The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027064	Klebsiella variicola strain WCHKV030666 chromosome, complete genome	5553346	1187604	1196691	5553346		Enterobacteria_phage(85.71%)	10	NA	NA
AVJ58747.1|1187604_1189938_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	81.6	0.0e+00
AVJ58748.1|1189951_1190272_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ58749.1|1190268_1190496_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ58750.1|1190492_1191041_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	65.8	9.1e-30
AVJ58751.1|1191037_1191304_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	4.4e-30
AVJ58752.1|1191843_1192581_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.8	1.7e-71
AVJ58753.1|1192577_1192823_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
AVJ58754.1|1192840_1193407_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	3.3e-59
AVJ58755.1|1194061_1195480_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ58756.1|1195491_1196691_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	50.6	9.1e-107
>prophage 2
CP027064	Klebsiella variicola strain WCHKV030666 chromosome, complete genome	5553346	1646672	1653598	5553346		Planktothrix_phage(33.33%)	6	NA	NA
AVJ62696.1|1646672_1647536_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AVJ59153.1|1647546_1648320_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	1.0e-26
AVJ62697.1|1648559_1649453_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	3.6e-15
AVJ59154.1|1649698_1651060_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.0e-207
AVJ59155.1|1651376_1652099_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AVJ59156.1|1652095_1653598_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.6e-30
>prophage 3
CP027064	Klebsiella variicola strain WCHKV030666 chromosome, complete genome	5553346	1925970	1976334	5553346	capsid,tRNA,tail,portal,plate,integrase,terminase	Enterobacteria_phage(40.62%)	58	1927841:1927857	1963434:1963450
AVJ59389.1|1925970_1926666_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AVJ59390.1|1926704_1927286_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ62716.1|1927491_1929177_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	1.0e-34
1927841:1927857	attL	TCAACGACAGCGGCGCG	NA	NA	NA	NA
AVJ59391.1|1929246_1930374_+	ribonuclease D	NA	NA	NA	NA	NA
AVJ59392.1|1930450_1930720_-	cell division topological specificity factor	NA	NA	NA	NA	NA
AVJ59393.1|1930723_1931536_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
AVJ59394.1|1931559_1932261_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
AVJ59395.1|1932387_1932669_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ59396.1|1932685_1933345_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
AVJ59397.1|1933439_1933886_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
AVJ59398.1|1933894_1934239_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
AVJ59399.1|1934389_1934920_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
AVJ59400.1|1935048_1936599_-	Na+/H+ antiporter NhaB	NA	NA	NA	NA	NA
AVJ59401.1|1936847_1937567_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
AVJ59402.1|1937641_1939174_-	SpoVR family protein	NA	NA	NA	NA	NA
AVJ59403.1|1939495_1940794_+	D-amino acid dehydrogenase small subunit	NA	NA	NA	NA	NA
AVJ59404.1|1940803_1941874_+	alanine racemase	NA	NA	NA	NA	NA
AVJ59405.1|1942015_1942456_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
AVJ59406.1|1942448_1942946_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ59407.1|1942947_1943916_-|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	46.0	8.4e-79
AVJ59408.1|1943980_1944280_-	XRE family transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	56.2	4.5e-23
AVJ59409.1|1944361_1944628_+	DNA-binding protein	NA	NA	NA	NA	NA
AVJ62717.1|1944656_1944869_+	DUF4761 domain-containing protein	NA	NA	NA	NA	NA
AVJ59410.1|1944885_1945428_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ59411.1|1945414_1945600_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ62718.1|1945807_1946080_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ59412.1|1946148_1946373_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ59413.1|1946369_1946948_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	41.1	1.1e-33
AVJ59414.1|1946958_1947927_+	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	51.5	1.4e-78
AVJ59415.1|1948228_1949245_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	52.9	8.0e-96
AVJ59416.1|1949237_1951847_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.5	2.5e-194
AVJ59417.1|1952482_1953181_+	DNA methylase	NA	A0A0M4S5U3	Salmonella_phage	72.1	2.3e-94
AVJ59418.1|1953209_1953584_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AVJ59419.1|1953669_1953933_-	hypothetical protein	NA	A0A1S5NR91	Burkholderia_phage	40.2	3.2e-09
AVJ59420.1|1954490_1955543_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.8	9.3e-140
AVJ59421.1|1955542_1957264_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	65.5	2.9e-223
AVJ59422.1|1957424_1958258_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	64.1	3.2e-95
AVJ59423.1|1958282_1959332_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	54.5	4.4e-105
AVJ59424.1|1959378_1960293_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	76.5	4.7e-87
AVJ59425.1|1960395_1960893_+|capsid	capsid assembly protein	capsid	B9A7B7	Serratia_phage	70.3	4.5e-60
AVJ59426.1|1960892_1961093_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	66.2	5.1e-15
AVJ59427.1|1961083_1961365_+	hypothetical protein	NA	B9A7B8	Serratia_phage	57.1	1.4e-18
AVJ59428.1|1961361_1961913_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	40.8	1.7e-28
AVJ59429.1|1961909_1962305_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AVJ59430.1|1962449_1962908_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	46.4	4.0e-31
AVJ59431.1|1962904_1963546_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	47.3	2.0e-44
1963434:1963450	attR	TCAACGACAGCGGCGCG	NA	NA	NA	NA
AVJ59432.1|1963545_1964130_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	63.5	1.2e-64
AVJ59433.1|1964126_1964495_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	58.3	8.0e-30
AVJ59434.1|1964481_1965381_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	62.9	2.5e-93
AVJ59435.1|1965373_1965976_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	48.1	5.1e-42
AVJ59436.1|1968402_1969476_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	47.0	4.5e-33
AVJ59437.1|1969603_1970092_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	61.1	6.8e-53
AVJ59438.1|1970101_1972822_-|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	47.7	1.2e-127
AVJ59439.1|1972802_1972979_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	71.4	3.0e-11
AVJ59440.1|1972975_1973275_-|tail	phage tail protein	tail	B9A7B2	Serratia_phage	75.8	3.7e-33
AVJ59441.1|1973329_1973845_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.2	3.4e-63
AVJ59442.1|1973844_1975026_-|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	68.8	2.6e-154
AVJ62719.1|1975179_1976334_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	81.2	1.3e-179
>prophage 4
CP027064	Klebsiella variicola strain WCHKV030666 chromosome, complete genome	5553346	2758011	2768892	5553346		Escherichia_phage(87.5%)	9	NA	NA
AVJ60160.1|2758011_2761119_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.3	0.0e+00
AVJ60161.1|2761173_2762439_+	MFS transporter	NA	NA	NA	NA	NA
AVJ60162.1|2762469_2763558_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	98.3	6.3e-208
AVJ60163.1|2763644_2763905_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	95.3	3.0e-39
AVJ60164.1|2764199_2765060_+	class A beta-lactamase LEN-16	NA	A0A077SL40	Escherichia_phage	90.6	1.8e-144
AVJ60165.1|2765077_2765839_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.2	2.1e-133
AVJ60166.1|2766099_2767002_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	98.7	1.1e-157
AVJ60167.1|2767013_2768279_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	97.6	6.8e-230
AVJ60168.1|2768271_2768892_+	aldolase	NA	A0A077SK32	Escherichia_phage	98.1	5.7e-113
>prophage 5
CP027064	Klebsiella variicola strain WCHKV030666 chromosome, complete genome	5553346	2860194	2902502	5553346	head,holin,tail,integrase	Salmonella_phage(34.04%)	64	2858369:2858383	2862806:2862820
2858369:2858383	attL	GCGGCGATACGCGCC	NA	NA	NA	NA
AVJ60250.1|2860194_2861295_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	57.1	1.2e-116
AVJ60251.1|2861380_2861698_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.0	6.9e-22
AVJ60252.1|2861697_2861937_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	2.8e-15
AVJ62761.1|2862195_2862570_+	RND transporter	NA	NA	NA	NA	NA
AVJ62762.1|2862607_2864977_-	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	46.4	4.8e-19
2862806:2862820	attR	GGCGCGTATCGCCGC	NA	NA	NA	NA
AVJ60253.1|2865087_2865270_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60254.1|2865269_2866151_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	61.1	4.3e-29
AVJ60255.1|2866150_2866924_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.1	1.1e-76
AVJ60256.1|2866920_2868117_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	6.6e-158
AVJ60257.1|2868116_2868470_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
AVJ60258.1|2868471_2869125_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	5.9e-60
AVJ60259.1|2869187_2869550_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60260.1|2869553_2869790_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60261.1|2869786_2870347_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60262.1|2870484_2870829_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	48.7	8.8e-23
AVJ60263.1|2870825_2871854_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	53.8	2.3e-98
AVJ60264.1|2871856_2872159_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
AVJ60265.1|2872159_2872759_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	7.6e-54
AVJ60266.1|2872758_2874684_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	71.3	2.1e-182
AVJ62763.1|2874673_2874826_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	82.0	5.4e-17
AVJ60267.1|2874867_2875317_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	55.3	1.1e-36
AVJ60268.1|2875320_2875761_-	DUF3277 domain-containing protein	NA	A0A0M5M1K6	Salmonella_phage	78.8	2.8e-61
AVJ60269.1|2875771_2876923_-	DUF3383 domain-containing protein	NA	A0A0M4RD26	Salmonella_phage	81.5	1.6e-177
AVJ60270.1|2876924_2877476_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	44.9	1.5e-40
AVJ60271.1|2877468_2877873_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	70.8	2.4e-43
AVJ60272.1|2877872_2878379_-	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	36.6	5.3e-16
AVJ60273.1|2878375_2878795_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	2.2e-39
AVJ60274.1|2878763_2879045_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60275.1|2879084_2880026_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	78.1	9.2e-139
AVJ60276.1|2880037_2880532_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	63.4	1.4e-50
AVJ60277.1|2880535_2881738_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	5.3e-107
AVJ60278.1|2881789_2882338_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	1.4e-49
AVJ60279.1|2882393_2883845_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	69.0	3.2e-191
AVJ62764.1|2883848_2885462_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	82.9	5.2e-275
AVJ60280.1|2885555_2885747_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AVJ60281.1|2886006_2886480_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	68.4	3.9e-53
AVJ60282.1|2886511_2887147_-	hypothetical protein	NA	I6S676	Salmonella_phage	81.6	2.3e-101
AVJ60283.1|2887228_2887459_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60284.1|2887702_2888092_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	49.6	2.0e-23
AVJ62765.1|2888088_2888586_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	81.8	6.9e-77
AVJ60285.1|2888563_2888833_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
AVJ60286.1|2889882_2890461_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	56.1	7.1e-49
AVJ60287.1|2890457_2891117_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	78.1	2.2e-99
AVJ60288.1|2891113_2891419_-	DUF968 domain-containing protein	NA	Q6V7S4	Burkholderia_virus	57.4	1.2e-23
AVJ60289.1|2891940_2892186_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60290.1|2892261_2892585_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	51.2	2.3e-12
AVJ60291.1|2892581_2892944_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60292.1|2892936_2894001_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	72.4	7.4e-145
AVJ60293.1|2893997_2894786_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	2.9e-61
AVJ60294.1|2894778_2895000_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60295.1|2894999_2895395_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60296.1|2895421_2896471_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	49.6	2.7e-30
AVJ60297.1|2896467_2896722_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60298.1|2896917_2897238_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	6.5e-36
AVJ60299.1|2897277_2897499_-	transcriptional regulator	NA	Q716D6	Shigella_phage	55.7	8.2e-14
AVJ60300.1|2897597_2898230_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	36.9	1.9e-34
AVJ60301.1|2898647_2898872_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ60302.1|2899083_2899377_+	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
AVJ60303.1|2899679_2900243_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	38.3	6.3e-26
AVJ60304.1|2900239_2900464_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	63.5	2.3e-19
AVJ60305.1|2900460_2900805_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ60306.1|2900797_2901421_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ60307.1|2901417_2902122_+	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	34.2	5.4e-27
AVJ60308.1|2902241_2902502_+	pyocin activator protein PrtN	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
>prophage 6
CP027064	Klebsiella variicola strain WCHKV030666 chromosome, complete genome	5553346	3021084	3033672	5553346	tail	Klebsiella_phage(62.5%)	8	NA	NA
AVJ60416.1|3021084_3022149_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.2	6.1e-14
AVJ60417.1|3022616_3024956_-	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	76.3	4.0e-50
AVJ60418.1|3025032_3028101_-	kinase	NA	A0A286S259	Klebsiella_phage	96.5	0.0e+00
AVJ60419.1|3028097_3028478_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	95.2	4.0e-69
AVJ60420.1|3028487_3028970_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	94.4	2.0e-81
AVJ60421.1|3029150_3029615_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.4	3.0e-58
AVJ62771.1|3029614_3032413_-|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.6	4.1e-94
AVJ62772.1|3033306_3033672_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	51.0	8.0e-06
>prophage 7
CP027064	Klebsiella variicola strain WCHKV030666 chromosome, complete genome	5553346	3036739	3080494	5553346	coat,holin,tRNA,terminase	Salmonella_phage(29.55%)	60	NA	NA
AVJ60425.1|3036739_3037672_-	hypothetical protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.3	3.4e-24
AVJ60426.1|3037695_3038088_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AVJ60427.1|3038084_3038636_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	5.9e-29
AVJ60428.1|3038637_3039021_-	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	46.0	2.4e-21
AVJ60429.1|3039022_3039433_-	protein singed	NA	A0A0H5AUF0	Pseudomonas_phage	39.0	1.0e-09
AVJ60430.1|3039436_3039649_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	53.7	1.2e-09
AVJ60431.1|3039688_3040825_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	76.2	5.3e-157
AVJ60432.1|3040912_3041677_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	59.4	1.1e-76
AVJ60433.1|3041783_3042896_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	53.3	3.4e-108
AVJ60434.1|3042879_3044304_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	71.5	1.3e-192
AVJ60435.1|3044308_3045613_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	60.3	1.7e-146
AVJ60436.1|3045590_3046586_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	43.8	3.8e-34
AVJ60437.1|3047146_3047392_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	97.5	5.5e-35
AVJ60438.1|3047546_3047738_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ62774.1|3048666_3049026_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60439.1|3050007_3050373_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60440.1|3050377_3050662_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	74.5	8.6e-32
AVJ60441.1|3050747_3050930_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ60442.1|3051135_3051762_-	endolysin	NA	F1C591	Cronobacter_phage	75.8	9.9e-89
AVJ60443.1|3051761_3052043_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	73.1	2.2e-32
AVJ60444.1|3052029_3052488_-	hypothetical protein	NA	G8C7V8	Escherichia_phage	73.1	2.2e-45
AVJ60445.1|3053116_3053503_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ60446.1|3053527_3053749_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60447.1|3053877_3054675_-	antitermination protein	NA	H6WRZ1	Salmonella_phage	77.0	5.4e-116
AVJ60448.1|3054677_3054809_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	73.7	2.3e-08
AVJ60449.1|3054805_3055162_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	66.9	4.7e-43
AVJ60450.1|3055158_3055455_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	3.5e-36
AVJ60451.1|3055457_3055664_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	74.2	2.1e-24
AVJ60452.1|3055663_3056260_-	DUF1367 domain-containing protein	NA	K7PKS6	Enterobacteria_phage	79.6	4.2e-89
AVJ60453.1|3056295_3056529_-	hypothetical protein	NA	A0A0M4R5D9	Salmonella_phage	54.5	2.9e-17
AVJ60454.1|3057008_3057452_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVJ60455.1|3057605_3059591_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.5	2.2e-206
AVJ60456.1|3059587_3059845_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ62775.1|3059844_3060423_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60457.1|3060445_3060682_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	51.5	5.1e-14
AVJ60458.1|3061267_3061603_-	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	43.0	5.8e-11
AVJ60459.1|3061610_3062360_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	81.1	1.3e-116
AVJ62776.1|3062362_3063202_-	hypothetical protein	NA	Q8HA96	Salmonella_phage	51.3	1.5e-23
AVJ60460.1|3063267_3064062_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.3	1.8e-63
AVJ60461.1|3064190_3064727_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	72.3	5.0e-65
AVJ60462.1|3064717_3064957_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	79.2	4.4e-29
AVJ60463.1|3065060_3065447_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	92.1	4.7e-57
AVJ60464.1|3065678_3066506_+	hypothetical protein	NA	A4KWU2	Enterobacteria_phage	47.8	2.6e-68
AVJ60465.1|3067241_3067511_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60466.1|3067801_3067993_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVJ60467.1|3068001_3068157_+	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	71.2	9.8e-14
AVJ60468.1|3068294_3071399_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	58.5	1.1e-292
AVJ60469.1|3071411_3072500_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	53.0	6.1e-102
AVJ60470.1|3072534_3072888_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ60471.1|3072880_3073492_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	74.2	3.2e-39
AVJ60472.1|3073488_3073797_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	4.2e-24
AVJ62777.1|3073804_3074044_+	DUF4060 domain-containing protein	NA	M9P0E0	Enterobacteria_phage	84.6	9.4e-32
AVJ60473.1|3074108_3074321_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	71.8	8.4e-24
AVJ60474.1|3074321_3075560_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	67.1	4.6e-162
AVJ60475.1|3075608_3076544_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.1	1.4e-139
AVJ60476.1|3076589_3077963_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	6.6e-53
AVJ60477.1|3077977_3078172_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60478.1|3078488_3079472_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AVJ62778.1|3079516_3079732_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ60479.1|3079750_3080494_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	3.2e-17
>prophage 8
CP027064	Klebsiella variicola strain WCHKV030666 chromosome, complete genome	5553346	3394230	3441975	5553346	head,capsid,tRNA,tail,portal,protease,holin,integrase,terminase	Enterobacteria_phage(22.22%)	52	3408430:3408444	3443579:3443593
AVJ60762.1|3394230_3396576_-	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	73.6	6.0e-46
AVJ60763.1|3396650_3399728_-	kinase	NA	A0A286S259	Klebsiella_phage	62.0	0.0e+00
AVJ60764.1|3399724_3400105_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	2.7e-57
AVJ60765.1|3400117_3400594_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	65.8	3.7e-51
AVJ60766.1|3400580_3401054_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
AVJ60767.1|3401075_3404462_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.7	2.5e-303
AVJ60768.1|3404522_3404756_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
AVJ60769.1|3404829_3405135_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
AVJ60770.1|3405137_3405542_-|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	52.3	1.7e-28
AVJ60771.1|3405572_3406277_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	65.7	1.6e-79
AVJ60772.1|3406333_3406681_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	61.9	1.8e-31
AVJ60773.1|3406677_3407127_-	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	82.6	5.1e-63
AVJ60774.1|3407123_3407462_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	67.0	1.2e-37
AVJ62796.1|3407474_3407807_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	31.6	8.8e-12
AVJ60775.1|3407812_3408067_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60776.1|3408112_3409333_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.0	1.7e-140
3408430:3408444	attL	AGTCAATCGGGTTCA	NA	NA	NA	NA
AVJ60777.1|3409342_3410050_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.5	2.2e-68
AVJ60778.1|3410025_3411345_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	58.9	3.8e-138
AVJ60779.1|3411351_3413088_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.3	1.3e-138
AVJ60780.1|3413041_3413506_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	4.8e-48
AVJ60781.1|3413685_3414027_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.9	2.1e-48
AVJ60782.1|3414719_3414965_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	95.1	4.6e-34
AVJ60783.1|3415119_3415311_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60784.1|3416235_3416601_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60785.1|3416809_3417160_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	37.7	1.1e-09
AVJ60786.1|3417156_3417654_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	86.4	2.3e-80
AVJ60787.1|3417653_3417869_-|holin	holin	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
AVJ60788.1|3420236_3420839_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	67.5	1.2e-75
AVJ60789.1|3420855_3421887_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	6.2e-96
AVJ60790.1|3421886_3422090_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60791.1|3422086_3422479_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	34.7	1.5e-10
AVJ60792.1|3422519_3422810_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	6.1e-17
AVJ60793.1|3422821_3423055_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	1.7e-25
AVJ60794.1|3423587_3429254_-	ATP-binding protein	NA	NA	NA	NA	NA
AVJ60795.1|3429538_3429976_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60796.1|3429989_3430454_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	70.9	9.0e-63
AVJ62797.1|3430446_3431451_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.9	2.1e-32
AVJ60797.1|3431510_3432065_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60798.1|3432067_3432292_-	XRE family transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	56.1	5.0e-11
AVJ60799.1|3432393_3432777_+	transcriptional regulator	NA	K7PH19	Enterobacteria_phage	63.5	5.1e-19
AVJ60800.1|3432782_3432974_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60801.1|3433106_3433421_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ60802.1|3433582_3433801_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ60803.1|3433810_3434005_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVJ60804.1|3434047_3434392_+	transcriptional regulator	NA	NA	NA	NA	NA
AVJ60805.1|3434533_3436672_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.9	1.5e-99
AVJ60806.1|3436724_3436970_+	excisionase	NA	NA	NA	NA	NA
AVJ60807.1|3436950_3438078_+|integrase	integrase	integrase	O21925	Phage_21	58.4	7.4e-119
AVJ60808.1|3438195_3439446_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
AVJ60809.1|3439686_3440337_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AVJ60810.1|3440353_3440812_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AVJ62798.1|3440868_3441975_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
3443579:3443593	attR	TGAACCCGATTGACT	NA	NA	NA	NA
>prophage 9
CP027064	Klebsiella variicola strain WCHKV030666 chromosome, complete genome	5553346	3684082	3693530	5553346	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
AVJ61017.1|3684082_3685804_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.0	2.0e-14
AVJ61018.1|3685843_3686548_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVJ61019.1|3686899_3687118_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AVJ61020.1|3687236_3689516_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	3.7e-165
AVJ61021.1|3689546_3689864_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AVJ61022.1|3690189_3690411_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AVJ61023.1|3690477_3692418_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	2.9e-38
AVJ61024.1|3692414_3693530_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 10
CP027064	Klebsiella variicola strain WCHKV030666 chromosome, complete genome	5553346	4197110	4210998	5553346		Morganella_phage(20.0%)	14	NA	NA
AVJ61464.1|4197110_4197779_+	dTMP kinase	NA	G3MB74	Bacillus_virus	36.4	9.4e-29
AVJ61465.1|4200342_4203099_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	54.8	1.5e-285
AVJ61466.1|4203091_4203442_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	68.2	6.4e-37
AVJ61467.1|4203452_4204097_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.2	1.5e-28
AVJ62832.1|4204089_4204305_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ61468.1|4204310_4204622_-	ubiquinol-cytochrome C reductase	NA	NA	NA	NA	NA
AVJ62833.1|4204618_4205323_-	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	57.3	9.9e-21
AVJ61469.1|4205454_4205634_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AVJ61470.1|4205626_4206469_-	antA/AntB antirepressor family protein	NA	A0A1U9AJ93	Stx1_converting_phage	44.0	1.2e-20
AVJ61471.1|4206482_4206914_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	44.7	5.0e-23
AVJ61472.1|4206913_4207111_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.6	3.0e-07
AVJ61473.1|4207310_4208192_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ62834.1|4208323_4209550_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	53.9	2.8e-127
AVJ61474.1|4210131_4210998_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
>prophage 1
CP027063	Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence	235448	162743	223896	235448	transposase,integrase	Shigella_phage(50.0%)	56	175631:175690	201070:202299
AVJ57549.1|162743_164274_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	5.9e-50
AVJ57550.1|167663_168206_+	3'-5' exonuclease	NA	NA	NA	NA	NA
AVJ57551.1|168219_168717_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ57619.1|168713_170477_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
AVJ57552.1|170478_171726_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AVJ57553.1|171722_172898_-	HNH endonuclease	NA	NA	NA	NA	NA
AVJ57554.1|173295_173493_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ57555.1|173825_174095_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AVJ57556.1|174102_174630_+	N-acetyltransferase	NA	NA	NA	NA	NA
175631:175690	attL	TGAATCGCCACGGATAATCTAGACACTTCCGAGCCGTTGATAATACTGGTTTTCATATTC	NA	NA	NA	NA
AVJ57557.1|175648_176796_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	5.9e-148
AVJ57558.1|176815_177181_+	DUF1173 domain-containing protein	NA	NA	NA	NA	NA
AVJ57559.1|177956_178742_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.3	1.0e-50
AVJ57560.1|180115_180421_-	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AVJ57561.1|180422_180641_-	plasmid maintenance protein CcdA	NA	NA	NA	NA	NA
AVJ57562.1|180692_180878_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ57563.1|180919_182293_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ57564.1|182381_182597_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ57565.1|182634_183063_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AVJ57566.1|183175_184021_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVJ57567.1|184123_184519_+	transcriptional regulator	NA	NA	NA	NA	NA
AVJ57568.1|184630_185215_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVJ57569.1|185282_186125_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AVJ57570.1|186285_186477_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ57571.1|186542_186773_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AVJ57572.1|186769_187186_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AVJ57573.1|187277_188681_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
AVJ57574.1|188690_190565_-	PTS beta-glucoside transporter subunit EIIBCA	NA	NA	NA	NA	NA
AVJ57575.1|190953_191589_-	DUF1349 domain-containing protein	NA	NA	NA	NA	NA
AVJ57576.1|191627_192833_-	MFS transporter	NA	NA	NA	NA	NA
AVJ57577.1|192917_193688_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVJ57620.1|194071_195481_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AVJ57578.1|195541_196438_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVJ57579.1|196537_197719_+	MFS transporter	NA	NA	NA	NA	NA
AVJ57580.1|197837_198446_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AVJ57581.2|198543_199446_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVJ57582.1|199963_201110_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	5.9e-148
AVJ57621.1|203288_204644_-	conjugal transfer protein	NA	NA	NA	NA	NA
201070:202299	attR	GAATATGAAAACCAGTATTATCAACGGCTCGGAAGTGTCTAGATTATCCGTGGCGATTCAAACTGTCAGAATTAGAGAACCCATTCTGTATCACATTAGACTCAAGCTTTGCTATGTCTTTGGCAAATCCATCACCATTTTTCATCGCACTTAACAGATTGTCAGTTAAGCCTTTTTTTACCCTATCAGATAGTTGACTGTTATTTTGTATGCTAGCCGCTATGTTTCCAACCAAATTACCTACAGAGCCACTCCCACCTCCTCCTTTAGCTTTACCTCCTAGGCTAAAACCTAAGCTAGCCATACCACCAAGTACAGCTGCAGCTGCCATAGATTGGAGAGCTTCCGCGGATACTCCAACGTCTTTCCCGAGACTACCGGTCATTGCGGCCGCAACGTCAGTAACAGCCTTCATTCCACCCTGGTTTGTTGAGCCTGCTGTTTGCGTTCGACTGCCTTGCATTCCACTGGTCCAAGCTTCATTAAAAGCCTGCCTTGAGCTGAGCGTGGACAATCTGTCGGTCCCTATCGAGTGCTGCCCTGCTGCGTTAACGGTATCACTTAACGATGACCCCAACCCAAGCGTTGGCATCATCCTGGTCGGAGAATCCAGAAGCCCGCCAGATGATATACCTCCACCGGTTGCAGTGGCTGCTGTGTGTGTCTGGTCACCAAAGGACTGTTTACCCGCATTACCCGCCGACCACACTTCTGGTGTGACATGTCCAGTATTGGCAGGAGCATCCGGAGTCACATTTTTCAACGCCCCCATCATCGGGTGGATGCTGGTGGTCAACAGGAACAGCGTCAGCATCGGCACCATGCAATACAGCGCTGAAGCTACTGACAGGTAGCTGCCGTACGTCTCCTGAATACTCCCCATATTCGCCCAGTTCATAGTGGTCTGTACACCCAGCGATGACCATGTGTCAAACTGCTGATTCAATACCATTTTTACGTATGCGTTGACCATGACCGCCGTTATCGGCCACATGTTAACGAATACAATCAGCTGCAGATACTTTGCTGCTGAAGTTATACCTTCCCCCCCTAAAAACAGGATCGCAATCAGGGCAAAGGGGGCAACCATGTAGCTGAACATTTCCAGAAACGATATTGCAGCGCCTGAGATGTTCAGCCAGAGTTGCCCCTGACTGACCATGGCGTTGGTACGTTTCATGCTCGCTTCGAAAAGCTGGTAGTCAGCCGCTATACCCAACGACTTGCGAT	NA	NA	NA	NA
AVJ57583.1|204687_205725_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
AVJ57584.1|206090_206633_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ57585.1|207519_207777_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ57586.1|208714_209179_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ57587.1|209178_209967_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ57588.1|209980_212923_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
AVJ57589.1|213391_213748_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ57590.1|214589_214937_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ57591.1|215019_215424_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ57592.1|215552_216620_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ57593.1|216688_216985_-	hydrogenase expression/formation protein HypD	NA	NA	NA	NA	NA
AVJ57594.1|217218_217596_+	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVJ57595.1|219371_219533_-	Hok/Gef family protein	NA	NA	NA	NA	NA
AVJ57596.1|219875_220361_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVJ57597.1|220348_220615_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AVJ57598.1|220747_221209_-	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
AVJ57599.1|221171_222319_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	5.9e-148
AVJ57600.1|222608_222764_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ57601.1|222776_223896_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	3.9e-51
