	ribonuclease G	NA	NA	NA	NA	NA
AWA50233.1|495780_499578_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
AWA50234.1|499666_501112_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AWA50235.1|501147_502077_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AWA50236.1|502208_502412_+	protein AaeX	NA	NA	NA	NA	NA
AWA50237.1|502419_503352_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AWA50238.1|503357_505325_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AWA50239.1|505404_505680_+	hypothetical protein	NA	NA	NA	NA	NA
AWA50240.1|505730_505997_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWA50241.1|506095_506359_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWA50242.1|506734_507205_-	arginine repressor	NA	NA	NA	NA	NA
AWA50243.1|507619_508558_+	malate dehydrogenase	NA	NA	NA	NA	NA
AWA50244.1|508694_509753_-|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AWA50245.1|509840_511208_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
AWA50246.1|511381_511780_-	DUF1043 domain-containing protein	NA	NA	NA	NA	NA
AWA50247.1|511970_513098_+	cell division protein ZapE	NA	NA	NA	NA	NA
AWA50248.1|513363_513792_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AWA50249.1|513807_514200_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AWA50250.1|514309_514513_-	hypothetical protein	NA	NA	NA	NA	NA
AWA50251.1|514511_515150_+	stringent starvation protein A	NA	NA	NA	NA	NA
AWA50252.1|515153_515648_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 2
CP028783	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 chromosome, complete genome	5413765	1235841	1311752	5413765	head,plate,portal,lysis,tRNA,tail,coat,capsid,integrase	Salmonella_phage(76.6%)	83	1234135:1234181	1270702:1270748
1234135:1234181	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AWA50952.1|1235841_1236867_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
AWA50953.1|1236869_1237499_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
AWA50954.1|1237621_1237864_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
AWA50955.1|1237896_1238406_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
AWA50956.1|1238413_1238614_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
AWA50957.1|1238577_1238916_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
AWA50958.1|1238983_1239217_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
AWA50959.1|1239216_1239444_+	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
AWA50960.1|1239440_1240292_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
AWA50961.1|1240288_1242673_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
AWA50962.1|1242835_1243024_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
AWA50963.1|1243035_1243269_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
AWA50964.1|1243364_1244048_-	hypothetical protein	NA	NA	NA	NA	NA
AWA50965.1|1244034_1245114_-	hypothetical protein	NA	NA	NA	NA	NA
AWA50966.1|1245113_1246115_-	hypothetical protein	NA	NA	NA	NA	NA
AWA50967.1|1246636_1246906_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
AWA50968.1|1246962_1248006_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
AWA50969.1|1248005_1249769_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
AWA50970.1|1249909_1250743_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
AWA50971.1|1250759_1251812_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
AWA50972.1|1251815_1252469_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
AWA50973.1|1252564_1253029_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
AWA50974.1|1253028_1253232_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
AWA54809.1|1253235_1253451_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
AWA50975.1|1253431_1253941_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
AWA50976.1|1253945_1254329_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
AWA50977.1|1254325_1254754_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
AWA50978.1|1254683_1254887_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	3.0e-23
AWA50979.1|1254849_1255272_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
AWA50980.1|1255264_1255711_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
AWA50981.1|1255733_1256600_-	hypothetical protein	NA	NA	NA	NA	NA
AWA50982.1|1256694_1257267_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
AWA50983.1|1257263_1257626_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
AWA50984.1|1257612_1258521_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
AWA50985.1|1258513_1259185_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
AWA50986.1|1259186_1261136_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
AWA50987.1|1261145_1262264_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
AWA50988.1|1262315_1263389_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
AWA50989.1|1263537_1264710_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
AWA50990.1|1264719_1265235_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
AWA50991.1|1265287_1265587_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
AWA50992.1|1265601_1265721_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AWA50993.1|1265713_1268344_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
AWA50994.1|1268340_1268826_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
AWA50995.1|1268822_1269917_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
AWA50996.1|1269983_1270202_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
AWA50997.1|1270229_1270607_-	hypothetical protein	NA	NA	NA	NA	NA
AWA50998.1|1271210_1271693_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1270702:1270748	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AWA50999.1|1271803_1272280_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AWA51000.1|1272269_1272560_+	RnfH family protein	NA	NA	NA	NA	NA
AWA51001.1|1272626_1272968_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AWA51002.1|1273115_1274777_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AWA51003.1|1274863_1275742_-	NAD(+) kinase	NA	NA	NA	NA	NA
AWA51004.1|1275866_1276457_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWA51005.1|1276576_1277863_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AWA51006.1|1277882_1278674_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AWA51007.1|1278837_1280202_+	signal recognition particle protein	NA	NA	NA	NA	NA
AWA51008.1|1280461_1280710_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AWA51009.1|1280728_1281277_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AWA51010.1|1281308_1282076_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AWA51011.1|1282115_1282463_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AWA51012.1|1282582_1283041_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AWA51013.1|1283097_1284468_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
AWA51014.1|1284476_1284959_-	OmpA family protein	NA	NA	NA	NA	NA
AWA51015.1|1284972_1286196_-	diguanylate cyclase	NA	NA	NA	NA	NA
AWA51016.1|1286188_1286698_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AWA51017.1|1287040_1288111_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
AWA51018.1|1288120_1289242_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AWA51019.1|1289304_1290177_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AWA51020.1|1290173_1291334_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AWA54810.1|1291434_1291482_-	hypothetical protein	NA	NA	NA	NA	NA
AWA51021.1|1291588_1291924_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AWA51022.1|1292194_1292932_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AWA51023.1|1293063_1294044_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AWA51024.1|1294040_1294772_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AWA51025.1|1294901_1297475_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
AWA51026.1|1303440_1304739_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
AWA51027.1|1304742_1305066_-	hypothetical protein	NA	NA	NA	NA	NA
AWA51028.1|1305107_1306463_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AWA51029.1|1306583_1309235_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AWA51030.1|1309269_1309968_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AWA51031.1|1310037_1310463_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
AWA51032.1|1310666_1311752_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
CP028783	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 chromosome, complete genome	5413765	1727294	1734199	5413765		Planktothrix_phage(33.33%)	6	NA	NA
AWA54825.1|1727294_1728158_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AWA51394.1|1728168_1728942_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AWA54826.1|1729182_1730076_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AWA51395.1|1730321_1731683_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AWA51396.1|1732001_1732724_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AWA51397.1|1732720_1734199_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 4
CP028783	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 chromosome, complete genome	5413765	2727444	2738331	5413765		Escherichia_phage(87.5%)	9	NA	NA
AWA52315.1|2727444_2730552_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AWA52316.1|2730606_2731872_+	MFS transporter	NA	NA	NA	NA	NA
AWA52317.1|2731902_2732991_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AWA52318.1|2733077_2733338_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AWA52319.1|2733635_2734496_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AWA52320.1|2734516_2735278_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWA52321.1|2735538_2736441_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
AWA52322.1|2736452_2737718_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
AWA52323.1|2737710_2738331_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
CP028783	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 chromosome, complete genome	5413765	2955267	3009088	5413765	transposase,plate,integrase,protease	Escherichia_phage(23.08%)	54	3002583:3002642	3008494:3009152
AWA54881.1|2955267_2956608_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AWA52521.1|2956620_2958165_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AWA52522.1|2958207_2958699_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AWA52523.1|2959339_2959906_+|protease	protease	protease	NA	NA	NA	NA
AWA52524.1|2960104_2961637_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
AWA52525.1|2961853_2962615_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
AWA52526.1|2962723_2963638_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWA52527.1|2963938_2964127_+	cold-shock protein	NA	NA	NA	NA	NA
AWA52528.1|2964197_2964506_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
AWA52529.1|2964511_2964649_+	glycosyl hydrolase family 2	NA	NA	NA	NA	NA
AWA52530.1|2964673_2965543_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
AWA52531.1|2965621_2966824_-	MFS transporter	NA	NA	NA	NA	NA
AWA52532.1|2966896_2968033_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWA52533.1|2968205_2969090_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWA52534.1|2969214_2970048_-	hypothetical protein	NA	NA	NA	NA	NA
AWA52535.1|2970278_2970665_+	glyoxalase	NA	NA	NA	NA	NA
AWA52536.1|2970832_2972449_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWA52537.1|2972634_2973342_+	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
AWA52538.1|2973338_2974304_-	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
AWA52539.1|2974406_2974913_+	thiol peroxidase	NA	NA	NA	NA	NA
AWA54882.1|2974983_2976006_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AWA52540.1|2976137_2977679_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
AWA52541.1|2977851_2979165_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AWA52542.1|2979296_2980178_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWA52543.1|2980267_2981329_-	TIGR01620 family protein	NA	NA	NA	NA	NA
AWA52544.1|2981325_2982723_-	YcjX family protein	NA	NA	NA	NA	NA
AWA52545.1|2982825_2983044_-	phage shock protein D	NA	NA	NA	NA	NA
AWA52546.1|2983072_2983432_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
AWA52547.1|2983431_2983656_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
AWA52548.1|2983711_2984380_-	phage shock protein PspA	NA	NA	NA	NA	NA
AWA54883.1|2984547_2985522_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
AWA52549.1|2986929_2988099_-	amidohydrolase	NA	NA	NA	NA	NA
AWA52550.1|2988270_2990580_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWA52551.1|2990558_2991389_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWA52552.1|2991499_2992405_+	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AWA52553.1|2992738_2994382_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
AWA52554.1|2994378_2995344_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
AWA52555.1|2995548_2996220_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
AWA54884.1|2996406_2997234_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
AWA52556.1|2997309_2998575_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
AWA52557.1|2998576_2998996_-	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
AWA52558.1|2999075_3000560_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWA52559.1|3000559_3000811_-	hypothetical protein	NA	NA	NA	NA	NA
AWA52560.1|3001457_3001880_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
AWA52561.1|3002472_3003177_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
3002583:3002642	attL	TGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCA	NA	NA	NA	NA
AWA52562.1|3003353_3004118_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWA52563.1|3004205_3004319_+	NTP-binding protein	NA	NA	NA	NA	NA
AWA52564.1|3004624_3005125_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWA52565.1|3005143_3005323_+	hypothetical protein	NA	NA	NA	NA	NA
AWA52566.1|3005252_3006092_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AWA52567.1|3006085_3006433_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWA54885.1|3006596_3007388_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AWA52568.1|3007533_3008493_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
AWA52569.1|3008383_3009088_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
3008494:3009152	attR	TGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCC	NA	NA	NA	NA
>prophage 6
CP028783	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 chromosome, complete genome	5413765	3013080	3057294	5413765	transposase,terminase,holin,tail,integrase	Klebsiella_phage(25.58%)	54	3042463:3042478	3065302:3065317
AWA52574.1|3013080_3016035_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
AWA52575.1|3016111_3019180_-	kinase	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
AWA52576.1|3019176_3019557_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
AWA52577.1|3019566_3020049_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
AWA52578.1|3020229_3020694_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
AWA52579.1|3021008_3021344_-	hypothetical protein	NA	NA	NA	NA	NA
AWA52580.1|3021427_3024325_-|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
AWA54886.1|3024586_3024778_-	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
AWA52581.1|3025002_3025359_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
AWA52582.1|3025435_3025612_-	hypothetical protein	NA	NA	NA	NA	NA
AWA52583.1|3025779_3026262_-	hypothetical protein	NA	NA	NA	NA	NA
AWA52584.1|3026315_3027488_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
AWA52585.1|3027511_3027904_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AWA52586.1|3027900_3028452_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
AWA52587.1|3028453_3028837_-	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
AWA52588.1|3028823_3029057_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
AWA52589.1|3029066_3029321_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
AWA52590.1|3029322_3029718_-	protein singed	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
AWA52591.1|3030039_3030993_-	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
AWA52592.1|3031003_3031789_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
AWA52593.1|3032319_3033432_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
AWA52594.1|3033415_3034816_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
AWA52595.1|3034815_3036123_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
AWA52596.1|3036100_3037105_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
AWA52597.1|3037653_3037839_-	hypothetical protein	NA	NA	NA	NA	NA
AWA52598.1|3037967_3038213_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
AWA52599.1|3039026_3039221_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	1.4e-25
AWA52600.1|3039171_3039447_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
AWA52601.1|3039443_3039788_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
AWA52602.1|3039784_3040324_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
AWA52603.1|3040320_3040632_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	3.8e-49
AWA52604.1|3041098_3042145_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
3042463:3042478	attL	CATTTTTTTGCTCGTT	NA	NA	NA	NA
AWA52605.1|3042546_3043575_+	hypothetical protein	NA	NA	NA	NA	NA
AWA52606.1|3043782_3044028_-	hypothetical protein	NA	NA	NA	NA	NA
AWA52607.1|3044083_3044386_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWA52608.1|3044382_3045231_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
AWA52609.1|3045227_3046088_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
AWA52610.1|3046173_3046395_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AWA52611.1|3046435_3046663_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
AWA52612.1|3046774_3047473_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
AWA54887.1|3047495_3047615_+	hypothetical protein	NA	NA	NA	NA	NA
AWA52613.1|3047760_3048837_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
AWA52614.1|3048918_3049122_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
AWA52615.1|3049550_3049745_+	hypothetical protein	NA	NA	NA	NA	NA
AWA52616.1|3049833_3050118_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
AWA52617.1|3050133_3050979_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
AWA52618.1|3051264_3051945_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
AWA52619.1|3051941_3052370_+	regulator	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
AWA52620.1|3052366_3053029_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
AWA52621.1|3053025_3053340_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
AWA54888.1|3053236_3054424_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
AWA52622.1|3054600_3055491_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
AWA52623.1|3055490_3056483_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AWA52624.1|3056484_3057294_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
3065302:3065317	attR	AACGAGCAAAAAAATG	NA	NA	NA	NA
>prophage 7
CP028783	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 chromosome, complete genome	5413765	3433383	3526334	5413765	head,plate,protease,portal,lysis,tRNA,tail,capsid,integrase	Salmonella_phage(56.14%)	96	3488909:3488927	3526409:3526427
AWA52976.1|3433383_3434676_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AWA52977.1|3434766_3436110_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
AWA52978.1|3436118_3436730_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AWA52979.1|3436852_3441106_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
AWA52980.1|3441241_3441736_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AWA52981.1|3442268_3443237_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
AWA52982.1|3443351_3445118_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
AWA52983.1|3445118_3446840_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AWA54903.1|3446884_3447586_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWA52984.1|3447939_3448158_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWA52985.1|3448278_3450558_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AWA52986.1|3450588_3450906_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AWA52987.1|3451231_3451453_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AWA52988.1|3451407_3451590_-	hypothetical protein	NA	NA	NA	NA	NA
AWA52989.1|3451529_3453470_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AWA52990.1|3453466_3454582_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AWA52991.1|3454728_3456387_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AWA52992.1|3456806_3457502_+	aquaporin Z	NA	NA	NA	NA	NA
AWA52993.1|3457617_3458517_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
AWA54904.1|3458660_3460313_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AWA52994.1|3460323_3461292_+	NADH oxidoreductase	NA	NA	NA	NA	NA
AWA52995.1|3461242_3461446_+	hypothetical protein	NA	NA	NA	NA	NA
AWA52996.1|3461503_3461938_-	DoxX family protein	NA	NA	NA	NA	NA
AWA54905.1|3462089_3463808_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AWA52997.1|3463846_3464848_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AWA52998.1|3464858_3466301_+	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
AWA52999.1|3466388_3467402_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWA53000.1|3467398_3468229_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
AWA53001.1|3468260_3469400_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AWA53002.1|3469452_3469632_+	hypothetical protein	NA	NA	NA	NA	NA
AWA53003.1|3470277_3470793_+	lipoprotein	NA	NA	NA	NA	NA
AWA53004.1|3471019_3471748_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
AWA54906.1|3471768_3472500_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWA53005.1|3472506_3473223_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AWA53006.1|3473222_3473891_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AWA53007.1|3474074_3474806_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWA53008.1|3474848_3476321_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
AWA53009.1|3476317_3477034_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
AWA53010.1|3477112_3478240_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AWA53011.1|3478281_3478770_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AWA53012.1|3478827_3479673_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AWA53013.1|3479669_3480623_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AWA54907.1|3480633_3481767_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AWA53014.1|3481930_3483043_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AWA53015.1|3483391_3483871_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AWA53016.1|3483959_3484862_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
AWA53017.1|3485683_3485971_-	hypothetical protein	NA	NA	NA	NA	NA
AWA53018.1|3486173_3486437_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AWA53019.1|3486443_3486827_-	hypothetical protein	NA	NA	NA	NA	NA
AWA54908.1|3487093_3488779_+	transporter	NA	NA	NA	NA	NA
3488909:3488927	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
AWA53020.1|3488998_3489217_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AWA53021.1|3489308_3490409_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
AWA53022.1|3490405_3490891_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
AWA53023.1|3490887_3493515_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
AWA53024.1|3493507_3493627_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AWA53025.1|3493641_3493941_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
AWA53026.1|3493993_3494509_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AWA53027.1|3494518_3495691_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
AWA53028.1|3495829_3496906_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
AWA53029.1|3496935_3497139_-	hypothetical protein	NA	NA	NA	NA	NA
AWA53030.1|3497135_3497867_-	hypothetical protein	NA	NA	NA	NA	NA
AWA53031.1|3497870_3500822_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
AWA54909.1|3500823_3501423_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
AWA53032.1|3501415_3502324_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
AWA53033.1|3502669_3503242_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
AWA53034.1|3503336_3504029_+	hypothetical protein	NA	NA	NA	NA	NA
AWA53035.1|3504025_3504472_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
AWA53036.1|3504464_3504896_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AWA53037.1|3504991_3505420_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
AWA53038.1|3505416_3505800_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
AWA53039.1|3505804_3506314_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
AWA53040.1|3506294_3506510_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
AWA53041.1|3506513_3506717_-|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AWA53042.1|3506716_3507181_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
AWA53043.1|3507276_3507927_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AWA53044.1|3507930_3508989_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
AWA53045.1|3509005_3509839_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AWA53046.1|3509981_3511748_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
AWA53047.1|3511747_3512773_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
AWA53048.1|3512834_3514577_-	hypothetical protein	NA	NA	NA	NA	NA
AWA53049.1|3514852_3515530_-	hypothetical protein	NA	NA	NA	NA	NA
AWA53050.1|3515644_3515950_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AWA54910.1|3515888_3516077_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AWA53051.1|3516230_3518645_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AWA53052.1|3518641_3519499_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
AWA53053.1|3519495_3519723_-	hypothetical protein	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
AWA53054.1|3519722_3519956_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
AWA53055.1|3520023_3520365_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AWA53056.1|3520328_3520529_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
AWA53057.1|3520536_3521046_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AWA53058.1|3521078_3521300_-	regulator	NA	NA	NA	NA	NA
AWA53059.1|3521445_3522324_+	Repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
AWA53060.1|3522335_3523280_+	hypothetical protein	NA	NA	NA	NA	NA
AWA53061.1|3523378_3524863_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWA53062.1|3524862_3525114_-	hypothetical protein	NA	NA	NA	NA	NA
AWA53063.1|3525281_3526334_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3526409:3526427	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 8
CP028783	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 chromosome, complete genome	5413765	3942916	4019045	5413765	head,transposase,lysis,tRNA,terminase,tail,coat,integrase	Escherichia_phage(22.95%)	92	3964657:3964703	4016117:4016163
AWA53432.1|3942916_3944434_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
AWA53433.1|3944765_3946241_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
AWA53434.1|3946300_3948448_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
AWA53435.1|3948530_3949865_-	lysine:cadaverine antiporter	NA	NA	NA	NA	NA
AWA53436.1|3950230_3951799_-	transcriptional regulator CadC	NA	NA	NA	NA	NA
AWA53437.1|3952091_3952364_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWA53438.1|3952464_3953385_-	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
AWA53439.1|3953895_3954762_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWA53440.1|3954784_3955810_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AWA53441.1|3955811_3958247_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AWA53442.1|3958257_3958953_-	molecular chaperone	NA	NA	NA	NA	NA
AWA53443.1|3959011_3959572_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AWA53444.1|3960043_3960706_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AWA53445.1|3960683_3960989_+	hypothetical protein	NA	NA	NA	NA	NA
AWA53446.1|3961041_3962346_-	citrate synthase	NA	NA	NA	NA	NA
AWA53447.1|3962590_3962779_+	hypothetical protein	NA	NA	NA	NA	NA
AWA53448.1|3962856_3963027_+	ATP-NAD kinase	NA	NA	NA	NA	NA
AWA53449.1|3963105_3963507_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AWA53450.1|3963902_3964196_-	hypothetical protein	NA	NA	NA	NA	NA
3964657:3964703	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AWA53451.1|3964858_3965176_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.9	3.7e-23
AWA53452.1|3965175_3965415_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	50.6	6.1e-15
AWA53453.1|3965492_3966977_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWA53454.1|3966976_3967228_-	hypothetical protein	NA	NA	NA	NA	NA
AWA53455.1|3967429_3967639_-	hypothetical protein	NA	NA	NA	NA	NA
AWA53456.1|3967635_3968367_-	hypothetical protein	NA	NA	NA	NA	NA
AWA54932.1|3968370_3969240_-	hypothetical protein	NA	NA	NA	NA	NA
AWA53457.1|3970979_3972100_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
AWA53458.1|3972669_3975147_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	45.6	2.7e-198
AWA53459.1|3975133_3975529_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
AWA53460.1|3975525_3975996_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
AWA54933.1|3975995_3976415_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
AWA53461.1|3976514_3979961_-	hypothetical protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
AWA53462.1|3980053_3980557_-	hypothetical protein	NA	NA	NA	NA	NA
AWA53463.1|3980684_3981470_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
AWA53464.1|3981535_3982249_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
AWA53465.1|3982238_3982409_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
AWA53466.1|3982508_3982868_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
AWA53467.1|3982884_3983355_-	hypothetical protein	NA	NA	NA	NA	NA
AWA53468.1|3983648_3983903_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
AWA53469.1|3983905_3984661_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
AWA53470.1|3984836_3985514_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
AWA53471.1|3985566_3986319_-	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
AWA53472.1|3986387_3986780_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
AWA53473.1|3986776_3987202_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
AWA53474.1|3987204_3987567_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
AWA53475.1|3987566_3987740_-	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
AWA53476.1|3987739_3988120_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
AWA53477.1|3988122_3988362_-	hypothetical protein	NA	NA	NA	NA	NA
AWA53478.1|3988372_3989467_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	62.8	1.7e-123
AWA53479.1|3989478_3989907_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
AWA53480.1|3989910_3991296_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
AWA53481.1|3991368_3991845_-	hypothetical protein	NA	NA	NA	NA	NA
AWA53482.1|3991886_3992891_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
AWA53483.1|3992865_3994287_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
AWA53484.1|3994299_3995772_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
AWA53485.1|3995771_3996374_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
AWA53486.1|3996744_3997074_+	hypothetical protein	NA	NA	NA	NA	NA
AWA53487.1|3997179_3997644_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
AWA53488.1|3997640_3998171_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
AWA53489.1|3998173_3998422_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AWA53490.1|3999158_4000205_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
AWA53491.1|4000432_4001122_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
AWA53492.1|4001118_4001649_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
AWA53493.1|4001641_4001779_-	YlcG family protein	NA	NA	NA	NA	NA
AWA53494.1|4001775_4002411_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
AWA53495.1|4002403_4002574_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
AWA53496.1|4002573_4003029_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
AWA53497.1|4003281_4003530_-	hypothetical protein	NA	NA	NA	NA	NA
AWA53498.1|4003529_4004177_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
AWA53499.1|4004349_4005192_-	addiction module toxin RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
AWA53500.1|4005298_4005805_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	58.7	1.1e-26
AWA53501.1|4005801_4006095_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
AWA53502.1|4006094_4007525_-	replicative DNA helicase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
AWA53503.1|4007514_4008414_-	DNA replication protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
AWA53504.1|4008638_4008860_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AWA53505.1|4008900_4009134_-	transcriptional regulator	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
AWA53506.1|4009261_4009951_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
AWA53507.1|4010301_4010517_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
AWA53508.1|4010616_4010811_+	hypothetical protein	NA	NA	NA	NA	NA
AWA53509.1|4010899_4011184_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
AWA53510.1|4011199_4012045_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
AWA53511.1|4012041_4012722_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
AWA53512.1|4012718_4012877_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
AWA53513.1|4012873_4013530_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
AWA53514.1|4013526_4014294_+	dcm methylase	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
AWA53515.1|4014290_4014509_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
AWA53516.1|4014510_4014726_+	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
AWA54934.1|4014727_4015063_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWA54935.1|4015059_4016103_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	86.2	2.5e-177
AWA53517.1|4016533_4017400_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4016117:4016163	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AWA53518.1|4017401_4017614_+	ribosome-associated protein	NA	NA	NA	NA	NA
AWA53519.1|4017659_4019045_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 9
CP028783	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 chromosome, complete genome	5413765	4228600	4240254	5413765	integrase	Enterobacteria_phage(70.0%)	13	4229050:4229064	4252107:4252121
AWA53715.1|4228600_4229704_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4229050:4229064	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
AWA53716.1|4229714_4230968_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
AWA53717.1|4231320_4232511_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
AWA53718.1|4232498_4233449_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
AWA53719.1|4233448_4233874_+	hypothetical protein	NA	NA	NA	NA	NA
AWA53720.1|4234442_4235009_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
AWA53721.1|4235026_4235272_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
AWA53722.1|4235268_4236006_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
AWA53723.1|4236547_4236814_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
AWA53724.1|4236810_4237368_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
AWA53725.1|4237364_4237592_+	hypothetical protein	NA	NA	NA	NA	NA
AWA53726.1|4237588_4237909_+	hypothetical protein	NA	NA	NA	NA	NA
AWA53727.1|4237920_4240254_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4252107:4252121	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 10
CP028783	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 chromosome, complete genome	5413765	5215280	5303850	5413765	plate,protease,portal,tRNA,terminase,tail,capsid,integrase	Enterobacteria_phage(34.88%)	89	5264391:5264432	5299628:5299669
AWA54583.1|5215280_5216801_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AWA54584.1|5216825_5217164_-	DUF413 domain-containing protein	NA	NA	NA	NA	NA
AWA54585.1|5217282_5218104_+	HTH-type transcriptional regulator HdfR	NA	NA	NA	NA	NA
AWA54586.1|5223953_5224805_-	glutamate racemase	NA	NA	NA	NA	NA
AWA54587.1|5224749_5226588_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.2	1.7e-08
AWA54588.1|5226954_5228055_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
AWA54589.1|5228106_5228466_-	hypothetical protein	NA	NA	NA	NA	NA
AWA54590.1|5228481_5229117_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
AWA54591.1|5229313_5230714_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AWA54592.1|5230696_5231614_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
AWA54593.1|5231872_5233246_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AWA54991.1|5233204_5233387_+	hypothetical protein	NA	NA	NA	NA	NA
AWA54594.1|5233345_5234122_-	acetylglutamate kinase	NA	NA	NA	NA	NA
AWA54595.1|5234128_5235133_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AWA54596.1|5235246_5236398_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
AWA54597.1|5236656_5239308_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AWA54598.1|5239351_5240002_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
AWA54599.1|5240149_5241013_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWA54600.1|5241218_5241881_+	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	1.0e-27
AWA54601.1|5241935_5243039_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
AWA54602.1|5243102_5243984_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AWA54603.1|5244127_5245015_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AWA54604.1|5245243_5246152_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWA54605.1|5246243_5246615_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AWA54606.1|5246652_5248209_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	23.8	5.6e-08
AWA54607.1|5248347_5249484_+	cytoplasmic protein	NA	NA	NA	NA	NA
AWA54608.1|5249458_5251891_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
AWA54609.1|5251893_5253054_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AWA54610.1|5253321_5253639_+	met repressor	NA	NA	NA	NA	NA
AWA54611.1|5253740_5253953_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
AWA54612.1|5254205_5256401_+	primosomal protein N'	NA	NA	NA	NA	NA
AWA54613.1|5256551_5257580_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
AWA54614.1|5257673_5258642_+	cell division protein FtsN	NA	NA	NA	NA	NA
AWA54615.1|5258733_5259264_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AWA54616.1|5259273_5260608_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.5	2.1e-43
AWA54992.1|5260671_5261598_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AWA54617.1|5261690_5262176_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AWA54618.1|5262237_5263200_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
AWA54619.1|5263396_5264299_-	cation-efflux pump FieF	NA	NA	NA	NA	NA
5264391:5264432	attL	AAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
AWA54620.1|5264655_5264901_+	DUF4177 domain-containing protein	NA	A0A0A7NPW2	Enterobacteria_phage	57.5	4.2e-19
AWA54621.1|5264901_5265117_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
AWA54622.1|5265144_5265393_-	hypothetical protein	NA	NA	NA	NA	NA
AWA54623.1|5265438_5266593_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	73.6	3.9e-163
AWA54624.1|5266744_5267926_+|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.6	6.1e-156
AWA54625.1|5267926_5268442_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	70.0	2.6e-63
AWA54626.1|5268493_5268793_+|tail	phage tail protein	tail	B9A7B2	Serratia_phage	72.7	2.2e-30
AWA54627.1|5268813_5268966_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	71.4	1.5e-11
AWA54628.1|5268955_5271691_+|tail	phage tail tape measure protein	tail	B9A7B3	Serratia_phage	79.0	5.6e-237
AWA54629.1|5271702_5272191_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	60.5	7.5e-52
AWA54630.1|5272288_5273362_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	45.5	2.5e-31
AWA54631.1|5273376_5276712_-	SGNH/GDSL hydrolase family protein	NA	A0A1I9SEN3	Klebsiella_phage	31.7	1.5e-98
AWA54993.1|5276708_5277317_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	45.9	4.7e-43
AWA54632.1|5277309_5278209_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	62.5	4.3e-93
AWA54633.1|5278195_5278564_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	57.4	2.3e-29
AWA54634.1|5278560_5279145_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.6	9.6e-62
AWA54635.1|5279144_5279786_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	49.8	1.4e-45
AWA54636.1|5279782_5280241_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	46.8	3.1e-31
AWA54637.1|5280385_5280781_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AWA54638.1|5280777_5281329_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	42.5	6.8e-33
AWA54639.1|5281325_5281607_-	hypothetical protein	NA	NA	NA	NA	NA
AWA54640.1|5281597_5281798_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	64.6	2.3e-15
AWA54641.1|5281797_5282295_-|capsid	capsid assembly protein	capsid	B9A7B7	Serratia_phage	69.7	2.2e-59
AWA54642.1|5282397_5283258_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	68.4	1.0e-83
AWA54643.1|5283304_5284354_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	53.9	2.3e-106
AWA54644.1|5284377_5285211_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.6	1.1e-95
AWA54645.1|5285371_5287093_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	66.5	4.3e-227
AWA54646.1|5287113_5288148_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.9	3.1e-140
AWA54647.1|5288580_5289414_-	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	83.4	6.7e-133
AWA54648.1|5289410_5289626_-	multidrug ABC transporter ATPase	NA	A0A1J0I2F3	Salmonella_phage	86.2	1.1e-18
AWA54994.1|5289880_5290576_-	DNA methylase	NA	A0A0M4S5U3	Salmonella_phage	69.8	1.2e-90
AWA54649.1|5290679_5290895_-	hypothetical protein	NA	NA	NA	NA	NA
AWA54650.1|5290891_5293519_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	53.6	1.3e-195
AWA54651.1|5293511_5294516_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	58.6	2.3e-103
AWA54652.1|5294816_5295704_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	55.2	9.1e-80
AWA54653.1|5295696_5295891_-	hypothetical protein	NA	NA	NA	NA	NA
AWA54654.1|5295887_5296115_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	40.6	1.4e-05
AWA54655.1|5296123_5296672_-	3'-5' exoribonuclease	NA	NA	NA	NA	NA
AWA54656.1|5296668_5296893_-	hypothetical protein	NA	NA	NA	NA	NA
AWA54657.1|5296962_5297235_-	hypothetical protein	NA	NA	NA	NA	NA
AWA54658.1|5297249_5297480_-	hypothetical protein	NA	A0A0M4S6M9	Salmonella_phage	68.6	1.5e-23
AWA54659.1|5297495_5297714_-	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	9.6e-07
AWA54660.1|5297740_5298013_-	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	84.4	1.1e-39
AWA54661.1|5298166_5298460_+	XRE family transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	58.8	7.3e-26
AWA54662.1|5298529_5299510_+|integrase	integrase	integrase	U5N0A8	Enterobacteria_phage	83.3	2.4e-153
AWA54663.1|5299694_5300198_-	stress adaptor protein CpxP	NA	NA	NA	NA	NA
5299628:5299669	attR	AAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
AWA54664.1|5300347_5301046_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
AWA54665.1|5301042_5302416_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
AWA54666.1|5302482_5303157_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AWA54667.1|5303229_5303850_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	3.5e-62
>prophage 1
CP028781	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence	159394	4961	66699	159394	transposase,protease,holin	uncultured_Caudovirales_phage(29.41%)	55	NA	NA
AWA49542.1|4961_5885_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
AWA49543.1|6557_6815_-	hypothetical protein	NA	NA	NA	NA	NA
AWA49544.1|7416_8871_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AWA49545.1|9853_11131_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AWA49546.1|11193_13197_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
AWA49679.1|14230_15438_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
AWA49547.1|16866_17298_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AWA49548.1|17548_19024_-	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AWA49549.1|19016_19697_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
AWA49550.1|19886_21272_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49551.1|21300_21654_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWA49552.1|21767_23060_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWA49553.1|23070_26217_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
AWA49554.1|26303_26744_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49555.1|26870_29318_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
AWA49556.1|29358_29556_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AWA49557.1|29589_30327_-	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AWA49558.1|30615_31065_-	copper resistance protein	NA	NA	NA	NA	NA
AWA49559.1|31298_33116_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AWA49560.1|33115_34012_+	copper resistance protein B	NA	NA	NA	NA	NA
AWA49561.1|34051_34432_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AWA49562.1|34436_35366_+	copper resistance protein D	NA	NA	NA	NA	NA
AWA49563.1|35420_36101_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AWA49564.1|36097_37498_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AWA49565.1|37714_38149_+	copper-binding protein	NA	NA	NA	NA	NA
AWA49680.1|38380_38560_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWA49566.1|40302_40812_+	porin	NA	NA	NA	NA	NA
AWA49567.1|40861_41359_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWA49568.1|41690_42017_+	transcriptional regulator	NA	NA	NA	NA	NA
AWA49681.1|42016_42727_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
AWA49569.1|42735_43281_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AWA49570.1|43356_43719_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AWA49571.1|45615_46152_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWA49572.1|46184_46610_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
AWA49573.1|46622_47912_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
AWA49574.1|47959_49711_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AWA49575.1|49728_50091_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AWA49576.1|50140_50491_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
AWA49577.1|50848_51118_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49578.1|51105_51681_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49579.1|51711_52206_+	DNA-binding protein	NA	NA	NA	NA	NA
AWA49580.1|52249_52618_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49581.1|52651_52855_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AWA49582.1|52903_53161_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49583.1|53236_53491_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49584.1|53666_53933_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AWA49585.1|53920_54403_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWA49682.1|54614_55961_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AWA49586.1|57803_58766_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AWA49587.1|58752_59502_-	diguanylate cyclase	NA	NA	NA	NA	NA
AWA49588.1|59739_59937_-	hypothetical protein	NA	NA	NA	NA	NA
AWA49589.1|59936_62732_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
AWA49590.1|62846_63416_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AWA49683.1|63450_63732_-	DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
AWA49591.1|65718_66699_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 2
CP028781	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence	159394	71485	120461	159394	transposase,coat	Escherichia_phage(28.57%)	54	NA	NA
AWA49595.1|71485_72313_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
AWA49596.1|73168_73873_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWA49597.1|75176_75845_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
AWA49598.1|76034_76850_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AWA49599.1|77000_77705_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA49600.1|77738_78095_-	sOS mutagenesis and repair protein UmuD	NA	A0A222YZE2	Escherichia_phage	46.6	5.5e-20
AWA49601.1|78097_78337_-	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
AWA49602.1|78438_79659_+|transposase	ISL3 family transposase ISKox3	transposase	NA	NA	NA	NA
AWA49687.1|79747_80410_-	resolvase	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
AWA49603.1|80790_81453_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
AWA49604.1|81552_81837_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AWA49605.1|82042_82354_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49606.1|82389_82674_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49688.1|82694_83048_-	DNA distortion polypeptide 3	NA	NA	NA	NA	NA
AWA49689.1|83235_83679_-	hypothetical protein	NA	NA	NA	NA	NA
AWA49607.1|83687_84701_-	replication initiation protein	NA	NA	NA	NA	NA
AWA49608.1|86053_86569_+	molecular chaperone DnaJ	NA	A0A2K9L588	Tupanvirus	39.8	3.3e-05
AWA49609.1|86627_86864_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49610.1|86923_87475_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49611.1|87540_87753_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49612.1|87742_87985_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49613.1|88078_88417_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49614.1|88790_89006_-	hypothetical protein	NA	NA	NA	NA	NA
AWA49690.1|89250_89796_+	DNA distortion polypeptide 1	NA	NA	NA	NA	NA
AWA49615.1|89798_90959_+|coat	spore coat protein CotH	coat	NA	NA	NA	NA
AWA49616.1|91311_91821_+	transcription termination factor NusG	NA	NA	NA	NA	NA
AWA49617.1|91771_92008_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49618.1|92053_92698_+	transglycosylase	NA	NA	NA	NA	NA
AWA49619.1|92681_92972_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49620.1|92996_95750_+	conjugal transfer protein	NA	NA	NA	NA	NA
AWA49621.1|95759_96530_+	pilus assembly protein	NA	NA	NA	NA	NA
AWA49622.1|96539_96797_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49623.1|96808_97864_+	pilus assembly protein	NA	NA	NA	NA	NA
AWA49624.1|98058_98787_+	pilus assembly protein	NA	NA	NA	NA	NA
AWA49625.1|98792_99722_+	conjugal transfer protein	NA	NA	NA	NA	NA
AWA49626.1|99718_100933_+	type IV secretion system protein VirB10	NA	NA	NA	NA	NA
AWA49627.1|100934_101132_+	DNA-binding protein	NA	NA	NA	NA	NA
AWA49628.1|101128_102163_+	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
AWA49629.1|102159_104001_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AWA49630.1|103997_104390_+	conjugal transfer protein	NA	NA	NA	NA	NA
AWA49631.1|104477_104792_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49632.1|104877_105204_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49633.1|105200_105695_+	micrococcal nuclease	NA	A0A0R6PHV6	Moraxella_phage	37.3	8.0e-17
AWA49634.1|105777_107040_+	ATP-binding protein	NA	A0A1V0SKF8	Klosneuvirus	31.4	1.3e-07
AWA49635.1|107043_109371_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.1	8.6e-37
AWA49636.1|109382_109838_+	DNA-binding protein	NA	NA	NA	NA	NA
AWA49637.1|109875_110526_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AWA49638.1|110798_110978_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49639.1|110974_111796_+	sprT domain-containing protein	NA	NA	NA	NA	NA
AWA49640.1|111905_112160_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49641.1|112177_112453_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49691.1|112515_112728_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49642.1|112685_112871_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49643.1|117473_120461_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.6	2.4e-294
>prophage 1
CP028782	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pQnrB52_020046, complete sequence	74017	6388	64447	74017	integrase,transposase	Escherichia_phage(33.33%)	54	8114:8173	60106:60927
AWA49696.1|6388_7465_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
8114:8173	attL	CGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
AWA49697.1|8177_8882_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA49698.1|9319_9634_-|transposase	transposase	transposase	NA	NA	NA	NA
AWA49699.1|9572_10586_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWA49755.1|10877_11432_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AWA49700.1|11528_11981_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
AWA49701.1|12113_12587_+	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	G3MBI7	Bacillus_virus	29.1	1.4e-15
AWA49756.1|12767_13613_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA16	NA	NA	NA	NA	NA
AWA49702.1|13729_14077_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWA49703.1|14070_14910_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWA49704.1|15314_16856_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWA49705.1|18162_18615_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
AWA49706.1|18656_19301_-	quinolone resistance pentapeptide repeat protein QnrB52	NA	NA	NA	NA	NA
AWA49707.1|19791_20631_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWA49708.1|20560_20740_-	hypothetical protein	NA	NA	NA	NA	NA
AWA49709.1|20758_21259_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWA49710.1|21564_21678_-	NTP-binding protein	NA	NA	NA	NA	NA
AWA49711.1|21765_22530_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWA49712.1|22571_22784_+	resolvase	NA	NA	NA	NA	NA
AWA49713.1|22796_24005_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AWA49714.1|24038_25472_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AWA49715.1|25853_26060_-	hypothetical protein	NA	NA	NA	NA	NA
AWA49716.1|26064_26577_-	restriction endonuclease	NA	NA	NA	NA	NA
AWA49717.1|26601_27306_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA49718.1|27251_27512_-	hypothetical protein	NA	NA	NA	NA	NA
AWA49719.1|28057_28444_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49720.1|28452_28644_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AWA49721.1|29655_30411_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
AWA49722.1|30411_30606_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49723.1|31089_31278_-	hypothetical protein	NA	NA	NA	NA	NA
AWA49724.1|31983_33399_-	hypothetical protein	NA	NA	NA	NA	NA
AWA49725.1|33395_35123_-	hypothetical protein	NA	NA	NA	NA	NA
AWA49726.1|37252_38515_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AWA49727.1|38764_39640_+	class A extended-spectrum beta-lactamase CTX-M-27	NA	A0A1B0VBP7	Salmonella_phage	100.0	1.2e-153
AWA49728.1|39719_40643_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
AWA49729.1|43219_43495_+	regulator protein FrmR	NA	NA	NA	NA	NA
AWA49730.1|43525_44635_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.1	3.7e-30
AWA49731.1|44676_45075_+	VOC family protein	NA	NA	NA	NA	NA
AWA49732.1|45138_45975_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AWA49733.1|46002_46638_-	resolvase	NA	NA	NA	NA	NA
AWA49734.1|46805_49793_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.6	2.4e-294
AWA49735.1|50127_53094_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AWA49757.1|53102_53504_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49736.1|53588_54293_-|transposase	IS6 family transposase IS1006	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
AWA49737.1|55217_56102_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AWA49738.1|56318_57533_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
AWA49739.1|57806_58031_-	hypothetical protein	NA	NA	NA	NA	NA
AWA49740.1|58027_58765_-	resolvase	NA	NA	NA	NA	NA
AWA49741.1|58871_59363_+	hypothetical protein	NA	NA	NA	NA	NA
AWA49742.1|59396_60101_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA49743.1|60112_60769_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWA49744.1|60864_62049_+	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
60106:60927	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGTAAGCTGCACCTCAAACCCCCGGATCAGGCTCTCCAGGCCATGCAGAAAGGCCTGCTCACCATCATCACTGTCCATAATCTGCAGCGCTTCCCGCAATAGCGGCGGCAGGTTTTCGTCCGGTGCTGCAGGGCGGTCGGTCAGGGCGGCAGTATGCTCCTGCTGCTCCAGTACGGCACCAAGGGTAAAATGACTGACCGCTGAAATCGCATATAACCCGTCGCGCAGTGAAAAGCCGTTTTCTGTCATAAAGCGTAACTGGGTTTCCACCGTATCATACTGTTTTTCATCAGGGCGGGTGCCGAGGTGCACTTTTGCCCCGTCACGGTAACGCAGCAGCGCCCGGCGGAAACTCATTGCATTATTGCGCAGAAATGACTGCCAGGATTCCCCCGCCGCAGGCAGTGAATAATCATGATGACGCGCCAGGATCTCCACCGCCAGCGCATCCAGTAACGCCCGTTTATTTTTCACATGCCAGTAAAGTGTCGGCTGTTCTATTCCCAGCTTCTGCGCCAGCTTGCGGGTCGTCAGCCCGTCAATCCCTGTCTCATTCAGCAGTTCCAGTGCCGCATCAATAACCGATTCTCTGTTCAGCCGTGCCATGACCGTCTCCTCCGATTTTCAGATTGACACTCTATCATTGATAGGGATATATTCCAACTCTATCAATGATAGGGAATTAACACAGGATCTGAAAAATGAATAAACCCGCTGTCATCGCGCTGGTGATTACACTGCTGGACGCGATGGGAATTGGTCTG	NA	NA	NA	NA
AWA49745.1|62143_63253_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
AWA49746.1|63742_64447_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
