The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028568	Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 chromosome, complete genome	5022867	373912	437283	5022867	transposase,integrase,protease	uncultured_Mediterranean_phage(21.43%)	53	370830:370846	390271:390287
370830:370846	attL	GCTGCGCCTCACCGCCA	NA	NA	NA	NA
AWA04809.1|373912_374893_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	1.6e-186
AWA04810.1|375360_375621_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04811.1|375696_376824_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	25.7	1.7e-06
AWA04812.1|377253_377565_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04813.1|377672_378653_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	1.6e-186
AWA04814.1|378994_379501_-	hypothetical protein	NA	NA	NA	NA	NA
AWA04815.1|379497_379917_-	hypothetical protein	NA	NA	NA	NA	NA
AWA04816.1|381401_382349_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
AWA04817.1|383063_384566_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AWA04818.1|384567_385761_-	hypothetical protein	NA	NA	NA	NA	NA
AWA04819.1|385921_386500_-	single-stranded DNA-binding protein	NA	R9TR60	Vibrio_phage	58.9	1.2e-53
AWA04820.1|387023_387683_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AWA04821.1|387778_390604_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.3	0.0e+00
390271:390287	attR	TGGCGGTGAGGCGCAGC	NA	NA	NA	NA
AWA04822.1|392878_393490_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
AWA04823.1|393700_395680_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.3	4.0e-27
AWA04824.1|395688_397173_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWA04825.1|397236_398028_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWA04826.1|398356_399253_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AWA04827.1|399315_400380_-	DUF3103 domain-containing protein	NA	NA	NA	NA	NA
AWA04828.1|400530_401682_-	hypothetical protein	NA	NA	NA	NA	NA
AWA04829.1|401680_402373_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWA04830.1|402383_403580_-	NnrS family protein	NA	NA	NA	NA	NA
AWA08664.1|409538_409856_+	DUF496 domain-containing protein	NA	NA	NA	NA	NA
AWA04831.1|410072_413156_+	penicillin-binding protein	NA	NA	NA	NA	NA
AWA04832.1|413242_413788_-	ribosome-associated protein	NA	NA	NA	NA	NA
AWA04833.1|413880_415224_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AWA04834.1|415309_416566_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AWA04835.1|416583_416841_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
AWA04836.1|416840_417113_-	STAS domain-containing protein	NA	NA	NA	NA	NA
AWA04837.1|417109_417742_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
AWA04838.1|417751_418243_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AWA04839.1|418250_419030_-	ABC transporter permease	NA	NA	NA	NA	NA
AWA04840.1|419029_419830_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.2	7.3e-20
AWA04841.1|420037_421033_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	36.8	1.3e-42
AWA04842.1|421032_421587_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	60.7	2.9e-39
AWA04843.1|421583_422144_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AWA04844.1|422094_422658_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
AWA04845.1|422661_423387_+	lipopolysaccharide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	1.3e-20
AWA04846.1|423452_424892_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
AWA04847.1|424913_425201_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
AWA04848.1|425203_425650_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AWA04849.1|425692_426559_+	RNase adaptor protein RapZ	NA	A0A1P8D5W0	Corynebacterium_phage	35.1	6.1e-12
AWA04850.1|426579_426852_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AWA04851.1|428876_429617_-	oxo-acid lyase	NA	NA	NA	NA	NA
AWA04852.1|429616_430732_-	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
AWA04853.1|430715_431855_-	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
AWA04854.1|431898_432549_-	hypothetical protein	NA	NA	NA	NA	NA
AWA04855.1|432560_433337_-	hypothetical protein	NA	NA	NA	NA	NA
AWA04856.1|433377_433674_-	cytoplasmic protein	NA	NA	NA	NA	NA
AWA04857.1|433673_434039_-	transcriptional regulator	NA	NA	NA	NA	NA
AWA04858.1|434039_434402_-	transcriptional regulator	NA	NA	NA	NA	NA
AWA04859.1|434710_435832_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IT49	uncultured_Mediterranean_phage	24.7	3.5e-20
AWA04860.1|435921_437283_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.6	3.5e-22
>prophage 2
CP028568	Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 chromosome, complete genome	5022867	913329	923265	5022867	tRNA	uncultured_Mediterranean_phage(25.0%)	10	NA	NA
AWA05284.1|913329_914076_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	54.1	7.2e-70
AWA05285.1|914080_914698_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	4.0e-34
AWA08684.1|914700_915276_+	DedA family protein	NA	NA	NA	NA	NA
AWA05286.1|915286_916327_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	35.6	8.6e-13
AWA05287.1|916374_917358_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.1	1.7e-34
AWA05288.1|917442_918456_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	9.1e-108
AWA05289.1|918635_918851_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AWA05290.1|918866_919310_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	1.7e-26
AWA05291.1|919398_921186_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.1	4.0e-74
AWA05292.1|921399_923265_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
>prophage 3
CP028568	Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 chromosome, complete genome	5022867	1118749	1180912	5022867	transposase,lysis	Salmonella_phage(14.29%)	52	NA	NA
AWA05446.1|1118749_1118965_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AWA05447.1|1118979_1119948_-	hypothetical protein	NA	NA	NA	NA	NA
AWA05448.1|1120067_1120874_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AWA05449.1|1121025_1122432_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AWA05450.1|1122521_1123391_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AWA05451.1|1123504_1123840_-	hypothetical protein	NA	NA	NA	NA	NA
AWA05452.1|1123965_1124307_-	DUF2956 domain-containing protein	NA	NA	NA	NA	NA
AWA05453.1|1124393_1126223_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AWA05454.1|1126219_1127167_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
AWA05455.1|1127554_1129096_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AWA05456.1|1129274_1130129_-	Tim44 domain-containing protein	NA	NA	NA	NA	NA
AWA05457.1|1130309_1130411_+	hypothetical protein	NA	NA	NA	NA	NA
AWA05458.1|1130561_1131956_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	71.5	5.0e-181
AWA05459.1|1132022_1132115_+	hypothetical protein	NA	NA	NA	NA	NA
AWA05460.1|1132292_1133366_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	26.6	2.1e-22
AWA05461.1|1133560_1133809_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.9	1.5e-19
AWA05462.1|1133810_1135172_-	U32 family peptidase	NA	Q6DW11	Phage_TP	76.2	1.1e-164
AWA05463.1|1135405_1136107_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AWA05464.1|1136225_1137173_+|transposase	IS30-like element ISAs2 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	31.4	6.4e-31
AWA05465.1|1137481_1138204_+	hypothetical protein	NA	NA	NA	NA	NA
AWA05466.1|1138233_1138725_+	adhesin	NA	NA	NA	NA	NA
AWA05467.1|1138792_1141231_+	hypothetical protein	NA	NA	NA	NA	NA
AWA05468.1|1141691_1142672_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	1.6e-186
AWA05469.1|1143627_1144266_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWA05470.1|1144386_1147815_+	two-component system sensor histidine kinase/response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	29.7	5.9e-42
AWA05471.1|1147776_1148070_-	hypothetical protein	NA	NA	NA	NA	NA
AWA05472.1|1148841_1150089_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
AWA05473.1|1150142_1151204_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
AWA05474.1|1151214_1151685_-	chemotaxis protein CheD	NA	NA	NA	NA	NA
AWA05475.1|1151695_1152499_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AWA05476.1|1154258_1155206_-|transposase	IS30-like element ISAs2 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	31.4	6.4e-31
AWA05477.1|1155886_1156459_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AWA05478.1|1156471_1158394_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
AWA05479.1|1158409_1160623_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AWA05480.1|1160649_1160976_-	anti-sigma factor antagonist	NA	NA	NA	NA	NA
AWA05481.1|1160990_1161359_-	response regulator	NA	W8CYM9	Bacillus_phage	40.5	1.0e-16
AWA05482.1|1161368_1162583_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	4.2e-11
AWA05483.1|1162886_1163975_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
AWA05484.1|1164178_1165120_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWA05485.1|1165247_1165856_+	LysE family translocator	NA	NA	NA	NA	NA
AWA05486.1|1165958_1167818_+	U32 family peptidase	NA	Q6DW11	Phage_TP	40.2	2.5e-15
AWA05487.1|1168584_1169061_-	cysteine methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	52.9	8.8e-21
AWA05488.1|1169057_1170617_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
AWA05489.1|1170826_1171228_+	hypothetical protein	NA	NA	NA	NA	NA
AWA05490.1|1171297_1172851_-	carboxypeptidase M32	NA	NA	NA	NA	NA
AWA05491.1|1172878_1173460_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
AWA05492.1|1173613_1173799_-	DUF3149 domain-containing protein	NA	NA	NA	NA	NA
AWA05493.1|1173931_1174825_-	TraB/GumN family protein	NA	NA	NA	NA	NA
AWA05494.1|1174912_1175245_+	DUF1904 domain-containing protein	NA	NA	NA	NA	NA
AWA05495.1|1175402_1176230_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AWA05496.1|1176348_1177794_-	outer membrane porin, OprD family	NA	NA	NA	NA	NA
AWA05497.1|1177942_1180912_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.6	0.0e+00
>prophage 4
CP028568	Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 chromosome, complete genome	5022867	2454721	2517043	5022867	transposase,tRNA,integrase	Catovirus(13.33%)	54	2487234:2487251	2518999:2519016
AWA06542.1|2454721_2455666_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
AWA06543.1|2455875_2456253_+	DUF454 domain-containing protein	NA	NA	NA	NA	NA
AWA06544.1|2456282_2456930_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.7	6.3e-30
AWA06545.1|2457112_2459659_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	36.3	1.0e-43
AWA06546.1|2459782_2460112_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AWA06547.1|2460915_2461863_-|transposase	IS30-like element ISAs2 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	31.4	6.4e-31
AWA06548.1|2464106_2465177_+	transcriptional regulator	NA	NA	NA	NA	NA
AWA06549.1|2465261_2465684_+	CBS domain-containing protein	NA	NA	NA	NA	NA
AWA06550.1|2465909_2469809_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	27.3	2.8e-56
AWA06551.1|2469875_2470742_+	hypothetical protein	NA	NA	NA	NA	NA
AWA06552.1|2470767_2471136_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
AWA06553.1|2471329_2474512_+	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	31.0	9.0e-61
AWA06554.1|2474508_2475510_+	HD domain-containing protein	NA	W8CYM9	Bacillus_phage	30.4	1.6e-11
AWA06555.1|2475499_2476144_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AWA06556.1|2476171_2477272_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AWA06557.1|2477268_2478306_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
AWA06558.1|2478688_2479873_-	acyltransferase	NA	NA	NA	NA	NA
AWA06559.1|2480133_2480778_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AWA06560.1|2481262_2482456_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AWA06561.1|2482561_2483992_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.4	1.4e-26
AWA06562.1|2484077_2484350_+	acylphosphatase	NA	NA	NA	NA	NA
AWA06563.1|2484435_2485071_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AWA06564.1|2485289_2487323_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
2487234:2487251	attL	GATGTGTTCCAGCATGTG	NA	NA	NA	NA
AWA06565.1|2487509_2488592_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
AWA06566.1|2488701_2489346_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.5	1.4e-32
AWA06567.1|2489409_2489991_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	40.8	1.4e-28
AWA06568.1|2490024_2490117_-	hypothetical protein	NA	NA	NA	NA	NA
AWA06569.1|2490398_2491868_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
AWA06570.1|2492224_2492659_-	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AWA06571.1|2492730_2493081_+	mercuric transporter	NA	NA	NA	NA	NA
AWA06572.1|2493094_2493370_+	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AWA08774.1|2493405_2493828_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AWA06573.1|2493879_2495574_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AWA06574.1|2495591_2495954_+	transcriptional regulator	NA	NA	NA	NA	NA
AWA06575.1|2495950_2496187_+	mercury resistance protein	NA	NA	NA	NA	NA
AWA06576.1|2496183_2496891_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AWA06577.1|2496929_2498645_+|transposase	transposase	transposase	NA	NA	NA	NA
AWA06578.1|2498647_2499508_+|transposase	transposase	transposase	NA	NA	NA	NA
AWA06579.1|2501899_2502655_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.5	3.4e-59
AWA06580.1|2502669_2504211_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	3.2e-128
AWA08775.1|2505356_2506139_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
AWA06581.1|2506314_2506815_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWA06582.1|2506833_2507013_+	hypothetical protein	NA	NA	NA	NA	NA
AWA06583.1|2507324_2508509_+	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
AWA06584.1|2508596_2509262_-	type B chloramphenicol O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	42.4	1.2e-23
AWA06585.1|2509684_2509879_+	hypothetical protein	NA	NA	NA	NA	NA
AWA08776.1|2509839_2511312_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWA06586.1|2512497_2513058_-	ETC complex I subunit	NA	NA	NA	NA	NA
AWA06587.1|2513267_2513621_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWA06588.1|2513639_2513819_+	hypothetical protein	NA	NA	NA	NA	NA
AWA06589.1|2513748_2514588_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AWA06590.1|2514581_2514929_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWA08777.1|2515092_2515884_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AWA06591.1|2516029_2517043_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
2518999:2519016	attR	CACATGCTGGAACACATC	NA	NA	NA	NA
>prophage 5
CP028568	Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 chromosome, complete genome	5022867	2915057	2961107	5022867	transposase,bacteriocin,plate,protease,tRNA	uncultured_Mediterranean_phage(13.33%)	36	NA	NA
AWA06920.1|2915057_2915816_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
AWA06921.1|2916000_2917521_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.6	1.8e-88
AWA06922.1|2917542_2918031_-|bacteriocin	bacteriocin production protein	bacteriocin	NA	NA	NA	NA
AWA06923.1|2918217_2919513_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.9	4.0e-92
AWA06924.1|2919556_2919787_+	hypothetical protein	NA	NA	NA	NA	NA
AWA06925.1|2919852_2921217_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	42.1	1.1e-79
AWA08800.1|2921342_2921951_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AWA06926.1|2922028_2924551_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.4	4.7e-89
AWA06927.1|2924752_2925244_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
AWA06928.1|2925393_2925624_+	alanine dehydrogenase	NA	NA	NA	NA	NA
AWA06929.1|2926229_2927180_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	2.4e-62
AWA06930.1|2927237_2928485_+	diguanylate cyclase response regulator	NA	A0A127AWB9	Bacillus_phage	32.2	6.5e-15
AWA06931.1|2928595_2929066_-	hypothetical protein	NA	NA	NA	NA	NA
AWA08801.1|2929085_2929793_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWA06932.1|2929789_2930506_+	arginyltransferase	NA	NA	NA	NA	NA
AWA06933.1|2930575_2930794_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWA06934.1|2930863_2933116_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.7	9.2e-169
AWA06935.1|2933175_2933493_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	49.4	2.4e-14
AWA06936.1|2933721_2933940_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.2	1.2e-17
AWA06937.1|2934047_2934911_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	31.2	1.8e-27
AWA06938.1|2935961_2937503_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	3.2e-128
AWA06939.1|2937517_2938273_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.5	3.4e-59
AWA06940.1|2939185_2939371_-	hypothetical protein	NA	NA	NA	NA	NA
AWA06941.1|2942279_2944325_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.4	5.1e-33
AWA06942.1|2944335_2944623_-	type VI secretion system PAAR protein	NA	G4KK81	Yersinia_phage	39.4	2.3e-08
AWA06943.1|2944880_2946311_-	hypothetical protein	NA	NA	NA	NA	NA
AWA06944.1|2946357_2949843_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AWA06945.1|2949884_2951330_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AWA06946.1|2951338_2951944_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AWA06947.1|2951943_2953482_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AWA06948.1|2953484_2956127_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	6.3e-92
AWA08802.1|2956147_2956858_-	type IV secretion protein DotU	NA	NA	NA	NA	NA
AWA06949.1|2956949_2958284_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AWA06950.1|2958286_2958802_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AWA06951.1|2958801_2960052_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AWA06952.1|2960108_2961107_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 6
CP028568	Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 chromosome, complete genome	5022867	3969820	3977724	5022867	protease	Staphylococcus_phage(50.0%)	9	NA	NA
AWA07733.1|3969820_3970405_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	3.3e-30
AWA07734.1|3970488_3971700_+|protease	serine protease	protease	V5LS29	Emiliania_huxleyi_virus	26.9	4.0e-09
AWA07735.1|3971762_3972872_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.0	7.9e-65
AWA07736.1|3973013_3973667_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.4	2.7e-20
AWA07737.1|3973721_3974831_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.2	1.6e-49
AWA07738.1|3974927_3975377_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AWA07739.1|3975499_3975832_-	NIPSNAP family protein	NA	NA	NA	NA	NA
AWA07740.1|3975907_3976387_-	hypothetical protein	NA	NA	NA	NA	NA
AWA07741.1|3976470_3977724_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.5	2.3e-100
>prophage 7
CP028568	Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 chromosome, complete genome	5022867	4097655	4144043	5022867	transposase,tRNA,protease,integrase	Ralstonia_phage(14.29%)	42	4115410:4115469	4144749:4144816
AWA07847.1|4097655_4099071_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AWA07848.1|4099261_4101433_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.5	4.4e-27
AWA07849.1|4101531_4102200_+	opacity-associated protein A	NA	NA	NA	NA	NA
AWA07850.1|4102472_4102682_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	57.1	1.4e-15
AWA07851.1|4103869_4104415_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	37.5	5.5e-27
AWA07852.1|4104461_4105541_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
AWA07853.1|4105446_4106442_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AWA07854.1|4106438_4106690_+	DUF2132 domain-containing protein	NA	NA	NA	NA	NA
AWA07855.1|4106694_4106946_+	DUF2960 domain-containing protein	NA	NA	NA	NA	NA
AWA07856.1|4106948_4107347_+	hypothetical protein	NA	NA	NA	NA	NA
AWA07857.1|4107460_4108030_-	DUF417 domain-containing protein	NA	NA	NA	NA	NA
AWA07858.1|4108072_4108507_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AWA07859.1|4108515_4109433_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWA07860.1|4109493_4109988_-	hypothetical protein	NA	NA	NA	NA	NA
AWA07861.1|4110159_4112133_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	24.7	8.4e-09
AWA07862.1|4112200_4112707_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
AWA07863.1|4112970_4115265_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
4115410:4115469	attL	CAGAAAGGGTTTAATGCGCGCCGTTGCCCAGATAGCTCAGTCGGTAGAGCAGGGGATTGA	NA	NA	NA	NA
AWA07864.1|4116115_4117735_+	hypothetical protein	NA	NA	NA	NA	NA
AWA07865.1|4118266_4119247_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	1.6e-186
AWA07866.1|4119315_4119897_-	hypothetical protein	NA	NA	NA	NA	NA
AWA07867.1|4120052_4121000_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
AWA07868.1|4122225_4122759_+	hypothetical protein	NA	NA	NA	NA	NA
AWA07869.1|4122755_4123058_+	DUF1232 domain-containing protein	NA	A0A2I7S9Z5	Vibrio_phage	39.2	2.0e-07
AWA07870.1|4123080_4123707_+	hypothetical protein	NA	NA	NA	NA	NA
AWA07871.1|4123703_4124138_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
AWA07872.1|4124354_4124534_-	hypothetical protein	NA	NA	NA	NA	NA
AWA07873.1|4124630_4125872_+|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	30.9	1.5e-27
AWA07874.1|4125962_4126385_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWA07875.1|4126654_4127428_+	hypothetical protein	NA	NA	NA	NA	NA
AWA07876.1|4127748_4128594_+	hypothetical protein	NA	A0A0R6PH67	Moraxella_phage	30.5	6.1e-33
AWA07877.1|4128653_4129409_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.5	3.4e-59
AWA07878.1|4129423_4130965_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	3.2e-128
AWA07879.1|4131386_4132055_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
AWA07880.1|4132067_4132757_+	hypothetical protein	NA	NA	NA	NA	NA
AWA07881.1|4132917_4134354_+	hypothetical protein	NA	A0A1L7N0M1	Ralstonia_phage	32.3	2.0e-07
AWA07882.1|4135889_4136375_-	hypothetical protein	NA	NA	NA	NA	NA
AWA07883.1|4136362_4137988_-	thiamine biosynthesis protein ThiF	NA	NA	NA	NA	NA
AWA07884.1|4137993_4139142_-	hypothetical protein	NA	NA	NA	NA	NA
AWA08863.1|4139151_4140138_-	patatin	NA	A0A1B2LRS3	Wolbachia_phage	26.7	6.7e-23
AWA07885.1|4140453_4140699_-	hypothetical protein	NA	NA	NA	NA	NA
AWA07886.1|4140685_4142878_-	DUF927 domain-containing protein	NA	NA	NA	NA	NA
AWA07887.1|4142891_4144043_-|integrase	site-specific integrase	integrase	Q4ZCC1	Staphylococcus_virus	24.4	6.4e-09
4144749:4144816	attR	CAGAAAGGGTTTAATGCGCGCCGTTGCCCAGATAGCTCAGTCGGTAGAGCAGGGGATTGAAAATCCCC	NA	NA	NA	NA
>prophage 1
CP028565	Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid pGES5_045096, complete sequence	32665	12172	20129	32665	transposase,integrase	Escherichia_phage(16.67%)	11	NA	NA
AWA04203.1|12172_12937_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWA04204.1|13024_13138_+	NTP-binding protein	NA	NA	NA	NA	NA
AWA04205.1|13443_13944_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWA04206.1|13962_14142_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04207.1|14071_14911_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWA04208.1|14904_15252_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWA04209.1|15473_16337_-	carbapenem-hydrolyzing class A beta-lactamase GES-5	NA	A0A1B0VBP7	Salmonella_phage	39.0	5.6e-42
AWA04210.1|16516_17530_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWA04211.1|17498_17798_+|transposase	transposase	transposase	NA	NA	NA	NA
AWA04212.1|17802_18390_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	56.9	9.7e-54
AWA04233.1|18461_20129_+	modification methylase PaeR7I	NA	R4TFP1	Halovirus	24.4	6.2e-21
>prophage 1
CP028567	Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid pMCR5_045096, complete sequence	241090	1387	60517	241090	transposase,integrase	Escherichia_phage(22.22%)	54	16718:16734	58091:58107
AWA04277.1|1387_2929_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	3.2e-128
AWA04278.1|4476_6120_-	phosphoethanolamine--lipid A transferase MCR-5.1	NA	NA	NA	NA	NA
AWA04279.1|6138_6681_-	chromate resistance protein ChrB	NA	NA	NA	NA	NA
AWA04280.1|6920_7481_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.8e-50
AWA04281.1|7483_10453_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.6	0.0e+00
AWA04282.1|10488_10893_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04496.1|11012_12179_+|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	69.9	3.4e-151
AWA04283.1|12281_13457_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04284.1|13770_14016_+	plasmid replication protein RepB	NA	NA	NA	NA	NA
AWA04285.1|14120_14348_-	hypothetical protein	NA	NA	NA	NA	NA
AWA04286.1|14358_14757_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWA04287.1|14831_15182_+	mercury transporter MerT	NA	NA	NA	NA	NA
AWA04288.1|15194_15470_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
AWA04289.1|15477_15690_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04290.1|15702_18696_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	47.4	8.2e-258
16718:16734	attL	GACAGGGTGTCGTCGCG	NA	NA	NA	NA
AWA04291.1|18699_19110_-	PIN domain nuclease	NA	NA	NA	NA	NA
AWA04292.1|19109_19349_-	methionine repressor-like protein	NA	NA	NA	NA	NA
AWA04293.1|20041_22927_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.4e-190
AWA04294.1|23052_23667_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
AWA04295.1|23732_24536_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AWA04497.1|24535_25372_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AWA04296.1|25478_25955_+|transposase	transposase	transposase	NA	NA	NA	NA
AWA04297.1|26029_26890_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AWA04298.1|26902_27445_+	tunicamycin resistance protein	NA	NA	NA	NA	NA
AWA04299.1|27926_28118_-	hypothetical protein	NA	NA	NA	NA	NA
AWA04300.1|28123_28369_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04301.1|28419_29556_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
AWA04302.1|31613_33644_+	restriction endonuclease subunit M	NA	A0A220A2U5	Liberibacter_phage	25.3	8.9e-22
AWA04303.1|33640_34690_+	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	33.1	4.0e-34
AWA04304.1|34686_36012_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AWA04305.1|36008_39257_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
AWA04306.1|39249_40554_+|transposase	ISL3 family transposase ISSm4	transposase	A0A2D1GQC1	Lysinibacillus_phage	31.0	7.2e-57
AWA04498.1|41028_41250_-	resolvase	NA	NA	NA	NA	NA
AWA04307.1|41181_42486_+|integrase	integrase	integrase	NA	NA	NA	NA
AWA04308.1|42532_43237_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA04309.1|43426_44242_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AWA04310.1|44392_45097_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA04311.1|45587_46580_+|transposase	transposase	transposase	NA	NA	NA	NA
AWA04312.1|46548_47049_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWA04313.1|47067_47247_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04314.1|47176_48016_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWA04315.1|48009_48357_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWA04499.1|48520_49312_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AWA04500.1|49429_50296_-	PSE family carbenicillin-hydrolyzing class A beta-lactamase CARB-12	NA	A0A077SL40	Escherichia_phage	44.5	1.2e-55
AWA04316.1|50343_51905_-|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
AWA04317.1|52091_52646_-	aminoglycoside N-acetyltransferase AAC(6')-IIa	NA	NA	NA	NA	NA
AWA04318.1|52754_53228_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
AWA04319.1|53370_53703_-	quaternary ammonium compound efflux SMR transporter QacK	NA	NA	NA	NA	NA
AWA04320.1|53950_54607_-	quinolone resistance pentapeptide repeat protein QnrVC6	NA	NA	NA	NA	NA
AWA04321.1|54883_55438_-	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
AWA04322.1|55617_56631_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
AWA04323.1|56569_56860_+|transposase	transposase	transposase	NA	NA	NA	NA
AWA04501.1|56894_57488_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	49.7	1.2e-40
AWA04324.1|57484_60517_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
58091:58107	attR	CGCGACGACACCCTGTC	NA	NA	NA	NA
>prophage 2
CP028567	Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid pMCR5_045096, complete sequence	241090	72874	111966	241090	transposase	Acidithiobacillus_phage(40.0%)	33	NA	NA
AWA04338.1|72874_74416_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.2	3.2e-128
AWA04339.1|74430_75186_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.5	3.4e-59
AWA04340.1|75502_76561_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04341.1|76811_77774_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04342.1|77834_79685_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AWA04343.1|79941_80994_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04344.1|81109_81595_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04345.1|82112_83144_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
AWA04346.1|83560_84697_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
AWA04347.1|85538_85871_-	hypothetical protein	NA	NA	NA	NA	NA
AWA04348.1|86049_88050_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04349.1|88108_89383_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
AWA04350.1|89547_91209_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AWA04351.1|91171_91651_-	hypothetical protein	NA	NA	NA	NA	NA
AWA04352.1|91928_93065_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
AWA04353.1|93092_94046_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
AWA04354.1|94143_94638_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04355.1|94938_95955_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
AWA04356.1|96094_96766_+	phosphatase	NA	NA	NA	NA	NA
AWA04357.1|96859_97810_-|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
AWA04358.1|98132_99782_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AWA04359.1|99842_100487_-	fructose-6-phosphate aldolase	NA	NA	NA	NA	NA
AWA04360.1|100798_101749_+|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
AWA04361.1|102325_102883_+	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
AWA04362.1|102903_103884_+	PTS sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
AWA04363.1|103909_104275_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
AWA04364.1|104361_105138_+	sorbitol-6-phosphate dehydrogenase	NA	W8CYX9	Bacillus_phage	46.3	6.9e-07
AWA04365.1|105239_105596_+	transcriptional regulator	NA	NA	NA	NA	NA
AWA04366.1|105696_106461_+	transcriptional regulator	NA	NA	NA	NA	NA
AWA04367.1|106493_107459_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	33.1	1.6e-37
AWA04368.1|108577_109852_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
AWA04369.1|110008_110380_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04370.1|110697_111966_+|transposase	IS4 family transposase ISApu1	transposase	NA	NA	NA	NA
>prophage 3
CP028567	Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid pMCR5_045096, complete sequence	241090	136851	183850	241090	transposase,integrase	Saccharomonospora_phage(33.33%)	50	136011:136029	151838:151856
136011:136029	attL	TCGATCAGCCAATAACATC	NA	NA	NA	NA
AWA04393.1|136851_138417_-|transposase	IS21 family transposase ISAs27	transposase	K4I413	Acidithiobacillus_phage	45.8	2.9e-121
AWA04394.1|138585_139965_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AWA04395.1|139974_142572_+|integrase	integrase	integrase	NA	NA	NA	NA
AWA04396.1|142574_143234_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWA04397.1|143582_144632_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
AWA04398.1|144674_145682_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04399.1|146311_148909_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04400.1|149616_150375_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04401.1|150678_150936_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04402.1|151204_151492_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AWA04403.1|151479_151773_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWA04404.1|151908_153135_-|transposase	transposase	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
151838:151856	attR	GATGTTATTGGCTGATCGA	NA	NA	NA	NA
AWA04405.1|153192_153597_+|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	I4AZM1	Saccharomonospora_phage	54.4	1.1e-32
AWA04406.1|153655_154192_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04407.1|155194_155866_-	protein RepA	NA	A0A077SLP3	Escherichia_phage	35.7	1.0e-30
AWA04408.1|157092_157497_-	hypothetical protein	NA	NA	NA	NA	NA
AWA04502.1|157889_158096_-	hypothetical protein	NA	NA	NA	NA	NA
AWA04409.1|158164_158617_-	hypothetical protein	NA	NA	NA	NA	NA
AWA04410.1|158699_159167_-	hypothetical protein	NA	NA	NA	NA	NA
AWA04411.1|159503_159932_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04412.1|160009_160432_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04413.1|160550_160955_-|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	I4AZM1	Saccharomonospora_phage	54.4	1.1e-32
AWA04414.1|161012_162239_+|transposase	transposase	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
AWA04415.1|162255_162552_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04416.1|162961_163306_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04417.1|163691_164111_-	transcriptional regulator	NA	NA	NA	NA	NA
AWA04418.1|164295_164622_-	hypothetical protein	NA	NA	NA	NA	NA
AWA04419.1|164621_165005_-	hypothetical protein	NA	NA	NA	NA	NA
AWA04420.1|165689_165953_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04421.1|165980_166325_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04422.1|166401_166986_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04423.1|167272_167575_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04503.1|167940_168753_+	chromosome partitioning protein ParA	NA	Q8JL10	Natrialba_phage	30.4	1.9e-15
AWA04424.1|168759_169047_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04425.1|169962_170367_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	53.6	1.1e-32
AWA04426.1|170424_171651_+|transposase	transposase	transposase	O80301	Enterobacteria_phage	78.3	5.0e-153
AWA04427.1|171865_172381_-	hypothetical protein	NA	NA	NA	NA	NA
AWA04428.1|172787_174197_-	hypothetical protein	NA	NA	NA	NA	NA
AWA04429.1|175057_175390_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04430.1|175965_176349_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04431.1|176376_177786_-|transposase	transposase	transposase	I4AZI9	Saccharomonospora_phage	29.2	8.9e-29
AWA04432.1|177785_178088_-	hypothetical protein	NA	NA	NA	NA	NA
AWA04433.1|178166_178631_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	51.5	2.3e-34
AWA04434.1|178787_179441_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04435.1|179452_180019_+	single-stranded DNA-binding protein	NA	A0A2I7R8Y7	Vibrio_phage	70.7	4.2e-46
AWA04436.1|180072_180414_+	hypothetical protein	NA	A0A2I7R6Q9	Vibrio_phage	40.2	3.3e-06
AWA04437.1|180559_181195_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
AWA04438.1|181578_181944_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04439.1|182161_182566_-|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	I4AZM1	Saccharomonospora_phage	54.4	1.1e-32
AWA04440.1|182623_183850_+|transposase	transposase	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
