The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025950	Escherichia coli strain SCEC020023 chromosome, complete genome	4883927	1099891	1107031	4883927		Escherichia_phage(83.33%)	6	NA	NA
AUS37172.1|1099891_1100530_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AUS37173.1|1100526_1101789_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AUS37174.1|1101785_1102694_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
AUS37175.1|1102889_1103657_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
AUS37176.1|1103707_1104364_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
AUS37177.1|1104469_1107031_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
>prophage 2
CP025950	Escherichia coli strain SCEC020023 chromosome, complete genome	4883927	1143332	1230667	4883927	head,lysis,holin,plate,terminase,capsid,integrase,tail,portal,tRNA	Erwinia_phage(22.92%)	91	1167834:1167848	1213450:1213464
AUS37212.1|1143332_1145963_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
AUS37213.1|1146197_1146383_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AUS37214.1|1147674_1148241_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
AUS37215.1|1148237_1148666_+	DedA family protein	NA	NA	NA	NA	NA
AUS37216.1|1148738_1150295_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AUS37217.1|1150444_1150960_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
AUS37218.1|1151023_1152562_-	multidrug effux MFS transporter subunit EmrB	NA	NA	NA	NA	NA
AUS37219.1|1152578_1153751_-	multidrug export protein EmrA	NA	NA	NA	NA	NA
AUS37220.1|1153877_1154408_-	transcriptional regulator	NA	NA	NA	NA	NA
AUS37221.1|1154498_1154834_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
AUS37222.1|1154823_1155561_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUS37223.1|1155684_1156869_-	MFS transporter	NA	NA	NA	NA	NA
AUS37224.1|1157321_1158314_-	proline/glycine betaine ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
AUS37225.1|1158371_1159436_-	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
AUS37226.1|1159428_1160631_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
AUS37227.1|1160620_1160869_-	hypothetical protein	NA	NA	NA	NA	NA
AUS37228.1|1160987_1161947_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	7.0e-134
AUS37229.1|1161956_1164101_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	2.2e-196
AUS37230.1|1164082_1164484_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	3.4e-18
AUS37231.1|1164480_1164726_-	NrdH-redoxin	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
AUS37232.1|1164973_1165303_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
AUS37233.1|1165454_1165799_+	DUF2002 family protein	NA	NA	NA	NA	NA
AUS37234.1|1165835_1166285_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
AUS37235.1|1166951_1167356_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
AUS37236.1|1167402_1167927_-	rhodanese-like domain-containing protein YgaP	NA	NA	NA	NA	NA
1167834:1167848	attL	GAAGATATTCATCAG	NA	NA	NA	NA
AUS37237.1|1167936_1168236_-	transcriptional regulator	NA	NA	NA	NA	NA
AUS37238.1|1168418_1168577_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
AUS37239.1|1168660_1169110_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	39.5	2.6e-06
AUS37240.1|1169110_1169773_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
AUS37241.1|1169793_1171194_-	GABA permease	NA	NA	NA	NA	NA
AUS37242.1|1171431_1172712_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	2.1e-32
AUS37243.1|1172725_1174174_-	NADP-dependent succinate-semialdehyde dehydrogenase I	NA	NA	NA	NA	NA
AUS37244.1|1174196_1175465_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
AUS37245.1|1175484_1176462_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
AUS37246.1|1176798_1179051_-	hypothetical protein	NA	NA	NA	NA	NA
AUS37247.1|1179843_1180062_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	86.1	4.6e-33
AUS37248.1|1180101_1181295_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	78.4	1.3e-166
AUS37249.1|1181297_1181762_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	74.8	1.7e-61
AUS37250.1|1181773_1184203_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	67.8	7.6e-270
AUS37251.1|1184195_1184315_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	3.7e-13
AUS37252.1|1184347_1184629_-|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	79.1	4.7e-30
AUS37253.1|1184691_1185210_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	2.0e-71
AUS37254.1|1185222_1186410_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	80.5	2.6e-183
AUS37255.1|1186541_1186955_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	45.7	4.0e-22
AUS37256.1|1188123_1188735_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	83.1	1.8e-95
AUS37257.1|1188727_1189636_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	81.5	3.0e-134
AUS37258.1|1189640_1189988_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	71.3	4.3e-41
AUS37259.1|1189984_1190626_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	83.1	1.5e-95
AUS37260.1|1190741_1191827_+	hypothetical protein	NA	NA	NA	NA	NA
AUS37261.1|1191832_1192282_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	72.7	8.5e-50
AUS37262.1|1192274_1192742_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.7	1.7e-56
AUS37263.1|1192704_1192950_-|holin	holin	holin	S4TNY4	Salmonella_phage	71.8	9.4e-27
AUS37264.1|1192849_1193263_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	67.2	5.4e-43
AUS37265.1|1193259_1193769_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.6	4.6e-76
AUS37266.1|1193752_1193974_-	primosomal protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
AUS37267.1|1193964_1194168_-|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
AUS37268.1|1194167_1194668_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	2.9e-59
AUS37269.1|1194765_1195524_-|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	66.3	1.3e-79
AUS37270.1|1195527_1196688_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	63.1	2.5e-130
AUS37271.1|1196709_1197573_-|capsid	capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	66.2	3.4e-103
AUS37272.1|1197737_1199507_+	oxidoreductase	NA	A0A0M4RE51	Salmonella_phage	80.5	1.9e-286
AUS37273.1|1199506_1200544_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	79.0	5.9e-163
AUS37274.1|1201010_1202228_-	acyltransferase	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	29.6	4.4e-32
AUS40616.1|1202516_1202699_-	Tum protein	NA	A0A218M4I0	Erwinia_phage	75.9	3.2e-16
AUS37275.1|1202842_1205083_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	92.5	0.0e+00
AUS37276.1|1205096_1205405_-	DUF3850 domain-containing protein	NA	A0A1S6KVH3	Escherichia_phage	43.2	1.6e-07
AUS37277.1|1205401_1205629_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	70.7	4.8e-25
AUS37278.1|1205628_1205856_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	90.7	2.3e-27
AUS37279.1|1205925_1206126_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	89.4	1.1e-28
AUS37280.1|1206112_1206340_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	92.0	1.6e-33
AUS37281.1|1206347_1206857_-	hypothetical protein	NA	A0A0M4QWN1	Salmonella_phage	98.8	1.2e-89
AUS37282.1|1206887_1207151_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
AUS37283.1|1207283_1207859_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	65.4	1.2e-67
AUS37284.1|1207858_1208863_+|integrase	site-specific integrase	integrase	A0A218M4I3	Erwinia_phage	97.6	2.2e-191
AUS37285.1|1208873_1210337_-	hypothetical protein	NA	NA	NA	NA	NA
AUS37286.1|1211383_1212838_+	hypothetical protein	NA	NA	NA	NA	NA
AUS40617.1|1213291_1213435_+	hypothetical protein	NA	NA	NA	NA	NA
AUS37287.1|1219860_1220343_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	5.2e-29
1213450:1213464	attR	GAAGATATTCATCAG	NA	NA	NA	NA
AUS37288.1|1220474_1220951_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
AUS37289.1|1220940_1221231_+	RnfH family protein	NA	NA	NA	NA	NA
AUS37290.1|1221292_1221634_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AUS37291.1|1221782_1223444_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AUS37292.1|1223529_1224408_-	NAD(+) kinase	NA	NA	NA	NA	NA
AUS40618.1|1224339_1224534_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
AUS37293.1|1224530_1225124_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUS40619.1|1225178_1226420_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AUS40620.1|1226485_1227277_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AUS37294.1|1227443_1228805_+	signal recognition particle protein	NA	NA	NA	NA	NA
AUS37295.1|1229053_1229302_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUS37296.1|1229320_1229869_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUS37297.1|1229899_1230667_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
CP025950	Escherichia coli strain SCEC020023 chromosome, complete genome	4883927	1514521	1602142	4883927	transposase,holin,tRNA,terminase,tail,portal,protease	Enterobacteria_phage(48.08%)	95	NA	NA
AUS37540.1|1514521_1514713_-	AlpA family transcriptional regulator	NA	E5E3Y1	Burkholderia_phage	49.0	4.2e-06
AUS40631.1|1514869_1515616_-	hypothetical protein	NA	NA	NA	NA	NA
AUS37541.1|1515617_1516904_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	37.3	3.2e-65
AUS37542.1|1517156_1517357_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AUS37543.1|1517488_1517794_-	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	2.6e-50
AUS37544.1|1517793_1518156_-	hypothetical protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
AUS37545.1|1518146_1518683_-	HD family hydrolase	NA	U5P0T3	Shigella_phage	99.4	3.7e-100
AUS37546.1|1518810_1519635_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AUS37547.1|1519700_1520063_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
AUS37548.1|1520135_1520360_+	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	63.1	3.2e-13
AUS37549.1|1520268_1520613_+	hypothetical protein	NA	U5P0J5	Shigella_phage	96.5	4.1e-60
AUS37550.1|1520531_1520966_+	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
AUS37551.1|1520937_1521159_-	hypothetical protein	NA	NA	NA	NA	NA
AUS37552.1|1521391_1522018_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
AUS37553.1|1522115_1522316_+	cell division protein	NA	NA	NA	NA	NA
AUS40632.1|1522353_1522905_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
AUS37554.1|1522852_1523053_+	hypothetical protein	NA	NA	NA	NA	NA
AUS37555.1|1523080_1523260_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AUS37556.1|1523249_1524191_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
AUS37557.1|1524187_1524682_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	8.6e-88
AUS37558.1|1524648_1525008_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	3.5e-54
AUS37559.1|1525004_1525394_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	100.0	5.4e-69
AUS37560.1|1525413_1526223_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	1.8e-151
AUS37561.1|1526230_1527220_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	5.6e-195
AUS37562.1|1527234_1527600_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	90.0	4.5e-57
AUS37563.1|1527804_1528800_-|protease	serine protease	protease	NA	NA	NA	NA
AUS37564.1|1529254_1529581_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
AUS37565.1|1529584_1530061_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	94.3	1.1e-82
AUS37566.1|1530277_1530460_+	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	98.3	7.2e-16
AUS37567.1|1530550_1530844_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AUS37568.1|1531524_1532064_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	99.4	4.0e-94
AUS37569.1|1532072_1534172_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.4	0.0e+00
AUS37570.1|1534168_1534381_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	3.2e-31
AUS37571.1|1534380_1535856_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	2.0e-281
AUS37572.1|1535833_1537861_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.4	0.0e+00
AUS37573.1|1537902_1538271_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	9.7e-52
AUS37574.1|1538263_1538539_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AUS37575.1|1538550_1539129_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
AUS37576.1|1539125_1539527_+|tail	phage tail protein	tail	K7PJP5	Enterobacteria_phage	100.0	1.1e-72
AUS37577.1|1539537_1540281_+|tail	phage tail protein	tail	K7PGT7	Enterobacteria_phage	100.0	1.6e-133
AUS40633.1|1540341_1540728_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
AUS37578.1|1540736_1541066_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AUS37579.1|1541037_1544112_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	94.7	0.0e+00
AUS37580.1|1544108_1544438_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AUS37581.1|1544437_1545136_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
AUS37582.1|1545140_1545884_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
AUS37583.1|1545781_1546423_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.0	7.8e-97
AUS37584.1|1546900_1550314_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.5	0.0e+00
AUS37585.1|1550384_1550984_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.0	2.4e-108
AUS37586.2|1555366_1556290_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
AUS37587.1|1556943_1558104_-	DUF4102 domain-containing protein	NA	A5VW56	Enterobacteria_phage	99.0	2.5e-218
AUS37588.1|1558415_1559348_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
AUS37589.1|1559445_1559616_+	hypothetical protein	NA	NA	NA	NA	NA
AUS37590.1|1559641_1560397_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AUS37591.1|1560575_1561823_-	hypothetical protein	NA	NA	NA	NA	NA
AUS37592.1|1562188_1563529_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AUS37593.1|1563564_1563816_+	hypothetical protein	NA	NA	NA	NA	NA
AUS37594.1|1563900_1564185_+	DUF406 family protein	NA	NA	NA	NA	NA
AUS37595.1|1564365_1565676_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AUS37596.1|1565675_1567820_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AUS37597.1|1568022_1568508_+	phosphohistidine phosphatase	NA	NA	NA	NA	NA
AUS37598.1|1569169_1569736_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AUS37599.1|1569819_1572459_+	outer membrane usher protein	NA	NA	NA	NA	NA
AUS37600.1|1572478_1573228_+	fimbrial protein	NA	NA	NA	NA	NA
AUS37601.1|1573243_1573735_+	hypothetical protein	NA	NA	NA	NA	NA
AUS37602.1|1573731_1574211_+	fimbrial protein	NA	NA	NA	NA	NA
AUS37603.1|1574207_1574753_+	fimbrial protein	NA	NA	NA	NA	NA
AUS37604.1|1574754_1575618_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
AUS37605.1|1575687_1576239_-	endonuclease SmrB	NA	NA	NA	NA	NA
AUS37606.1|1576404_1577337_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUS37607.1|1577371_1578457_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
AUS37608.1|1578460_1579285_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AUS37609.1|1579284_1580094_+	hypothetical protein	NA	NA	NA	NA	NA
AUS37610.1|1580093_1580642_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AUS37611.1|1580675_1580954_+	YfcL family protein	NA	NA	NA	NA	NA
AUS37612.1|1581009_1583016_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AUS37613.1|1583174_1584395_+	3-oxoacyl-ACP synthase I	NA	NA	NA	NA	NA
AUS37614.1|1584670_1585849_+	arabinose transporter	NA	NA	NA	NA	NA
AUS37615.1|1585845_1586841_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AUS37616.1|1586939_1588076_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	2.0e-23
AUS37617.1|1588141_1589155_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUS37618.1|1589154_1589967_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AUS37619.1|1590049_1590709_+	DedA family protein	NA	NA	NA	NA	NA
AUS37620.1|1590864_1591779_+	acetyl-CoA carboxylase carboxyl transferase subunit beta	NA	NA	NA	NA	NA
AUS37621.1|1591848_1593117_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AUS37622.1|1593106_1593757_+	cell division protein DedD	NA	NA	NA	NA	NA
AUS37623.1|1594015_1594504_+	colicin V production protein	NA	NA	NA	NA	NA
AUS37624.1|1594540_1596058_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
AUS37625.1|1596152_1596722_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
AUS37626.1|1596987_1597770_+	lysine/arginine/ornithine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUS37627.1|1597990_1598773_+	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
AUS37628.1|1598862_1599549_+	histidine ABC transporter permease HisQ	NA	NA	NA	NA	NA
AUS37629.1|1599545_1600262_+	histidine ABC transporter permease	NA	NA	NA	NA	NA
AUS37630.1|1600269_1601043_+	histidine transport ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
AUS37631.1|1601239_1602142_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	44.2	2.4e-67
>prophage 4
CP025950	Escherichia coli strain SCEC020023 chromosome, complete genome	4883927	1898639	1905068	4883927		Enterobacteria_phage(33.33%)	6	NA	NA
AUS37875.1|1898639_1900046_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
AUS37876.1|1900269_1901334_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	7.5e-105
AUS37877.1|1901360_1902230_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	3.4e-111
AUS37878.1|1902261_1903152_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.6	5.6e-29
AUS37879.1|1903166_1903721_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	3.3e-51
AUS37880.1|1903901_1905068_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	7.0e-112
>prophage 5
CP025950	Escherichia coli strain SCEC020023 chromosome, complete genome	4883927	2800548	2855633	4883927	head,protease,portal,holin,terminase,capsid,integrase,tail,transposase,tRNA	Escherichia_phage(41.67%)	68	2808740:2808754	2855735:2855749
AUS38691.1|2800548_2801655_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUS40694.1|2801690_2802332_+	lysogenization protein HflD	NA	NA	NA	NA	NA
AUS38692.1|2802335_2803706_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
AUS38693.1|2803874_2804546_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AUS38694.1|2804545_2806006_+	sensor protein PhoQ	NA	NA	NA	NA	NA
AUS38695.1|2806081_2807203_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AUS38696.1|2807251_2808478_-	peptidase T	NA	NA	NA	NA	NA
AUS40695.1|2808533_2808749_+	hypothetical protein	NA	NA	NA	NA	NA
AUS38697.1|2808727_2809864_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2808740:2808754	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
AUS38698.1|2809847_2810711_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AUS40696.1|2811307_2811934_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUS38699.1|2812048_2813262_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
AUS38700.1|2813484_2814015_-|tail	tail fiber domain-containing protein	tail	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
AUS38701.1|2814016_2815229_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
AUS38702.1|2818620_2819220_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
AUS38703.1|2819287_2822767_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
AUS38704.1|2822827_2823475_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	2.6e-108
AUS38705.1|2823372_2824116_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
AUS38706.1|2824121_2824820_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
AUS38707.1|2824819_2825176_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
AUS38708.1|2825153_2828381_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
AUS40697.1|2828427_2828688_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
AUS38709.1|2828729_2829116_-|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
AUS38710.1|2829115_2829820_-|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
AUS38711.1|2829880_2830225_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
AUS38712.1|2830221_2830671_-	hypothetical protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
AUS38713.1|2830667_2831006_-|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
AUS38714.1|2831014_2831332_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
AUS38715.1|2831408_2832626_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
AUS38716.1|2832640_2833240_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
AUS38717.1|2833232_2834459_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
AUS38718.1|2834606_2836364_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
AUS38719.1|2836363_2836846_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
AUS38720.1|2836992_2837343_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
AUS38721.1|2837635_2837776_-	Rz1 lytic protein	NA	U5P461	Shigella_phage	84.6	1.0e-09
AUS38722.1|2837868_2838162_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
AUS38723.1|2838252_2838435_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
AUS38724.1|2838487_2838715_+	hypothetical protein	NA	NA	NA	NA	NA
AUS38725.1|2838651_2839185_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
AUS38726.1|2839248_2839599_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
AUS38727.1|2839603_2839819_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
AUS38728.1|2839968_2840130_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
AUS38729.1|2840126_2840315_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
AUS38730.1|2840575_2840911_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
AUS38731.1|2840981_2841194_+	hypothetical protein	NA	NA	NA	NA	NA
AXF46285.1|2841682_2841769_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AUS38732.1|2842163_2842985_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
AUS38733.1|2842981_2843362_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
AUS38734.1|2843362_2844421_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
AUS38735.1|2844422_2844701_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
AUS38736.1|2844868_2845081_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
AUS38737.1|2845283_2845463_-	hypothetical protein	NA	NA	NA	NA	NA
AUS38738.1|2846115_2846298_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
AUS38739.1|2846391_2846748_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
AUS38740.1|2846805_2847228_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
AUS38741.1|2847268_2848339_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	56.1	7.4e-52
AUS38742.1|2848410_2848836_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AUS38743.1|2848819_2849062_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
AUS40698.1|2849267_2849792_+	LexA family transcriptional repressor	NA	H9C160	Pectobacterium_phage	28.0	2.2e-12
AUS38744.1|2850003_2850162_+	hypothetical protein	NA	NA	NA	NA	NA
AUS38745.1|2850145_2850445_+	hypothetical protein	NA	NA	NA	NA	NA
AUS38746.1|2850516_2850735_+	hypothetical protein	NA	NA	NA	NA	NA
AUS38747.1|2850699_2850954_-	hypothetical protein	NA	NA	NA	NA	NA
AUS38748.1|2851303_2851492_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AUS38749.1|2851488_2851680_+	DUF1482 family protein	NA	NA	NA	NA	NA
AUS38750.1|2851773_2854215_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
AUS38751.1|2854276_2854546_+	excisionase	NA	NA	NA	NA	NA
AUS38752.1|2854514_2855633_+|integrase	integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
2855735:2855749	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 6
CP025950	Escherichia coli strain SCEC020023 chromosome, complete genome	4883927	3748549	3848683	4883927	head,lysis,transposase,holin,terminase,capsid,integrase,tail,portal	Enterobacteria_phage(30.3%)	109	3792948:3792995	3844780:3844827
AUS39564.1|3748549_3749822_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.3e-177
AUS39565.1|3750085_3750826_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
AUS39566.1|3750971_3751319_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUS39567.1|3751409_3752528_-	hypothetical protein	NA	NA	NA	NA	NA
AUS39568.1|3753389_3754565_-	hypothetical protein	NA	NA	NA	NA	NA
AUS39569.1|3754941_3755172_-	hypothetical protein	NA	NA	NA	NA	NA
AUS40730.1|3755128_3755524_+	hypothetical protein	NA	NA	NA	NA	NA
AUS39570.1|3755557_3755767_+	hypothetical protein	NA	NA	NA	NA	NA
AUS39571.1|3756254_3756470_-	hypothetical protein	NA	NA	NA	NA	NA
AUS39572.1|3756944_3757562_-	hypothetical protein	NA	NA	NA	NA	NA
AUS39573.1|3757640_3757847_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AUS39574.1|3757818_3758016_-	hypothetical protein	NA	NA	NA	NA	NA
AUS39575.1|3758518_3758707_-	hypothetical protein	NA	NA	NA	NA	NA
AUS39576.1|3759400_3759772_-	hypothetical protein	NA	NA	NA	NA	NA
AUS39577.1|3760065_3761589_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AUS39578.1|3762682_3762823_-	hemolysin activation protein	NA	NA	NA	NA	NA
AUS40731.1|3762909_3763032_-	hemolysin expression modulating protein	NA	NA	NA	NA	NA
AUS39579.1|3763118_3763310_-	hypothetical protein	NA	NA	NA	NA	NA
AUS39580.1|3764921_3766445_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AUS39581.1|3766738_3767110_+	hypothetical protein	NA	NA	NA	NA	NA
AUS39582.1|3768607_3768997_+	hypothetical protein	NA	NA	NA	NA	NA
AUS39583.1|3768993_3769419_+	hypothetical protein	NA	NA	NA	NA	NA
AUS39584.1|3770871_3771243_-	hypothetical protein	NA	NA	NA	NA	NA
AUS39585.1|3771536_3773060_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AXF46283.1|3773588_3773807_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	100.0	5.6e-07
AUS39586.1|3774225_3774576_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AUS39587.1|3774588_3776181_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
AUS40732.1|3776280_3777237_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
AUS39588.1|3777486_3779040_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	22.2	2.9e-12
AUS39589.1|3779033_3780080_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
AUS39590.1|3780079_3781078_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
AUS39591.1|3781104_3782127_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
AUS39592.1|3782155_3783031_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
AUS39593.1|3783079_3783370_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
AUS39594.1|3783380_3784124_+	epimerase	NA	NA	NA	NA	NA
AUS40733.1|3784498_3784756_+	hypothetical protein	NA	NA	NA	NA	NA
AUS40734.1|3784977_3785106_+	chemotaxis protein	NA	NA	NA	NA	NA
AUS39595.1|3787380_3788451_-	hypothetical protein	NA	NA	NA	NA	NA
AUS39596.1|3788428_3790135_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AUS39597.1|3790127_3791336_-	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
AUS39598.1|3791577_3792786_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	56.5	7.7e-130
3792948:3792995	attL	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AUS39599.1|3793060_3793213_-	hypothetical protein	NA	NA	NA	NA	NA
AUS39600.2|3793932_3794856_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
AUS39601.1|3794892_3795654_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	33.2	2.2e-21
AUS39602.1|3795646_3796045_+	hypothetical protein	NA	NA	NA	NA	NA
AUS39603.1|3796044_3796710_+	hypothetical protein	NA	NA	NA	NA	NA
AUS39604.1|3797505_3799077_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
AUS39605.1|3799096_3799444_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AUS39606.1|3799443_3800121_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AUS39607.1|3800347_3802237_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AUS39608.1|3802839_3803871_-	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	37.3	1.2e-11
AUS39609.1|3807728_3808328_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	98.0	7.5e-110
AUS39610.1|3808394_3811793_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	88.1	0.0e+00
AUS39611.1|3811853_3812495_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	7.3e-95
AUS39612.1|3812392_3813136_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	2.6e-144
AUS39613.1|3813141_3813840_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.0	2.2e-129
AUS39614.1|3813839_3814169_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	1.1e-57
AUS39615.1|3814165_3816727_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.4	0.0e+00
AUS39616.1|3816719_3817154_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
AUS39617.1|3817135_3817558_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	1.9e-72
AUS40735.1|3817573_3818314_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	2.1e-130
AUS39618.1|3818321_3818717_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
AUS39619.1|3818713_3819292_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	5.9e-80
AUS39620.1|3819303_3819657_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	4.4e-62
AUS39621.1|3819668_3820064_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	90.9	1.2e-52
AUS39622.1|3820105_3821131_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	96.8	2.9e-186
AUS39623.1|3821186_3821519_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
AUS39624.1|3821528_3822848_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	1.5e-232
AUS39625.1|3822828_3824430_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	9.4e-309
AUS39626.1|3824426_3824633_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AUS39627.1|3824629_3826555_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
AUS39628.1|3826529_3827075_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
AUS39629.1|3827214_3827358_-	DNA-packaging protein	NA	NA	NA	NA	NA
AUS39630.1|3827463_3827697_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
AUS39631.1|3827753_3828164_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
AUS39632.1|3828209_3828374_+	hypothetical protein	NA	NA	NA	NA	NA
AUS39633.1|3828514_3828667_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
AUS39634.1|3828654_3829092_-|lysis	lysis protein	lysis	Q716B4	Shigella_phage	95.9	3.0e-68
AUS39635.1|3829088_3829565_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	95.5	1.9e-84
AUS40736.1|3829568_3829904_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	100.0	5.2e-60
AUS39636.1|3829980_3831033_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.0	2.4e-204
AUS39637.1|3831183_3831387_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
AUS39638.1|3831651_3832578_+	hypothetical protein	NA	NA	NA	NA	NA
AUS39639.1|3832564_3833113_+	hypothetical protein	NA	NA	NA	NA	NA
AUS39640.1|3833125_3833467_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
AUS39641.1|3833484_3834474_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.4e-193
AUS39642.1|3834481_3835279_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	2.0e-150
AUS39643.1|3835298_3835688_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	98.4	1.0e-67
AUS39644.1|3835684_3836044_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	1.7e-53
AUS39645.1|3836010_3836505_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	96.3	2.8e-86
AUS39646.1|3836501_3837443_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.0	5.6e-152
AUS39647.1|3837432_3837612_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AUS39648.1|3837787_3838339_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
AUS39649.1|3838331_3838592_-	XRE family transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
AUS39650.1|3838689_3839382_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
AUS39651.1|3839706_3839928_+	hypothetical protein	NA	NA	NA	NA	NA
AUS39652.1|3839899_3840334_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
AUS39653.1|3840252_3840597_-	hypothetical protein	NA	U5P0J5	Shigella_phage	96.5	4.1e-60
AUS39654.1|3840505_3840730_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	63.1	3.2e-13
AUS39655.1|3840802_3841165_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
AUS39656.1|3841230_3842055_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AUS39657.1|3842182_3842719_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	99.4	3.7e-100
AUS39658.1|3842709_3843072_+	hypothetical protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
AUS39659.1|3843071_3843377_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
AUS39660.1|3843376_3843727_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
AUS40737.1|3843828_3844767_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	4.7e-183
AUS39661.1|3844971_3846225_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3844780:3844827	attR	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AUS39662.1|3846236_3847340_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AUS39663.1|3847627_3848683_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	1.6e-118
>prophage 7
CP025950	Escherichia coli strain SCEC020023 chromosome, complete genome	4883927	4223166	4249897	4883927	holin,transposase	Escherichia_phage(22.22%)	22	NA	NA
AUS39996.1|4223166_4224552_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	1.9e-257
AUS39997.1|4224790_4226164_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
AUS39998.1|4226527_4226737_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.9e-06
AUS39999.1|4226899_4227157_-	biofilm development YmgB/AriR family protein	NA	NA	NA	NA	NA
AUS40000.1|4228907_4229429_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AUS40001.1|4229425_4230379_+	fec operon regulator FecR	NA	NA	NA	NA	NA
AUS40002.1|4230465_4232790_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUS40003.1|4232834_4233737_+	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AUS40004.1|4233733_4234732_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
AUS40005.1|4234728_4235685_+	iron-dicitrate ABC transporter permease FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AUS40006.1|4235685_4236453_+	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AUS40007.1|4237010_4237424_-	hypothetical protein	NA	NA	NA	NA	NA
AUS40008.1|4237918_4239442_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AUS40009.1|4239735_4240173_+	hypothetical protein	NA	NA	NA	NA	NA
AUS40010.1|4241023_4241845_+	carbohydrate transporter	NA	NA	NA	NA	NA
AUS40011.1|4243099_4244239_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
AUS40012.1|4244386_4246390_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AUS40013.1|4246334_4246493_+|holin	choline transporter	holin	NA	NA	NA	NA
AUS40014.1|4246452_4247730_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AUS40015.1|4248009_4249172_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AUS40016.1|4249238_4249457_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUS40017.1|4249507_4249897_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.2	1.9e-61
>prophage 1
CP025944	Escherichia coli strain SCEC020023 plasmid pOXA10_020023, complete sequence	89048	9872	65839	89048	integrase,transposase	Escherichia_phage(40.91%)	53	NA	NA
AUS35974.2|9872_10796_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	1.8e-171
AUS35975.1|11153_11675_-	hypothetical protein	NA	NA	NA	NA	NA
AUS35976.1|13188_14673_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.8e-32
AUS35977.1|14672_14924_-	hypothetical protein	NA	NA	NA	NA	NA
AUS35978.1|15081_15513_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
AUS35979.1|15512_16784_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.0	1.1e-150
AUS35980.1|16865_17843_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
AUS35981.1|17839_19045_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
AUS35982.1|19459_19729_+	hypothetical protein	NA	NA	NA	NA	NA
AUS35983.1|20085_20913_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AUS35984.1|21051_21240_+	hypothetical protein	NA	NA	NA	NA	NA
AWX42338.1|23142_23400_+	hypothetical protein	NA	NA	NA	NA	NA
AWX42339.1|23457_24234_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
AWX42340.1|24230_24974_-	hypothetical protein	NA	NA	NA	NA	NA
AWX42341.1|25024_25375_-	hypothetical protein	NA	NA	NA	NA	NA
AWX42342.1|25768_26842_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
AWX42343.1|27134_28049_+	hypothetical protein	NA	NA	NA	NA	NA
AWX42344.1|28303_28534_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AWX42345.1|28530_28947_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AWX42392.1|28992_29118_+	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	97.2	3.9e-13
AWX42346.1|29155_30172_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
AWX42347.1|30336_33402_-	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	26.0	3.6e-06
AWX42348.1|33394_34417_-	tetrathionate reductase subunit TtrC	NA	NA	NA	NA	NA
AWX42393.1|34417_35170_-	tetrathionate reductase subunit TtrB	NA	NA	NA	NA	NA
AWX42349.1|35379_37113_+	sensor histidine kinase	NA	NA	NA	NA	NA
AWX42350.1|37087_37672_+	two-component system response regulator TtrR	NA	NA	NA	NA	NA
AWX42351.1|37764_37968_+	fumarate hydratase FumD	NA	NA	NA	NA	NA
AWX42394.1|38981_40538_-	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.1e-83
AWX42352.1|41329_41671_-	RamA family antibiotic efflux transcriptional regulator	NA	D0R0F8	Streptococcus_phage	29.8	2.0e-06
AWX42353.1|42135_42333_-	hypothetical protein	NA	NA	NA	NA	NA
AWX42354.1|42334_43912_+	hypothetical protein	NA	NA	NA	NA	NA
AWX42355.1|44011_44251_+	hypothetical protein	NA	NA	NA	NA	NA
AWX42356.1|44227_44824_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.7	7.1e-36
AWX42357.1|44880_45585_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWX42358.1|47312_48029_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	2.4e-139
AWX42359.1|48263_48737_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
AWX42395.1|48811_49603_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AWX42360.1|49619_50420_-	oxacillin-hydrolyzing class D beta-lactamase OXA-10	NA	NA	NA	NA	NA
AWX42361.1|50684_51944_-	chloramphenicol efflux MFS transporter CmlA5	NA	S4TR35	Salmonella_phage	31.7	1.7e-26
AWX42362.1|52264_52717_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
AWX42363.1|52889_53534_+|integrase	DNA integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	36.9	2.5e-18
AWX42364.1|53424_54129_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWX42365.1|55612_55855_+	relaxase	NA	NA	NA	NA	NA
AWX42366.1|55886_56564_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWX42367.1|56642_57842_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AWX42368.1|57873_58758_-	EamA family transporter	NA	NA	NA	NA	NA
AWX42369.1|58849_59554_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWX42396.1|59626_59851_+	hypothetical protein	NA	NA	NA	NA	NA
AWX42370.1|60061_61555_+|transposase	IS91-like element ISVsa3 family transposase	transposase	NA	NA	NA	NA
AWX42371.1|61585_62470_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AWX42372.1|62686_63901_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
AWX42373.1|63928_64234_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWX42374.1|64345_65839_+|transposase	IS91-like element ISVsa3 family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP025949	Escherichia coli strain SCEC020023 plasmid pRmtB_020023, complete sequence	73313	8540	16481	73313	transposase	Escherichia_phage(50.0%)	8	NA	NA
AUS36074.1|8540_9245_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AUS36075.1|9549_10107_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AUS36076.1|10289_11150_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AUS36077.1|11319_12075_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
AUS36078.1|12200_12905_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUS36079.1|13956_14433_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AUS36080.1|14479_15355_-	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
AUS36081.1|15776_16481_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
